Small-molecule nucleic acid drugs interfering with cancer-specific linc00942 and application thereof in liver cancer targeted therapy
By designing a siRNA that specifically targets LINC00942 and conjugates it with GalNAc, the problem of siRNA delivery was solved, enabling targeted therapy of liver cancer cells and effectively inhibiting liver cancer growth and metastasis.
Patent Information
- Application Number
- CN202510213517.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-26
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-02-26
AI Technical Summary
In existing technologies, the targeting and effectiveness of siRNA delivery to tumor cells are difficult to achieve, resulting in poor treatment outcomes for liver cancer.
We designed a specific siRNA sequence targeting LINC00942 and coupled it with a GalNAc ligand. By utilizing the binding of GalNAc to the ASGPR receptor on the surface of hepatocytes, we achieved precise delivery of the siRNA.
Effectively silencing LINC00942, which is highly expressed in liver cancer cells, significantly inhibits the growth and metastasis of liver cancer cells, providing a novel targeted therapy strategy for liver cancer.
Smart Images

Figure CN120284998B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of tumor treatment, in particular to a small-molecule nucleic acid drug for intervening cancer-specific LINC00942 and its application in liver cancer targeted therapy. BACKGROUND
[0002] Long non-coding RNAs (lncRNAs) are a class of RNA molecules that are widely present in the human genome but do not encode proteins, usually with a length of more than 200 nucleotides. lncRNAs play complex and diverse roles in biology, although they do not directly translate into proteins, they have important functions in the regulation of gene expression, cell differentiation, developmental processes, and the occurrence and development of various diseases. Through interactions with DNA, RNA, or proteins, lncRNAs can affect gene transcription, RNA processing, translation, and protein localization and function. Recent research has revealed that lncRNAs exhibit abnormal expression patterns in a variety of conditions such as cancer, cardiovascular disease, neurodegenerative disease, and immune system disorders, making them potential biomarkers and therapeutic targets. The diversity and functional complexity of lncRNAs make the study of this field challenging, but at the same time, it provides a huge opportunity to decode unknown details in life processes and brings new hope for precision medicine.
[0003] Studies have shown that many lncRNAs are abnormally expressed in tumors. These abnormally expressed lncRNAs can promote the occurrence and development of tumors in various ways, such as regulating the expression of tumor-related genes, affecting the proliferation and survival of tumor cells, and regulating the immune escape of tumors. Therefore, intervention and regulation of the expression of these lncRNAs closely related to tumors are considered a promising new strategy for tumor treatment. At present, various methods have been developed to intervene in the expression of lncRNAs, including RNA interference (RNAi), antisense RNA (ASO), aptamer, ribozyme, and small molecule inhibitors. These methods can regulate the expression of lncRNAs by degrading lncRNA transcripts, blocking the binding of transcription factors to the promoter of lncRNA genes, interfering with the interaction of lncRNAs with proteins, DNA, RNA, or complexes. However, there are still many challenges in effectively interfering with these lncRNAs for treatment, such as off-target effects, immunogenicity, delivery efficiency, drug resistance, etc. In order to solve these problems, the development of targeted delivery technology becomes crucial. By using targeted delivery technology, therapeutic agents can be specifically delivered to tumor cells, thereby improving treatment efficacy and reducing side effects. Among them, N-acetylgalactosamine (GalNAc) has a high affinity with hepatocyte-specific asialoglycoprotein receptor (ASGPR). By combining GalNAc with siRNA, a GalNAc-siRNA complex can be formed, which can be specifically delivered to liver cells. This delivery method can achieve precise regulation of lncRNA expression, thereby providing a new strategy for tumor treatment.
[0004] RNA interference technology (RNAi) uses siRNA molecules to silence specific genes and has become a new hope for the treatment of various diseases. However, there are still challenges in effectively delivering siRNA to target cells and making it work.
[0005] Based on this, the present inventors expect to use the pro-cancer long non-coding RNA LINC00942 highly expressed in liver cancer as a potential target for liver cancer treatment, design an siRNA sequence that specifically targets LINC00942, and conjugate it with a GalNAc ligand. Since GalNAc can bind to the ASGPR receptor specifically expressed on the surface of hepatocytes, the siRNA conjugate can be accurately delivered into hepatocytes. This method effectively solves the problem of siRNA delivery and achieves specific silencing of LINC00942, thereby achieving the purpose of inhibiting the growth of liver cancer cells.
[0006] In addition, the present inventors expect to provide a new method for treating liver cancer by using a GalNAc-mediated siRNA delivery system to specifically silence LINC00942 highly expressed in liver cancer, achieving the effect of targeted therapy for liver cancer. SUMMARY
[0007] In order to overcome the deficiencies of the prior art, the purpose of the present application is to provide a small molecule nucleic acid drug intervening cancer-specific LINC00942 and its application in liver cancer targeted therapy.
[0008] In order to achieve the above-mentioned purpose, the present application provides an application of siRNA targeting LINC00942 in the preparation of a liver cancer drug.
[0009] Preferably, the targeting sequence of the siRNA comprises the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.
[0010] Preferably, the sense strand of the siRNA comprises the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4, and the antisense strand of the siRNA comprises the sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6; preferably, the nucleic acid on the sense strand or the antisense strand of the siRNA comprises 2'-OMe modification (i2OMe) and fluorination modification (i2F).
[0011] Preferably, the 3' end of the siRNA is coupled with trivalent GalNAc.
[0012] In addition, the present application also discloses siRNA targeting LINC00942, wherein the targeting sequence of the siRNA comprises the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.
[0013] Preferably, the nucleic acid on the sense strand or the antisense strand of the siRNA comprises 2'-OMe modification (i2OMe) and fluorination modification (i2F).
[0014] Preferably, the 3' end of the siRNA is coupled with trivalent GalNAc.
[0015] Furthermore, the present application discloses an application of a reagent for detecting the level of LINC00942 in the preparation of a liver cancer prognosis evaluation kit.
[0016] Preferably, the reagent comprises primers and / or probes for detecting LINC00942.
[0017] Preferably, the primers for detecting LINC00942 are shown in SEQ ID NO: 7 and 8.
[0018] It should be noted that in the technical solutions described in the present application, the present application identifies a long non-coding RNA (LINC00942) which is specifically highly expressed in liver cancer tissues and has a cancer-promoting function, and uses it as a potential target for liver cancer treatment. For this target, a specific siRNA is designed to silence the expression of LINC00942, and by coupling with a GalNAc ligand, a GalNAc-siLINC00942 conjugate is constructed to achieve targeted delivery to liver cancer cells. In vivo experiments were carried out by liver orthotopic xenograft tumor model, and the results showed that the tumor growth and metastasis ability of mice receiving GalNAc-siLINC00942 treatment were significantly reduced. The study shows that using GalNAc-siRNA technology to target LINC00942 which is specifically highly expressed in liver cancer cells can effectively inhibit the occurrence and development of liver cancer, and provides a new strategy for targeted therapy of liver cancer.
[0019] Compared with the prior art, the above at least one technical solution adopted by the embodiments of the present application can achieve at least the following beneficial effects:
[0020] The present application finds a cancer-promoting long non-coding RNA LINC00942 which is highly expressed in liver cancer, and uses it as a potential target for liver cancer treatment. A specific siRNA sequence targeting LINC00942 is designed, and it is coupled with a GalNAc ligand. GalNAc can bind to the ASGPR receptor specifically expressed on the surface of liver cells, thereby delivering the siRNA conjugate to the liver cells accurately. This method effectively solves the siRNA delivery problem, achieves specific silencing of LINC00942, and achieves the purpose of inhibiting the growth of liver cancer cells. In short, the present application provides a new method for treating liver cancer, which specifically silences LINC00942 highly expressed in liver cancer by using a GalNAc-mediated siRNA delivery system, and achieves the effect of targeted therapy for liver cancer. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 It is shown that LINC00942 is significantly highly expressed in liver cancer tissues and almost not expressed in normal liver tissues.
[0022] Figure 2 It is shown that LINC00942 is specifically highly expressed in liver cancer tissues and is related to patient prognosis. Among them, Figure 2Figures A and B show that multiple datasets all indicate that LINC00942 is significantly highly expressed in liver cancer tissues but almost not expressed in adjacent normal tissues. Figure C shows the Kaplan-Meier curves in the TCGA-LIHC cohort, which show the overall survival probability of patients with high and low expression of LINC00942.
[0023] Figure 3 In vitro cell function experiments demonstrated that LINC00942 promotes the proliferation, migration, and invasion of liver cancer cells. Figure 3 Figure A shows the interference of LINC00942 with multiple siRNAs in the hepatocellular carcinoma cell lines MHCC97H and SNU449, with the interference efficiency detected by qPCR. Figure B shows the overexpression of LINC00942 in the hepatocellular carcinoma cell lines Huh7 and SNU449, with the overexpression efficiency detected by qPCR. Figure 3 Figures C through F show the results of CCK8 proliferation, colony formation, cell migration, and invasion experiments performed after knocking down LINC00942 in liver cancer cells. The results showed that interfering with LINC00942 significantly inhibited the proliferation, colony formation, migration, and invasion abilities of liver cancer cells. Figure 3 G-J in the figure show that after overexpressing LINC00942 in liver cancer cells, CCK8 proliferation, colony formation, cell migration and invasion experiments were performed. It was found that overexpression of LINC00942 significantly promoted the proliferation, colony formation, migration and invasion of liver cancer cells.
[0024] Figure 4 In vitro cell experiments demonstrated that LINC00942 promotes the proliferation, migration, and invasion of liver cancer cells. Among these, Figure 4 Figures A through E show the construction of a stable LINC00942-shRNA knockdown cell line and the results of CCK8 proliferation, colony formation, cell migration, and invasion experiments. The results showed that interfering with LINC00942 significantly inhibited the proliferation, colony formation, migration, and invasion of liver cancer cells.
[0025] Figure 5 In vivo experiments demonstrated that LINC00942 promotes the proliferation, migration, and invasion of liver cancer cells. Among these, Figure 5 Figures A through D show that LINC00942 was stably knocked down in MHCC97H cells, with a yield of 3 × 10⁻⁶ cells. 6 LINC00942 cells were subcutaneously injected into 5-week-old male BALB / c nude mice. The experiment showed that LINC00942 knockdown significantly delayed tumor growth and reduced tumor volume and weight. Ki67 staining of tumor tissue also showed a significant decrease in the Ki67 positivity rate of tumor cells in the LINC00942 knockdown group. Figure 5 E-H in the figure shows that LINC00942 is stably overexpressed in Huh7 cells, with 3×106 The cells were subcutaneously injected into 5-week-old male BALB / c nude mice. It was found that overexpression of LINC00942 significantly promoted tumor growth and increased tumor volume and weight. Ki67 staining of tumor tissues also showed that the Ki67 positive rate of tumor cells in the LINC00942 overexpression group was significantly increased. Figure 5 I and J in FIG. 3 show that 3x10 6 Huh7 cells stably overexpressing LINC00942 were injected into the liver of 5-week-old male BALB / c nude mice to construct a nude mouse liver orthotopic xenograft tumor model. After 4 weeks, the mice were euthanized, and the lung tissue was dissected. Hematoxylin and eosin (H&E) staining was used to determine the number of metastatic lesions in the lung. The results showed that overexpression of LINC00942 significantly promoted tumor lung metastasis. The above in vivo experiments further demonstrated the ability of LINC00942 to promote liver cancer cell growth and metastasis in vivo.
[0026] Figure 6 Flow chart for GalNAc-siRNA treatment of liver orthotopic xenograft tumor.
[0027] Figure 7 shows the therapeutic effect of GalNAc-siLINC00942 in vivo. Among them, Figure 7 A and B in FIG. 4 show that mice treated with GalNAc-siLINC00942 had significantly reduced tumor growth ability in vivo and significantly reduced fluorescence intensity compared with the control group. Figure 7 C and D in FIG. 4 show that HE staining found that the liver metastasis ability and lung metastasis ability of mice in the GalNAc-siLINC00942 treatment group were significantly reduced compared with the control group. Figure 7 E in FIG. 4 shows that the degree of Ki67 staining in the tumor tissue of mice in the GalNAc-siLINC00942 treatment group was significantly reduced. DETAILED DESCRIPTION
[0028] The embodiments of the present application are described in detail below with reference to the accompanying drawings.
[0029] Following, the embodiments of the present application are described through specific examples, and other advantages and effects of the present application can be easily understood by those skilled in the art from the disclosure. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. The present application can also be implemented or applied through other different specific embodiments, and various modifications or changes can be made to the details in the specification without departing from the spirit of the present application. It should be noted that the following embodiments and features in the embodiments can be combined with each other without conflict. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.
[0030] It should be noted that the various aspects of the embodiments described below are within the scope of the appended claims. It should be apparent that the aspects described herein can be embodied in a wide variety of forms and that any specific structure and / or function described herein is merely illustrative. Based on the teachings herein one skilled in the art should appreciate that an aspect described herein can be implemented independently of any other aspects and that an aspect can be implemented both as any number of software running on data processing equipment and / or as an apparatus.
[0031] It should be noted that the present application designs technical solutions from the following aspects:
[0032] 1. LINC00942 is specifically highly expressed in liver cancer tissues, but not expressed in normal liver tissues. Therefore, a siRNA for specific targeted interference is designed, and the target sequence is: GGTTCATCTCCAGAAGGCTTGGAAT. In order to improve the stability of siRNA in vivo, chemical modification is performed on siRNA. Specifically, 2'-O-Me, FU and FC are included. These modifications can significantly prolong the half-life of siRNA in vivo and improve its therapeutic effect. In addition, in order to achieve specific targeting of liver cells, a GalNAc molecule is connected to the 3' end of the sense strand of siRNA.
[0033] 2. Preparation of tumor cell line: 293T cells are used to package PWPXL-GFP-Luciferase lentivirus, and MHCC97H cells are infected. Stable Luciferase-expressing MHCC97H cell lines are screened and established, which makes it possible to track tumor growth through in vivo luminescence imaging technology in the future.
[0034] 3. Establishment of liver orthotopic xenograft tumor model in nude mice: Luciferase-stable-expressed MHCC97H cells were injected into the liver of nude mice orthotopically.
[0035] 4. Experimental grouping and treatment regimen: The first live imaging was performed 7 days after cell inoculation, and the animals were randomly divided into two groups, 5 in each group. The control group of mice was given GalNAc-siNC subcutaneously, and the experimental group of mice was given GalNAc-siLINC00942. The second live imaging was performed on day 14 and the drug was given again. The last imaging was performed on day 21, and the liver and lung tissues of the mice were collected for HE staining and immunohistochemical experiments and statistical analysis to evaluate the therapeutic effect of GalNAc-siLINC00942 in vivo.
[0036] Example 1
[0037] Experimental methods
[0038] 1.1 RNA-seq data set download and analysis
[0039] The bam files of RNA-seq of human tumor samples of 33 different cancer types were downloaded from the TCGA database; the TPM expression value of LINC00942 was quantified by bioinformatics software StringTie analysis. For liver cancer tissue expression data, the expression data of 50 pairs of paired liver cancer and pericancer tissues in the TCGA liver cancer patient (TCGA-LIHC) RNA-seq data set from GDC data (https: / / portal.gdc.cancer.gov / ) were analyzed. The GSE77314 data set and the GSE144269 data set were downloaded from the Gene Expression Omnibus database (GEO, https: / / www.ncbi.nlm.nih.gov / geo / ), and the expression of LINC00942 in 50 pairs of tumor tissues and pericancer tissues was analyzed.
[0040] 1.2 Cell culture
[0041] Human hepatoma cells Huh7, MHCC97H and SNU449 and human embryonic kidney cells HEK-293T were cultured in high-glucose DMEM medium containing 10% fetal bovine serum (FBS) and 1% double-antibiotic (penicillin and streptomycin). The cells were cultured in a 37°C, 5% CO2 incubator.
[0042] 1.3 Real-time fluorescent quantitative PCR (qPCR)
[0043] Total RNA was extracted from cultured cells using TRIzol reagent (Invitrogen, CA, USA) and reverse transcribed into cRNA using Evo M-MLV RT Master Mix (Accurate Biology, Hunan, China). qPCR reactions used SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, Hunan, China) with 3 replicates per sample.
[0044] Table 1 qPCR primer sequences
[0045]
[0046]
[0047] 1.4 siRNA transfection
[0048] All siRNAs were synthesized by Accurate Bio. The siRNA dry powder was dissolved with DEPC water after transient centrifugation, configured as a 20 mM storage solution, aliquoted and stored in a -20 °C low temperature refrigerator. Lipofectamine RNAi MAX transfection reagent (Invitrogen, CA, USA) was used for transient transfection in cells. The subsequent experiment can be carried out after transfection for 24-48 h.
[0049] Table 2 siRNA sequences
[0050] Name Sequence (5'-3') siNC AGUACAGCAAACGAUACGG (as set forth in SEQ ID NO: 13) siLINC00942-1 GGTTCATCTCCAGAAGGCTTGGAAT (as set forth in SEQ ID NO. 1) siLINC00942-2 TCCTCGGCCTGAGGGAGGCAGTGAA (as set forth in SEQ ID NO. 2)
[0051] 1.5 LINC00942 shRNA design and plasmid construction
[0052] The shRNA forward and reverse primers of LINC00942 were synthesized by GeneOrbit Biotech Co., Ltd. The primer fragments were annealed into shRNA double strands; the Lenti-gRNA-Puro (Addgene #84752) vector was digested with BsmB I-v2 (New England Biolabs, MA, USA); the shRNA was connected in the Lenti-gRNA-Puro vector through the Solution I ligase (Takara, Japan) connection reaction. Then Escherichia coli HB101 was transformed, single colonies were picked after plating and expanded, plasmids were extracted, and after correct identification by sequencing, the plasmid construction was completed, which was used for subsequent lentivirus packaging.
[0053] Table 3 shRNA sequences
[0054]
[0055] 1.6 Plasmid construction of overexpression of LINC00942
[0056] According to the full-length sequence of LINC00942, specific amplification primers were designed, and the full-length fragment of LINC00942 was amplified by PCR with PrimeSTAR HS Premix high-fidelity enzyme (Takara, Japan); the PWPXL vector was digested with EcoR I-HF (New England Biolabs, MA, USA) and BamH I-HF (New England Biolabs, MA, USA); the full-length fragment of LINC00942 was ligated to the PWPXL vector by seamless cloning with ClonExpressUltra One Step Cloning Kit (Vazyme, Nanjing, China); after transformation and plasmid extraction, the correct plasmid was sequenced and identified, and then the PWPXL-LINC00942 overexpression plasmid was successfully constructed. The empty vector was used as a negative control.
[0057] Full-length sequence of LINC00942:
[0058]
[0059] 1.7 PWPXL-EGFP-Luciferase plasmid construction for mouse in vivo imaging experiment
[0060] The luciferase gene was cloned in the PWPXL vector, which itself contains EGFP. Luciferase was inserted behind EGFP, expressed in fusion, to obtain the PWPXL-EGFP-Luciferase plasmid.
[0061] 1.8 Lentivirus packaging and infection, construction of stable expression cell lines
[0062] Lentivirus packaging: well-grown HEK-293T cells were trypsinized, and an appropriate amount of cells were seeded into a 6-well plate. After overnight culture, the density reached 70-80%, and lentivirus packaging could be performed. 2 μg of plasmid, 1.4 μg of packaging plasmid psPAX2 (Addgene #12260), and 0.7 μg of envelope plasmid pMD2.G (Addgene #12259) were mixed with 500 μL of serum-free DMEM medium. Another EP tube was used to mix 10 μL of lipofectamine transfection reagent with 500 μL of serum-free DMEM medium, and it was incubated at room temperature for 5 min. The two systems were mixed, gently blown and mixed, and incubated for 15 min. The 6-well plate of HEK-293T cells was taken out of the incubator, the culture medium was discarded, 1 mL of serum-free medium was added to each well, and then the incubated transfection system was slowly added along the well wall, mixed, and returned to the incubator. After 6-8 h of culture, the culture medium was replaced with 2 mL of fresh complete culture medium. After 48 h of transfection, the culture medium was collected, filtered through a 0.45 μm filter, and collected in an EP tube using a syringe. The virus solution was obtained, which could be directly used for cell infection or stored at -80°C.
[0063] Lentivirus infection and stable strain construction: when the cell density reaches 50-70%, lentivirus infection can be performed. For example, using a six-well plate, the cells were replaced with fresh culture medium and polybrene was added at a final concentration of 6 μg / mL, and then returned to the incubator. After 30 min, the cells were taken out and an appropriate amount of virus solution was added to the wells. After overnight infection, the fresh culture medium was replaced. After 36-48 h, the fluorescence microscope was used to observe the infection efficiency of the fluorescent plasmid and the subsequent flow sorting was performed. For the resistance screening plasmid, the corresponding screening drug was added, and after screening, the RNA was extracted to detect the efficiency. The stable expression strain with good efficiency was confirmed for subsequent experiments.
[0064] 1.9 In vitro cell function experiment: cell proliferation, migration and invasion experiment
[0065] Cell proliferation was assessed using CCK8 and colony formation assays. For the CCK8 assay, 1500 cells from different treatment groups were seeded in 96-well plates. After the required incubation period, 10% CCK8 (HY-K0301, MCE) was added to the cells, and incubation continued for 2 hours. Absorbance at OD 450 was then measured. For the colony formation assay, 3000 cells from different treatment groups were seeded in 6-well plates and incubated for 7–14 days. Cells were then stained with 1% crystal violet solution for 15 minutes, photographed, and quantified using ImageJ software.
[0066] Cell migration and invasion assays were performed in 24-well plates containing Transwell chambers (Corning, USA). For cell migration assays, cells (5 × 10⁶ cells / well) in 200 μl of serum-free medium were used. 4 Cells were seeded into the upper chamber, and 500 μl of DMEM medium containing 20% FBS was added to the lower chamber. After incubation at 37°C for a period of time, the chambers were removed, stained with crystal violet for 15 min, and then rinsed with water. The dried chambers were imaged using an inverted microscope, and cell counting was performed using ImageJ software. For cell invasion assays, Matrigel (BD, New Jersey, USA) was thawed at 4°C before the experiment and diluted with serum-free medium at a ratio of 1:9 on ice. Then, 500 μl of medium containing 20% FBS was added to a 24-well plate, a transwell chamber was placed, 70 μl of diluted Matrigel was added to the chamber, and the 24-well plate was incubated for 30 min before proceeding with subsequent experiments.
[0067] 1.10 Subcutaneous tumor formation experiment in nude mice
[0068] Five-week-old male BALB / c nude mice were housed in an SPF environment and provided with adequate food and water during their growth period. Huh7 cells stably overexpressing LINC00942 or MHCC97H cells stably knocked down LINC00942 were subcutaneously injected into the mice. Tumor size was measured every 3 days. At the end of the experiment (3-5 weeks), the mice were euthanized, and subcutaneous tumors were removed, weighed, and recorded. All subcutaneous tumors were grouped and photographed. Fresh tumor tissue was fixed in 4% paraformaldehyde for subsequent paraffin embedding, sectioning, and immunohistochemical staining.
[0069] 1.11 Nude Mouse Orthotopic Liver Xenograft Experiment
[0070] 5-week-old male BALB / c nude mice were raised in a SPF environment, and were provided with sufficient food and water during growth. Huh7 cells stably overexpressing LINC00942 were directly injected into the liver of BALB / c nude mice. The state of the mice was observed during the period to ensure that the tumor load was not too large. After 4 weeks, the mice were euthanized, and then the mouse lungs were fixed in 4% paraformaldehyde for subsequent hematoxylin and eosin (H&E) staining.
[0071] 1.12GalNAc-siLINC00942 treatment of nude mice orthotopic liver tumor model
[0072] GalNAc-siRNA for in vivo animal experiments was synthesized by Huzhou Hemma Biological. The GalNAc-siNC sequence was UUCUCCGACGUGUCACGUUU ((as shown in SEQ ID NO: 10)). The GalNAc-siLINC00942 sequence was GGTTCATCTCCAGAAGGCTTGGAAT (as shown in SEQ ID NO: 1). (The GalNAc-siLINC00942 sequence was selected according to the siRNA interference efficiency and function of the most obvious group in the in vitro cell experiment, and the corresponding sequence of siLINC00942-1 was selected.) The GalNAc-siNC and GalNAc-siLINC00942 sequences were coupled and chemically modified, including 2'-OMe, FC, FU. At the same time, three GalNAc molecules were connected to the 3' end of the sense strand.
[0073] Construction of cell lines stably expressing EGFP-Luciferase: MHCC97H cells were infected with PWPXL-EGFP-Luciferase virus, and 48 hours later, the cells were collected for cell flow sorting to obtain GFP-positive cells, which were further cultured to obtain a liver cancer cell line stably expressing EGFP-Luciferase.
[0074] 5x10 6MHCC97H cells stably expressing EGFP-Luciferase were injected into the livers of 5-week-old male BALB / c nude mice to construct an orthotopic liver xenograft model. Seven days after orthotopic transplantation, each mouse was intraperitoneally injected with D-luciferin (150 mg / kg). After anesthesia with isoflurane, the mice were imaged using the IVIS Lumina LT Series III in vivo imaging system to observe the growth of the xenograft. The nude mice were randomly divided into two groups (N=5 mice / group) and treated with subcutaneous injections of GalNAc-siNC and GalNAc-siLINC00942 (5 mg / kg), respectively, once a week for two consecutive weeks. After in vivo imaging in the third week, the mice were euthanized, and the liver and lung tissues were harvested for subsequent HE staining and immunohistochemical staining.
[0075] Example 2 Experimental Results
[0076] 2.1 Expression of LINC00942 in Hepatocellular Carcinoma
[0077] The expression levels of LINC00942 in 33 types of tumor tissues and corresponding normal tissues were analyzed using the TCGA database (the sample size of each type of tissue is marked in the figure). It was found that LINC00942 was significantly highly expressed in liver cancer tissues, while it was almost not expressed in normal liver tissues.
[0078] 2.2 Correlation between LINC00942 expression and prognosis in hepatocellular carcinoma tissues
[0079] Multiple datasets (TCGA-LIHC, GSE77314, GSE144269) all showed that LINC00942 was significantly highly expressed in hepatocellular carcinoma tissues but almost not expressed in adjacent normal tissues. Figure 2 (A and B in the text). This provides a good target for specific targeted therapy of liver cancer cells. Furthermore, high expression of LINC00942 is associated with poorer patient prognosis. Figure 2 The addition of C in the formula further enhances the clinical significance of targeted LINC00942 therapy.
[0080] 2.3 In vitro experimental study on the correlation between LINC00942 and the proliferation, migration and invasion of liver cancer cells
[0081] To investigate the biological function of LINC00942, two siRNAs specifically targeting LINC00942 were designed (sequences are shown in the methods section). These siRNAs were transiently transferred into MHCC97H and SNU449 cells. After 48 hours, RNA was extracted, and the interference efficiency of LINC00942 was detected by qPCR. Figure 3In addition, an overexpression plasmid of LINC00942 was constructed and transfected into Huh7 and SNU449 cells. After 48 hours, RNA was extracted and the overexpression efficiency of LINC00942 was detected by qPCR. Figure 3 (B) Knockdown of LINC00942 in liver cancer cells significantly reduced the proliferation, migration, and invasion abilities of liver cancer cells. Figure 3 In contrast, overexpression of LINC00942 significantly promoted the proliferation, migration, and invasion of liver cancer cells. Figure 3 (GJ in the text). Furthermore, stable knockdown of LINC00942 via shRNA also significantly inhibited the proliferation, migration, and invasion of liver cancer cells. Figure 4 (AE in the text). All of the above results demonstrate the pro-cancer effect of LINC00942 in liver cancer cells.
[0082] 2.4 In vivo experimental study on the correlation between LINC00942 and the proliferation, migration and invasion of liver cancer cells
[0083] 3×10 6 Stable knockdown of LINC00942 in MHCC97H cells was subcutaneously injected into 5-week-old male BALB / c nude mice. Results showed that LINC00942 knockdown significantly delayed tumor growth and reduced tumor volume and weight. Figure 5 (AC in the group). Ki67 staining also showed a significant decrease in Ki67 positivity in tumor tissues of the LINC00942 knockdown group ( Figure 5 (D in the text). Additionally, 3×10 6 Huh7 cells stably overexpressing LINC00942 were subcutaneously injected into 5-week-old male BALB / c nude mice. Experiments showed that overexpression of LINC00942 significantly promoted tumor growth, increasing tumor volume and weight. Figure 5 (EG in the group). Ki67 staining also showed a significant increase in Ki67 positivity in tumor tissues of the LINC00942 overexpression group. Figure 5 H). Simultaneously, Huh7 cells stably overexpressing LINC00942 were injected into the livers of nude mice to construct a nude mouse orthotopic liver xenograft model. The results showed that overexpression of LINC00942 significantly increased the formation of lung metastases. Figure 5 (I and J in the text). The above in vivo experiments further demonstrate the ability of LINC00942 to promote the growth and metastasis of liver cancer cells in vivo.
[0084] The therapeutic effects of 2.5GalNAc-siLINC00942 in vivo
[0085] Based on the significant high expression of LINC00942 in hepatocellular carcinoma (HCC) but almost no expression in normal liver, and the fact that LINC00942 can promote tumor progression in HCC, we further explored the in vivo therapeutic effects and significance of GalNAc-siLINC00942. An orthotopic xenograft model of nude mouse liver was established (see Methods for details). Figure 6 As shown, in vivo treatment experiments were conducted in nude mice by subcutaneous injection of GalNAc-siLINC00942 or the corresponding control GalNAc-siNC. The results showed that mice treated with GalNAc-siLINC00942 exhibited significantly reduced tumor growth in vivo compared to the control group. Figure 7 In addition to A and B in the control group, the ability to metastasize to the liver and lungs was also significantly reduced compared to the control group. Figure 7 (C and D in the text). Furthermore, the Ki67 positivity rate in the tumor tissue of mice treated with GalNAc-siLINC00942 was significantly reduced ( Figure 7 (E in the text). The above results suggest that targeting LINC00942, which is specifically highly expressed in liver cancer cells, with GalNAc-siRNA can effectively inhibit the in vivo growth and metastasis of xenograft tumors in nude mice.
[0086] The above embodiments are merely illustrative of the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made based on the essence of the content of the present invention should be covered within the scope of protection of the present invention.
Claims
1. The application of siRNA targeting LINC00942 in the preparation of liver cancer drugs, characterized in that, The target sequence of the siRNA is the sequence shown in SEQ ID NO:1 or SEQ ID NO:
2.
2. The application according to claim 1, characterized in that, The siRNA is coupled with a trivalent GalNAc at its 3' end.
3. The application of shRNA targeting LINC00942 in the preparation of liver cancer drugs, characterized in that, The sense strand of the shRNA is SEQ ID NO:3, and the antisense strand of the shRNA is SEQ ID NO:5; or the sense strand of the shRNA is SEQ ID NO:4, and the antisense strand of the shRNA is SEQ ID NO:
6.
4. A siRNA targeting LINC00942, characterized in that, The target sequence of the siRNA is the sequence shown in SEQ ID NO:1 or SEQ ID NO:
2.
5. The siRNA according to claim 4, characterized in that, The siRNA is coupled with a trivalent GalNAc at its 3' end.
Citation Information
Patent Citations
Small molecule nucleic acid drug for intervening cancer-specific LINC01419 and application of small molecule nucleic acid drug in targeted therapy of liver cancer
CN117653653A
Small molecule nucleic acid drug for targeted inhibition of LINC02163 and application of small molecule nucleic acid drug in targeted therapy of liver cancer
CN118526591A