Application of carnitine and / or TGR5 inhibitor in preparation of medicine for treating fatty liver disease related to metabolic dysfunction

Abstract

The invention relates to the technical field of medicines, in particular to application of a carnitine and / or TGR5 inhibitor in preparation of a medicine for treating fatty liver diseases related to metabolic dysfunction. It is found that activation of TGR5 causes inhibition of carnitine biosynthesis, and then lipid metabolism of hepatocytes is affected. The expression of the BBOX1 protein is recovered through exogenous supplement of carnitine and a TGR5 inhibitor or gene therapy, lipid metabolism of liver cells can be effectively improved, and lipid toxicity and inflammatory response are reduced. A new thought is provided for the treatment of MASH, that is, the progress of diseases is prevented by recovering the lipid metabolism capability of hepatocytes instead of depending on anti-inflammatory or anti-fibrosis drugs.

Description

Technical Field

[0001] The present invention relates to the field of pharmaceutical technology, and particularly to the use of carnitine and / or G protein-coupled bile acid receptor 5 (TGR5) inhibitors in the preparation of drugs for treating metabolic dysfunction-associated steatohepatitis. Background Art

[0002] Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD) is a liver disease caused by metabolic abnormalities. Its progression covers from simple steatosis (SLD) to metabolic dysfunction-associated steatohepatitis (MASH), and may ultimately develop into liver fibrosis, cirrhosis, and even hepatocellular carcinoma (HCC). The occurrence of MASH is closely related to abnormal liver lipid metabolism, bile acid imbalance, and chronic inflammation. Therefore, preventing the progression of MASLD to MASH has become the research focus in this field.

[0003] Currently, the treatment strategies for MASLD mainly include lifestyle interventions (such as diet control and exercise), insulin sensitizers, bile acid receptor agonists (such as FXR agonists), and anti-inflammatory drugs. However, these treatment methods can only play a certain intervention role in the early stage of MASLD. They mainly slow down the disease progression by improving insulin resistance, reducing liver fat accumulation, or reducing inflammatory responses, but cannot effectively prevent the transformation of MASLD to MASH. Once MASLD progresses to MASH, there is currently no targeted clinical drug that can reverse this process. Therefore, the existing treatment methods have obvious limitations in the mechanistic intervention of MASH occurrence. Summary of the Invention

[0004] To solve the above problems, the present invention provides the use of carnitine and / or TGR5 inhibitors in the preparation of drugs for treating metabolic dysfunction-associated steatohepatitis. The present invention discovers that by targeting TGR5 and its downstream signaling pathways, restoring the expression of BBOX1 protein, and increasing the endogenous carnitine level in hepatocytes, abnormal lipid metabolism can be improved and the progression of MASLD to MASH can be effectively delayed.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides the use of carnitine and / or substances that promote carnitine synthesis in the preparation of drugs for treating metabolic dysfunction-associated steatohepatitis, and the substances that promote carnitine synthesis include one or more of TGR5 inhibitors, substances that increase the expression level of the Bbox1 gene, substances that reduce the expression level of the Gpbar1 gene, and substances that reduce the expression level of the Trim21 gene.

[0007] Preferably, the metabolic dysfunction-related fatty liver disease includes metabolic dysfunction-related steatohepatitis.

[0008] Preferably, the carnitine includes L-carnitine; the TGR5 inhibitor includes SBI-115.

[0009] Preferably, the substance for increasing the expression level of the Bbox1 gene includes a Bbox1 recombinant expression vector and / or an adenovirus containing the Bbox1 recombinant expression vector; the substance for decreasing the expression level of the Gpbar1 gene includes: a recombinant vector for knocking out Gpbar1 and / or an adenovirus containing the recombinant vector for knocking out Gpbar1; the substance for decreasing the expression level of the Trim21 gene includes: a recombinant vector for knocking out Trim21 and / or an adenovirus containing the recombinant vector for knocking out Trim21.

[0010] Preferably, the Bbox1 recombinant expression vector includes an Alb promoter and a Bbox1 sequence; the nucleotide sequence of the Alb promoter is as shown in SEQ ID NO.9, and the nucleotide sequence of the Bbox1 sequence is as shown in SEQ ID NO.10.

[0011] Preferably, the recombinant vector for knocking out Gpbar1 contains an sgRNA of the Gpbar1 gene; the recombinant vector for knocking out Trim21 contains an sgRNA of the Trim21 gene; the nucleotide sequences of the sgRNA of the Gpbar1 gene are as shown in SEQ ID NO.13 and SEQ ID NO.14; the nucleotide sequences of the sgRNA of the Trim21 gene are as shown in SEQ ID NO.15 and SEQ ID NO.16.

[0012] Preferably, the adenovirus includes AAV8 virus.

[0013] The present invention provides a drug for treating metabolic dysfunction-related fatty liver disease, and the active ingredients include carnitine and / or a TGR5 inhibitor; calculated based on the body weight of a mouse, the unit dose of carnitine in the drug is 0.1-100 mg / kg body weight; the unit dose of the TGR5 inhibitor in the drug is 0.1-100 μM.

[0014] Preferably, the carnitine includes L-carnitine; the TGR5 inhibitor includes SBI-115.

[0015] Preferably, calculated based on the body weight of a mouse, the unit dose of carnitine in the drug is 10-20 mg / kg body weight; the unit dose of the TGR5 inhibitor in the drug is 10-20 μM.

[0016] Beneficial effects:

[0017] The present invention provides the use of carnitine and / or substances that promote carnitine synthesis in the preparation of a medicament for treating metabolic dysfunction-related fatty liver disease, and the substances that promote carnitine synthesis include one or more of a TGR5 inhibitor, a substance that increases the expression level of the Bbox1 gene, a substance that decreases the expression level of the Gpbar1 gene, and a substance that decreases the expression level of the Trim21 gene. The present invention discovers that the activation of TGR5 leads to the inhibition of carnitine biosynthesis, thereby affecting the lipid metabolism of hepatocytes. By exogenously supplementing carnitine, a TGR5 inhibitor, or restoring the expression of BBOX1 through gene therapy, the lipid metabolism of hepatocytes can be effectively improved, and lipotoxicity and inflammatory responses can be reduced. This provides a new idea for the treatment of MASH, that is, by restoring the lipid metabolism ability of hepatocytes to prevent the progression of the disease, rather than simply relying on anti-inflammatory or anti-fibrotic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0019] Figure 1 It is the detection result of lipid accumulation in cells of different groups in Example 1; the scale bar is 100 μm;

[0020] Figure 2 It is the detection result of the levels of triglyceride and total cholesterol in cells of different groups in Example 1, as well as the relative expression levels of mRNAs of IL-6 and IL-8;

[0021] Figure 3 It is the flow cytometry detection result and cell death rate result of cells of different groups in Example 1;

[0022] Figure 4 It is the KEGG pathway and metabolomics analysis results of differentially expressed genes in Example 1; among them, the partially blocked contents in B are isovalerylcarnitine and tetradecanoylcarnitine respectively;

[0023] Figure 5 It is the immunoblotting detection result and LC / MS analysis result of cells of different groups in Example 2;

[0024] Figure 6 It is the different staining results and quantitative results of cells of different groups in Example 3; the scale bar is 100 μm;

[0025] Figure 7 It is the Oil Red O staining result of cells of different groups in Example 4; the scale bar is 100 μm;

[0026] Figure 8 It is the flow cytometry detection result of cells of different groups in Example 4;

[0027] Figure 9 The mRNA expression level results of IL-6 and IL-8 in different groups of cells in Example 4 (A) and the results of metabolomics analysis (B);

[0028] Figure 10 The experimental results of the HFHfr + C.diffFMT mouse model in Example 5, the scale bar is 100 μm;

[0029] Figure 11 The experimental results of the LCA + HFHfr mouse model in Example 5, the scale bar is 100 μm;

[0030] Figures 12 to 17 The experimental results of the effects of Bbox1 overexpression and Gpbar1 or Trim21 knockout on liver injury in the MASH model in Example 6; among them, Figure 12 A in it is the schematic diagram of the treatment of mice in different groups; Figure 12 B in it is the Western Blot detection results of mice in different groups; Figure 13 The liver staining results of different groups of mice in the HFHfr + C.diffFMT model, the scale bar is 100 μm; Figure 14 The detection results of different indexes of different groups of mice in the HFHfr + C.diffFMT model; Figure 15 The liver staining results of different groups of mice in the LCA + HFHfr model, the scale bar is 100 μm; Figure 16 The detection results of different indexes of different groups of mice in the LCA + HFHfr model; Figure 17 A in it is the results of RNA-seq analysis and GSEA analysis; Figure 17 B in it is the results of metabolomics analysis;

[0031] Among them, ns indicates P > 0.05, * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.0002, **** indicates P < 0.0001. Detailed implementation manners

[0032] The present invention provides the use of carnitine and / or substances promoting carnitine synthesis in the preparation of drugs for treating metabolic dysfunction-related fatty liver disease, and the substances promoting carnitine synthesis include one or more of TGR5 inhibitors, substances increasing the expression level of the Bbox1 gene, substances decreasing the expression level of the Gpbar1 gene, and substances decreasing the expression level of the Trim21 gene. The coding gene corresponding to the TGR5 protein in the present invention is the Gpbar1 gene. As an implementation manner, the nucleotide sequence of the Bbox1 gene is as shown in SEQ ID NO.10.

[0033] As an embodiment, the metabolic dysfunction-related fatty liver disease includes metabolic dysfunction-related steatohepatitis.

[0034] As an embodiment, the carnitine includes L-carnitine; the TGR5 inhibitor includes SBI-115.

[0035] As an embodiment, the substance for increasing the expression level of the Bbox1 gene includes a Bbox1 recombinant expression vector and / or an adenovirus containing the Bbox1 recombinant expression vector; the substance for decreasing the expression level of the Gpbar1 gene includes: a recombinant vector for knocking out Gpbar1 and / or an adenovirus containing the recombinant vector for knocking out Gpbar1; the substance for decreasing the expression level of the Trim21 gene includes: a recombinant vector for knocking out Trim21 and / or an adenovirus containing the recombinant vector for knocking out Trim21.

[0036] As an embodiment, the Bbox1 recombinant expression vector includes an Alb promoter and a Bbox1 sequence; the nucleotide sequence of the Alb promoter is as shown in SEQ ID NO.9, and the nucleotide sequence of the Bbox1 sequence is as shown in SEQ ID NO.10.

[0037] As an embodiment, the recombinant vector for knocking out Gpbar1 contains an sgRNA of the Gpbar1 gene; the recombinant vector for knocking out Trim21 contains an sgRNA of the Trim21 gene; the nucleotide sequences of the sgRNA of the Gpbar1 gene are as shown in SEQ ID NO.13 and SEQ ID NO.14; the nucleotide sequences of the sgRNA of the Trim21 gene are as shown in SEQ ID NO.15 and SEQ ID NO.16.

[0038] As an embodiment, the adenovirus includes an AAV8 virus.

[0039] The present invention provides a drug for treating metabolic dysfunction-related fatty liver disease, and the active ingredient includes carnitine and / or a TGR5 inhibitor; calculated by the body weight of a mouse, the unit dose of carnitine in the drug is 0.1-100 mg / kg body weight; the unit dose of the TGR5 inhibitor in the drug is 0.1-100 μM.

[0040] As an embodiment, the carnitine includes L-carnitine; the TGR5 inhibitor includes SBI-115.

[0041] As an embodiment, calculated by the body weight of a mouse, the unit dose of carnitine in the drug is 10-20 mg / kg body weight; the unit dose of the TGR5 inhibitor in the drug is 10-20 μM.

[0042] The present invention discovers that the activation of TGR5 leads to the inhibition of carnitine biosynthesis, thereby affecting lipid metabolism in hepatocytes. By exogenously supplementing carnitine or restoring the expression of BBOX1 protein through gene therapy, the lipid metabolism in hepatocytes can be effectively improved, and lipotoxicity and inflammatory responses can be reduced. This provides a new idea for the treatment of MASH, that is, by restoring the lipid metabolism ability of hepatocytes to prevent the progression of the disease, rather than simply relying on anti-inflammatory or anti-fibrotic drugs.

[0043] The present invention discovers that the activation of TGR5 significantly increases lipid accumulation and cell death in hepatocytes, while reducing the levels of carnitine metabolites, indicating that TGR5 exacerbates hepatocyte lipotoxicity by inhibiting carnitine synthesis. The present invention also discovers that TGR5 binds to CD36 and recruits the E3 ubiquitin ligase TRIM21, resulting in the ubiquitination and degradation of BBOX1 protein, thereby inhibiting carnitine synthesis. The present invention discovers that SBI-115 significantly reduces lipid accumulation and inflammation, restores carnitine metabolism, and reverses the progression of MASH. In an animal model, inhibiting the expression of TGR5 can significantly improve liver pathological changes and reduce fibrosis and inflammation.

[0044] The present invention discovers that TGR5 plays different roles in hepatocytes and macrophages. In macrophages, TGR5 has an anti-inflammatory effect, while in hepatocytes, the activation of TGR5 promotes the progression of MASH. Therefore, specific inhibition of TGR5 in hepatocytes can effectively prevent the progression of MASH without interfering with the anti-inflammatory function of macrophages. This dual mechanism of action makes TGR5 inhibitors have higher selectivity and safety in the treatment of MASH.

[0045] The present invention discovers that TGR5 inhibitors not only have a preventive effect in the early stage of MASH, but can also reverse pathological changes by restoring carnitine biosynthesis when the disease has progressed to the MASH stage. This dual effect makes TGR5 inhibitors have greater flexibility in clinical applications.

[0046] To further illustrate the present invention, the application of carnitine and / or TGR5 inhibitors provided by the present invention in the preparation of drugs for treating metabolic dysfunction-related fatty liver disease will be described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0047] Preparation Example

[0048] The primer sequences used in the following examples for real-time fluorescence quantitative PCR are shown in Table 1.

[0049] Table 1 Primer sequences used in real-time fluorescence quantitative PCR

[0050]

[0051] The materials and reagents used in the following examples are as follows:

[0052] Primary mouse hepatocytes: Hepatocytes were isolated from 8-week-old male C57BL / 6 mice using a two-step collagenase perfusion method. For the specific steps, refer to the literature

Li W C, Ralphs KL, Tosh D. Isolation and cμlture ofadμltmouse hepatocytes[J]. Methods Mol Biol, 2010, 633: 185-96.

[0053] Peritoneal macrophages: Male C57BL / 6 mice were intraperitoneally injected with 3% Brewer's zymosan (Sigma-Aldrich, Catalog No: 58856-93-2) to induce the proliferation of peritoneal macrophages. After 24 h, the mice were sacrificed by CO2 asphyxiation, and the abdomen was disinfected with 75% ethanol. 5 - 10 ml of cold PBS or DMEM was injected into the peritoneal cavity, and the abdomen was gently massaged to release the cells. The peritoneal fluid was collected. The cells were collected by centrifugation (300 g, 5 min), and the cell number was counted using a hemocytometer.

[0054] DMEM medium: Used for culturing hepatocytes and macrophages, supplemented with 1% penicillin-streptomycin (WISENT, Catalog No: 450-201-EL) and 10% fetal bovine serum.

[0055] O.C.T. compound (SAKURASAKURA, Catalog No: 4583): Used for tissue fixation.

[0056] Oil Red O staining solution (Beyotime, Catalog No: C0157M): Used for detecting lipid droplets.

[0057] 3D culture dish (Sigma-Aldrich, Catalog No: Z764051): Used for preparing agarose micropores.

[0058] Preparation of agarose micropores:

[0059] 1) Add 330 μL of 2% agarose solution to a sterile 3D culture dish.

[0060] 2) Place the 3D culture dish at room temperature to allow the agarose solution to solidify and form agarose micropores.

[0061] 3) Add 1 ml of DMEM medium to each agarose micropore and incubate in a 37 °C, 5% CO2 cell culture incubator for more than 15 min to balance the micropore environment.

[0062] SBI-115 was dissolved in DMSO.

[0063] The PA-OA mixture consists of equimolar amounts of palmitic acid (PA) and oleic acid (OA).

[0064] G / TLCA consists of 50 μM of glycochenodeoxycholic acid (GLCA, Sigma - Aldrich, Catalog No: 474 - 74 - 8) and 50 μM of taurolithocholic acid (TLCA, Sigma - Aldrich, Catalog No: 516 - 90 - 5).

[0065] Antibodies: TGR5 (abcam, Cat#ab72608), BBOX1 (Catalog No: 16099 - 1 - AP, Proteintech), β - actin (Catalog No: 66009 - 1 - Ig, Proteintech), CD36 (Catalog No: 18836 - 1 - AP, Proteintech), Ubquitin (P4D1) (Cell Signaling Technology, Catalog No: #3936).

[0066] Example 1

[0067] In in vitro experiments, hepatocytes were treated with TGR5 agonists (G / TLCA and INT - 777) and TNFα, and lipid accumulation, cell death, and the expression of inflammatory factors (such as IL - 6 and IL - 8) were detected. The effect of TGR5 on carnitine metabolism was determined by RNA - seq and metabolomics analysis. The results are shown in Figures 1 to 4 .

[0068] Gpbar1 gene - knockout cells (denoted as Gpbar1 - shRNA) were constructed by lentiviral transfection, including the following steps:

[0069] 1) Construction of recombinant plasmid:

[0070] Forward sequence of Gpbar1 - shRNA (SEQ ID NO.7):

[0071] 5'-ccgggctcctgtcagtcttggcctactcgagtaggccaagactgacaggagctttttg-3';

[0072] Reverse sequence of Gpbar1 - shRNA (SEQ ID NO.8):

[0073] 5'-ggcccgaggacagtcagaaccggatgagctcatccggttctgactgtcctcgaaaaac-3';

[0074] The forward and reverse sequences of Gpbar1-shRNA were annealed and inserted between the Age I and EcoR I restriction sites of pLKO.1puro (Addgene, Plasmid#8453) to obtain a recombinant plasmid;

[0075] 2) Transfection and culture: ① Mix 500 μl of Opti-MEM (Thermo Fisher, Catalog No. 31985062) with 20 μl of liposome transfection reagent (Abbkine, Catalog No. BMU111); ② Mix 500 μl of Opti-MEM with 3.75 μg of PsPAX2 (Addgene, Catalog No. 12260), 1.25 μg of pMD2.G (Addgene, Catalog No. 12259), and 5 μg of the recombinant plasmid; ③ Add ② to ①, mix well, and let stand for 15 min. Then add 5 mL of fresh DMEM that has been changed 1 h in advance to HEK293T cells with a confluence of 80%. Change the medium after 6 - 8 h, add 7 mL of DMEM, replenish 3 mL of DMEM after 12 h, centrifuge at 3000 rpm for 5 min after 48 h, collect the supernatant, and filter it through a 0.45 μM PES filter membrane (Beyotime, Catalog No. FF345 - 50 pcs) to collect the lentivirus solution;

[0076] 3) Transfect hepatocytes:

[0077] Day 0: Seed the mouse hepatocyte cell line (AML12, ATCC, CAT#CRL - 2254) one day in advance so that the density at the time of infection the next day is 40 - 60%;

[0078] Day 1: Add 10 MOI of the virus solution to each well, add Polybrene (MCE, Cat. No.: HY - 112735) to a final concentration of 6 - 8 μg / mL, gently shake well, and incubate at 37°C for 8 - 24 h;

[0079] Day 2: Replace with fresh medium: Wash the cells gently once with PBS and replace with fresh complete medium;

[0080] Days 3 - 5: Start screening with 4 μg / ml of puromycin (MCE, Cat. No.: HY - B1743) 48 h later, change the drug-containing medium every day, and continue screening for 3 - 5 days until all the control wells die and the transfected wells survive stably.

[0081] During the implementation of the present invention, a mouse hepatocyte cell line (AML12, ATCC, CAT#CRL-2254) was used as the control group cells. The Gpbar1 gene knockout cells (denoted as Gpbar1-shRNA) and the control group cells were cultured under standard conditions (37 °C, 5% CO2) respectively.

[0082] Both groups of cells were exposed to the OA+PA mixture (working concentration 200 μm) to induce a lipotoxic environment, and at the same time, two groups of cells not exposed to the OA+PA mixture were set as the control group.

[0083] According to the experimental grouping, the TGR5 agonist G / TLCA (2 μL was added to each well of the 24-well plate) or INT-777 (working concentration 6 μm) was added respectively, and the control group (Ctrl) was added with an equal volume of DMSO. In some groups, human recombinant TNFα (proteintech, HZ-1014, working concentration 10 ng / mL) was further added to induce an inflammatory response. After the treatment, quantitative analysis was performed by Oil Red O staining. At the same time, total RNA was extracted, and the mRNA expression levels of IL-6 and IL-8 were detected by qRT-PCR. In addition, the total cholesterol level and triglyceride level of the cells were measured after the treatment.

[0084] To further study the effect of Gpbar1 on cell apoptosis under lipotoxicity and inflammatory stress, AnnexinV-FITC / PI (Beyotime, Cat#C1062S) double-staining flow cytometry was used to evaluate the cell death rate. After the treatment was completed, the cells were collected, stained with the Annexin V-FITC apoptosis detection kit, and detected and quantitatively analyzed using a flow cytometer.

[0085] In addition, to systematically reveal the Gpbar1-related regulatory network and metabolic pathways, the present invention further performed differential gene expression analysis and KEGG pathway enrichment analysis. The cells before and after Gpbar1 knockdown were entrusted to Gene Denovo Biotechnology Co., Ltd. for transcriptome sequencing (RNA-seq) after treatment with OA+PA+TNFa+G / TLCA, and the KEGG pathway analysis of the differentially expressed genes was performed using an enrichment algorithm.

[0086] The results showed that in wild-type hepatocytes, the TGR5 agonist significantly enhanced the lipid accumulation induced by FFA (free fatty acid) ( Figure 1 ), and when combined with TNFα, it could further increase the levels of triglyceride (TG) and total cholesterol (TC), and significantly up-regulate the mRNA expression of IL-6 and IL-8 ( Figure 2) Flow cytometry results showed that the co - action of the TGR5 agonist and TNFα could significantly increase the mortality of wild - type hepatocytes, while after knocking out the Gpbar1 gene, the proportion of apoptosis could be significantly reduced ( Figure 3 ), suggesting that the TGR5 protein is involved in regulating lipotoxicity - related cell death. Further analysis by RNA - seq found that the differentially expressed genes in hepatocytes and mouse liver tissues under the MASH model were enriched in the KEGG pathways related to cell death, fatty acid, and lipid metabolism ( Figure 4 in A). Metabolomics analysis was commissioned from Shenzhen Huiyun Biotechnology Co., Ltd. The results showed that after TGR5 activation, there was a significant inhibition of the carnitine metabolic pathway, indicating that TGR5 exacerbates hepatocyte lipotoxicity and death by interfering with carnitine synthesis, thereby promoting the progression of MASH ( Figure 4 in B). It is suggested that inhibiting Gpbar1 expression or inhibiting the function of the TGR5 protein (TGR5 inhibitor) can treat MASH.

[0087] Example 2: TGR5 exacerbates hepatocyte death by inhibiting carnitine synthesis

[0088] To determine the specific mechanism by which TGR5 activation induces the degradation of the BBOX1 protein, mouse hepatocytes were treated with the autophagy inhibitor 3 - MA (MCE, Cat.No.: HY - 19312), chloroquine (CQ, purchased from MCE, Cat.No.: HY - 17589A), the proteasome inhibitor MG - 132 (MCE, Cat.No.: HY - 13259), and carfilzomib (MCE, Cat.No.: HY - 10455). The treatment concentration of the above drugs was 10 μm.

[0089] First, under lipotoxic conditions (OA + PA+TNFα), the GPBAR1 agonist G / TLCA was administered (the treatment method was the same as in Example 1). Different degradation inhibitors were added to analyze the BBOX1 degradation mechanism, including the autophagy inhibitors 3 - MA and chloroquine (CQ), the proteasome inhibitors MG - 132 and carfilzomib. Cells were collected at different time points (0h, 6h, 12h, 24h) for Western blot detection.

[0090] Subsequently, immunoprecipitation experiments were used to explore the interaction between BBOX1 and lipid metabolism-related proteins. The specific steps are as follows: cells co-treated with TNFα+OA+PA and GPBAR1 agonist G / TLCA (10μM) for 24h were washed and lysed with lysis buffer (containing protease and phosphatase inhibitors, Beyotime, Cat#P1045), incubated with rotation at 4°C for 30 minutes, centrifuged at 12,000 rpm to remove cell debris, and the supernatant was quantified at 5μg / μl (Beyotime, Cat.No.: P0009) for subsequent operations. Subsequently, BBOX1 antibody 2μg (Proteintech, Cat.No.: 16099-1-AP) was added and incubated with Protein A / G magnetic beads (Beyotime, Cat.No.: P2108-5ml) at 4°C overnight, and immune complex binding was completed under rotation. The magnetic beads were washed three times with TBS (biosharp, Cat#BL602A), and the products were eluted with SDS-PAGE protein loading buffer (Biyuntian, Cat. No.: P0015A) for Western blot analysis.

[0091] The results showed that only proteasome inhibitors could effectively block the degradation of BBOX1 protein ( Figure 5 A), indicating that BBOX1 is mainly degraded via the proteasome pathway. Further detection of ubiquitination levels by immunoblotting revealed that BBOX1 can form a complex with TGR5 (or GPBAR1) and CD36 proteins under the combined treatment of TNFα+OA+PA+G / TLCA, accompanied by a significant increase in ubiquitination modification, especially after the addition of the TGR5 agonist G / TLCA; in addition, the expression levels of each target protein were verified to be consistent in the input group, excluding the influence of expression differences on the co-precipitation results ( Figure 5 Middle B), indicating that TGR5 activation can promote BBOX1 ubiquitination and its formation of complexes with lipid metabolism factors. The above experimental results collectively prove that TGR5 mediates the ubiquitin-dependent degradation of BBOX1.

[0092] To screen for E3 ubiquitin ligases that mediate BBOX1 degradation, BBOX1 antibodies were used as probes to perform immunoprecipitation experiments in the control group, TNFα+OA+PA group, and TNFα+OA+PA+G / TLCA group. Shanghai Zhongke New Life Biotechnology Co., Ltd. was commissioned to perform LC / MS analysis. The results showed that the precipitated proteins were mainly enriched in ubiquitination-related proteins. Further analysis confirmed that under the induction of TNFα+OA+PA, the enrichment of E3 ubiquitin ligase TRIM21 increased, and G / TLCA treatment could further enhance the expression levels of these proteins ( Figure 5In C), it is suggested that TGR5 activation affects the stability and function of BBOX1 by regulating the ubiquitin enzyme system in the ubiquitination pathway, and TRIM21 is the key molecule mediating the degradation of BBOX1 protein induced by TGR5 activation.

[0093] Example 3

[0094] By specifically knocking out Gpbar1 gene in macrophages combined with knocking out Gpbar1 gene in hepatocytes, and jointly inducing the MASLD phenotype by fecal microbiota transplantation and high-fat high-fructose diet (HFHfr), to explore the regulatory role of Gpbar1 in hepatocytes and macrophages.

[0095] Construct a mouse model: Cross Gpbar1 fl / fl ×Lyz-Cre mice (purchased from Jicuiyaokang, strain numbers are T009825 and T003822 respectively) with Rosa26-LSL-Cas9 mice (The Jackson Laboratory, RRID:IMSR_JAX:024857) to obtain mice with specific knockout of Gpbar1 in macrophages combined with the expression of Cas9 protein (Gpbar1 knockout in macrophages × Rosa26-LSL-Cas9); Knock out the Gpbar1 gene in hepatocytes by tail vein injection of Alb-Cre-U6-Gpbar1 sgRNA virus (see Example 6).

[0096] Feeding protocol: All mice were fed a high-fat high-fructose diet (see Example 5) starting from 6 weeks of age for 12 consecutive weeks.

[0097] Fecal microbiota transplantation treatment: Some mice started to receive fecal microbiota transplantation of C. difficile at the 12th week (see Example 5).

[0098] Group settings: Include a control group, HFHfr (see Example 5)+FMT:C.diff group (the same as C.diff FMT in Example 5), HFHfr+Alb-Cre Gpbar1 sgRNA group, HFHfr+FMT:C.diff+Alb-Cre Gpbar1 sgRNA group.

[0099] Endpoint detection:

[0100] The experiment was terminated at the 16th week. The mice were sacrificed and liver tissues were taken for the following analysis:

[0101] H&E staining: to evaluate the hepatic tissue morphology and inflammatory infiltration; Masson staining: to detect the degree of liver fibrosis; Oil Red O staining: to observe the lipid accumulation in the liver; F4 / 80 immunofluorescence staining: to detect the macrophage infiltration in the hepatic tissue (antibody: CST, 70076; kit: PANOVUE, 10234100050); pathological scoring (NAS scoring): the comprehensive hepatic pathological assessment was performed with reference to the literature [Kleiner D E, Brunt E M, Van Natta M, et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease [J]. Hepatology, 2005, 41(6): 1313 - 21.]. The results are shown in Figure 6 。

[0102] The results showed that after knocking out the Gpbar1 gene in macrophages, the MASH phenotype showed an aggravating trend, suggesting that the expression of TGR5 in macrophages has the effect of delaying or inhibiting the progression of MASH. Further, simultaneous knockout of Gpbar1 in hepatocytes (Alb-Cre Gpbar1-sgRNA group) could significantly alleviate the MASH phenotype, indicating that the high expression of TGR5 in hepatocytes has a promoting effect on the progression of MASH, and this promoting effect is stronger than the protective effect exerted by it in macrophages.

[0103] Example 4 Therapeutic effect of TGR5 inhibitor SBI-115 in a 3D co-culture model

[0104] A 3D co-culture system (primary hepatocytes + peritoneal inflammatory macrophages) was used to evaluate the therapeutic effect of the TGR5 receptor inhibitor SBI-115 on metabolic dysfunction-associated steatohepatitis (MASH), including: evaluating cellular lipid accumulation (Oil Red O staining), cell death (flow cytometry), and detecting the changes in the mRNA expression levels of inflammatory factors (IL-6, IL-8) by real-time fluorescence quantitative PCR to evaluate the effects of different treatments on the inflammatory response, including the following steps:

[0105] 1) 1.5×10 5 hepatocytes and 1.5×10 5 macrophages were mixed in 75 μL of DMEM medium to obtain a cell mixture; the cell mixture was inoculated into agarose micropores.

[0106] 2) Each agarose micropore inoculated with the cell mixture was added to one well in a 24-well plate. The 24-well plate was divided into 5 groups, with 3 wells in each group. Each group was treated as follows:

[0107] Control group: Add 1 μL of dimethyl sulfoxide (DMSO) to each well;

[0108] SBI-115 group: Add SBI-115 (MedChemExpress, Catalog No: HY-15677) with a final concentration of 10 μM to each well;

[0109] PA+OA+G / TLCA group: Add a PA-OA mixture with a final concentration of 200 μM and 2 μL of G / TLCA to each well;

[0110] Prevention model group: Add a PA-OA mixture with a final concentration of 200 μM, 2 μL of G / TLCA and SBI-115 with a final concentration of 10 μM to each well;

[0111] Treatment model group: After adding a PA-OA mixture with a final concentration of 200 μM and 2 μL of G / TLCA to each well and treating for 48 h, add SBI-115 with a final concentration of 10 μM.

[0112] After the 5 groups were treated, they were cultured for 7 days under the conditions of 37 °C and 5% CO2.

[0113] After culturing for 7 days, the cells were collected for Oil Red O staining, flow cytometry analysis and real-time fluorescence quantitative PCR, and the primer sequences used are shown in Table 1.

[0114] The results showed that after the intervention of G / TLCA, the phenomenon of lipid accumulation in hepatocytes was significantly enhanced. Through quantitative analysis of Oil Red O staining, the proportion of lipid droplet-positive cells in the PA+OA+G / TLCA group was significantly higher than that in the control group. In the preventive treatment plan, there was no statistical difference in the lipid deposition level between the experimental group and the blank control group, while the therapeutic intervention could reduce the area of the lipid droplet-positive region compared with the model group ( Figure 7 ).

[0115] Flow cytometry detection showed that G / TLCA treatment significantly increased the cell mortality rate, while after receiving the dual treatment plan, the cell mortality rate decreased significantly in both the prevention model group and the treatment model group. It can be seen that SBI-115 can effectively relieve the hepatocyte damage caused by TGR5 activation ( Figure 8 ).

[0116] The results of real-time fluorescence quantitative PCR showed that compared with the PA+OA+G / TLCA treatment group, the mRNA expression levels of the key inflammatory factors IL-6 and IL-8 in the treatment model group and the prevention model group were significantly decreased. It can be seen that SBI-115 has an obvious effect in relieving the inflammatory response caused by TGR5 activation ( Figure 9In A). It was confirmed that the TGR5 inhibitor could effectively relieve the inflammatory response of hepatocytes, and this effect could be achieved by regulating the lipid metabolism reprogramming mechanism mediated by the TGR5 signaling pathway.

[0117] The cells in the PA+OA+G / TLCA group, preventive model group, and treatment model group after 7 days of culture were sent to Shenzhen Huiyun Company for metabolomics analysis, and the results are shown in Figure 10 In B. The results showed that SBI-115 could restore carnitine metabolism and reverse the progression of MASH.

[0118] Example 5 Compensatory treatment based on TGR5 overexpression-induced carnitine metabolism imbalance

[0119] In a mouse model, the present invention used two models, HFHfr+C.diffFMT and LCA+HFHfr, to determine the effect of L-carnitine on MASLD or MASH, including the following steps:

[0120] 1. HFHfr+C.diffFMT model

[0121] Objective: To induce metabolic dysfunction-associated fatty liver disease (MASLD) by a high-fat and high-fructose diet (HFHfr), and to determine the role of the gut microbiota in the progression of MASLD by combining fecal microbiota transplantation (FMT) with Clostridium difficile (C.diff).

[0122] Construction method:

[0123] 1) C57BL / 6J mice were fed with a high-fat and high-fructose diet (Research Diets, Catalog.NO: D09100301).

[0124] 2) Clostridium difficile (Beijing CapitalBio Corporation, Bio-18725) was cultured under anaerobic conditions in a modified Brain-Heart Infusion (BHI) medium supplemented with 5 g / L yeast extract and 0.1% L-cysteine. The bacteria were cultured for 24 h until the OD 600 value reached 1.5.

[0125] 3) The cultured Clostridium difficile was prepared into a 1 ml bacterial solution and administered to the mice by oral gavage. Starting from 12 weeks of feeding the mice with a high-fat and high-fructose diet, Clostridium difficile gavage was performed every two weeks and the high-fat and high-fructose diet was continued until the 16th week.

[0126] 2. LCA+HFHfr model

[0127] Objective: To induce MASLD by high-fat and high-fructose diet (HFHfr) and administer lithocholic acid (LCA, Sigma-Aldrich, Catalog.NO, 434-13-9) at a dose of 50 mg / kg to determine the role of LCA in the progression of MASLD.

[0128] The construction method was similar to the HFHfr + C.diff FMT model, except that the Clostridium difficile suspension for gavage was replaced with a lithocholic acid solution; the preparation method of the lithocholic acid solution was as follows: dissolve lithocholic acid in normal saline; administer 50 mg / kg body weight of lithocholic acid to mice by oral gavage every day based on the mass of lithocholic acid.

[0129] During the 12th to 20th weeks for both model mice, L-carnitine was administered by gavage at a dose of 10 mg / kg body weight every day; at the same time, a control group was set up, and the control group was gavaged with an equal volume of normal saline. Liver samples of mice were taken and detected at the beginning of the experiment (0 week) and 20 weeks later. Lipid accumulation was detected by Oil Red O staining, liver fibrosis was evaluated by Masson staining, macrophage infiltration was detected by F4 / 80 immunofluorescence staining (kit: PANOVUE, Cata.No.: 10234100050, F4 / 80 antibody: CST, Cata.No.: 70076), cell death rate was measured by flow cytometry, and liver pathological changes were evaluated by NAS score recorded in the literature [Kleiner D E, Brunt E M, Van Natta M, et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease[J]. Hepatology, 2005, 41(6):1313 - 21.]. The results are shown in Figure 10 and Figure 11 .

[0130] The results showed that the supplementation of L-carnitine could significantly reduce the NAS score in the livers of mice, decrease lipid accumulation and the degree of liver fibrosis, and reduce the infiltration level of F4 / 80-positive macrophages. The above changes indicate that L-carnitine can effectively relieve liver injury and fibrosis, and improve lipid metabolism disorders and inflammatory responses in the liver in the MASH models induced by HFHfr + C.diff FMT and LCA + HFHfr.

[0131] Example 6 Targeted gene intervention verification model based on the ubiquitination degradation pathway of the TGR5-TRIM21-BBOX1 axis

[0132] Two mouse MASH models (HFHfr + C.diffFMT and LCA + HFHfr) were constructed using the method of Example 5, and the effect of TGR5-targeted therapy was evaluated. First, the mice were divided into a treatment group (injected 12 weeks after HFHFr diet) and a prevention group (injected before feeding HFHFr), and AAV8 virus was injected via the tail vein, aiming to overexpress Bbox1 or specifically knockout the Gpbar1 and Trim21 genes ( Figure 12 A and B in). During the treatment, the AAV8 virus carried the Alb-Bbox1 gene, Alb-Cre-U6-Gpbar1 sgRNA, or Alb-Cre-U6-Trim21 sgRNA. After the mice were inoculated with the AAV8 virus, they were continued to be fed with HFHfr or LCA + HFHfr diet and monitored until the 16th week. The preparation method of the AAV8 virus is as follows:

[0133] I. Construction of AAV8 plasmid:

[0134] 1. Bbox1 overexpression plasmid (pAAV-Alb-Bbox1)

[0135] (1) Plasmid backbone

[0136] Basic vector: pAAV-CAG-GFP (Addgene, Catalog No. 37825-AAV8).

[0137] (2) Key element sequence

[0138] Alb promoter (SEQ ID NO. 9): 5'-agttccagatggtaaatatacacaagggatttagtcaaacaattttttggcaagaat attatgaattttgtaatcggttggcagccaatgaaatacaaagatgagtctagttaataatctacaattattggttaaagaagtatattagtgctaatttc cctccgtttgtcctagcttttctcttctgtcaaccccacacgcctttggcac-3';

[0139]

[0140] (3) Plasmid Cloning

[0141] Digest the pAAV-CAG-GFP vector. After removing the CAG promoter with the restriction enzyme sites NcoI and AfeI, use T4 DNA ligase (NEB, Catalog No. M0202S) to ligate the Alb promoter to obtain the pAAV-Alb-GFP vector.

[0142] Digest the pAAV-Alb-GFP vector. After removing the GFP sequence with the restriction enzyme sites BamH I and Hind III, use T4 DNA ligase to ligate the Bbox1 sequence to obtain the pAAV-Alb-Bbox1 plasmid.

[0143] Transform and amplify the pAAV-Alb-Bbox1 plasmid using TOP10 competent cells (TOLOBIO, Catalog No. CC96105), and extract the plasmid using an endotoxin-free plasmid kit (TransGen Biotech, Catalog No. EM123-01).

[0144] 2. Gpbar1 knockout plasmid (pAAV-Alb-Cre-U6-Gpbar1 sgRNA) and Trim21 knockout plasmid (pAAV-Alb-Cre-U6-Trim21 sgRNA)

[0145] (1) Plasmid backbone: pAAV-Alb-Bbox1 constructed in step 1.

[0146] (2) Key element sequences:

[0147] Cre enzyme sequence (SEQ ID NO.11): 5'-atgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcatcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattag-3';

[0148] U6 promoter fused with gRNA scaffold sequence (SEQ ID NO.12): 5'-gagggcctatttcccatgattccttcatattt gcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgggtcttcgagaagacctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3';

[0149] Table 2 sgRNA sequences

[0150]

[0151] (3) Plasmid cloning

[0152] Digest the pAAV-Alb-Bbox1 vector at the ApaI restriction site, and use T4 DNA ligase to ligate the Cre enzyme sequence to obtain the pAAV-Alb-Cre-Bbox1 vector.

[0153] Digest the pAAV-Alb-Cre-Bbox1 vector at the BamHI and HindIII restriction sites to remove the Bbox1 sequence, and then use T4 DNA ligase to ligate the U6 promoter fused with the gRNA scaffold sequence to obtain the pAAV-Alb-Cre-U6-gRNA vector.

[0154] Digest the pAAV-Alb-Cre-U6-gRNA vector at the BbsI restriction site, and use T4 DNA ligase to ligate the sgRNA of Gpbar1 or the sgRNA of Trim21 to obtain the pAAV-Alb-Cre-U6-Gpbar1 sgRNA plasmid and the pAAV-Alb-Cre-U6-Trim21 sgRNA plasmid.

[0155] Transform and amplify in TOP10 competent cells, and extract the plasmid using an endotoxin-free plasmid kit (TransGen Biotech, Cat.No.: EM123-01).

[0156] II. Packaging of AAV8 Vector

[0157] 1. Packaging Cells: HEK293T (ATCC, Cat. No.: CRL-3216) cells are used for packaging the AAV8 vector.

[0158] 2. Preparation of Plasmids: Recombinant plasmids: AAV8-Alb-Bbox1, AAV8-Alb-Cre-U6-Gpbar1 sgRNA, AAV8-Alb-Cre-U6-Trim21 sgRNA; AAV helper plasmids: AAV-Helper (Polyplus, Cat. No.: 101000183), AAV-RC Range (Polyplus, Cat. No.: 101000216).

[0159] 3. Transfection and Cultivation: ① Mix Opti-MEM (Thermo Fisher, Cat. No.: 31985062) with liposome transfection reagent (Abbkine, Cat. No.: BMU111); ② Mix Opti-MEM with 20 μg of AAV-Helper, 20 μg of AAV-RC Range and 15 μg of the recombinant plasmid, add ② to ①, mix well and let stand for 15 min, then add the mixture to HEK293T cells with 80% confluence. Change the medium at 6 - 8 h and collect the virus solution after 72 h.

[0160] III. Collection

[0161] 1. Collection of Medium + Cells: At 72 h after transfection, collect the medium and scrape the cells with a cell scraper and collect them together.

[0162] 2. Virus Extraction: Use a commercial AAV purification kit (TaKaRa, Cat. No.: 6666) to purify the virus.

[0163] 3. Quantification: Quantify the purified AAV8 virus by qPCR method (TaKaRa, Cat. No.: 632252), quantify according to the capsid protein to determine the virus titer. The primers used are as follows:

[0164] F: 5'-ATGGAAGCGCCAGAGAGAAA-3' (SEQ ID NO.17);

[0165] R: 5'-CTAGTGATGGTGATGGTGGC-3' (SEQ ID NO.18).

[0166] IV. Injection

[0167] Injection method: Inject the AAV8 virus into mice through the tail vein.

[0168] Dose: Inject 1×10 10 viral genomes (vg) per mouse.

[0169] Injection frequency: Once a week for 4 consecutive weeks to ensure continuous expression or knockout of the target gene in hepatocytes.

[0170] Set up a control group. Mice in the control group were injected with 200 μl of normal saline. After 16 weeks, liver samples of the mice were taken and detected. Lipid accumulation was detected by Oil Red O staining, liver fibrosis was evaluated by Masson staining, macrophage infiltration was detected by F4 / 80 immunofluorescence staining, cell death rate was measured by flow cytometry, and liver pathological changes were evaluated by NAS score. OE Biotech was commissioned for RNA-seq analysis, GSEA analysis and metabolomics analysis. The results are shown in Figures 13 to 17 .

[0171] The results showed that compared with the control group, the treatment groups (Bbox1 overexpression group, Gpbar1 knockout group, Trim21 knockout group) showed significant improvements in reducing hepatic vacuolar degeneration, decreasing the area of Oil Red O positive staining, and in liver fibrosis and liver inflammation ( Figures 13 to 16 ). RNA-seq analysis and GSEA analysis further confirmed the significant improvements in liver lipid metabolism, inflammation and fibrosis in the treatment groups ( Figure 17 in A). Metabolomics analysis showed that the levels of hepatic carnitine metabolites in the treatment groups were significantly increased ( Figure 17 in B), indicating that the treatment had a positive effect on fatty acid metabolism and energy metabolism.

[0172] In summary, the present invention proposes a novel treatment strategy based on TGR5 regulation. By targeting TGR5 and its downstream signaling pathways, the expression of BBOX1 protein is restored, and the endogenous carnitine level in hepatocytes is increased, thereby improving lipid metabolism disorders and effectively delaying the progression of MASLD to MASH. The present invention provides a new technical means for the precise treatment of MASLD / MASH and fills the gap in existing treatment regimens.

[0173] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments according to these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of carnitine and / or substances promoting carnitine synthesis in the preparation of a medicament for treating fatty liver disease associated with metabolic dysfunction, wherein the substances promoting carnitine synthesis include one or more of a TGR5 inhibitor, a substance increasing the expression level of the Bbox1 gene, a substance decreasing the expression level of the Gpbar1 gene, and a substance decreasing the expression level of the Trim21 gene.

2. The application according to claim 1, characterized in that, The fatty liver disease associated with metabolic dysfunction includes non-alcoholic steatohepatitis associated with metabolic dysfunction.

3. The application according to claim 1, characterized in that The carnitine includes L-carnitine; the TGR5 inhibitor includes SBI-115.

4. The application according to claim 1, characterized in that The substance increasing the expression level of the Bbox1 gene includes a Bbox1 recombinant expression vector and / or an adenovirus containing the Bbox1 recombinant expression vector; the substance decreasing the expression level of the Gpbar1 gene includes: a recombinant vector knocking out Gpbar1 and / or an adenovirus containing the recombinant vector knocking out Gpbar1; the substance decreasing the expression level of the Trim21 gene includes: a recombinant vector knocking out Trim21 and / or an adenovirus containing the recombinant vector knocking out Trim21.

5. The application according to claim 4, characterized in that The Bbox1 recombinant expression vector includes an Alb promoter and a Bbox1 sequence; the nucleotide sequence of the Alb promoter is as shown in SEQ ID NO.9, and the nucleotide sequence of the Bbox1 sequence is as shown in SEQ ID NO.

10.

6. The application according to claim 4, wherein The recombinant vector knocking out Gpbar1 contains an sgRNA of the Gpbar1 gene; the recombinant vector knocking out Trim21 contains an sgRNA of the Trim21 gene; The nucleotide sequences of the sgRNA of the Gpbar1 gene are as shown in SEQ ID NO.13 and SEQ ID NO.14; the nucleotide sequences of the sgRNA of the Trim21 gene are as shown in SEQ ID NO.15 and SEQ ID NO.

16.

7. The application according to any one of claims 4 to 6, characterized in that The adenovirus includes an AAV8 virus.

8. A drug for treating metabolic dysfunction-related fatty liver disease, characterized in that, The active ingredient includes carnitine and / or a TGR5 inhibitor; based on the body weight of a mouse, the unit dose of carnitine in the medicament is 0.1-100 mg / kg body weight; the unit dose of the TGR5 inhibitor in the medicament is 0.1-100 μM.

9. The drug according to claim 8, characterized in that, The carnitine includes L-carnitine; the TGR5 inhibitor includes SBI-115.

10. The medicament according to claim 8 or 9, characterized in that, Based on the body weight of a mouse, the unit dose of carnitine in the medicament is 10-20 mg / kg body weight; the unit dose of the TGR5 inhibitor in the medicament is 10-20 μM.

Images