Genetically engineered bacterium for treating inflammatory bowel disease

Abstract

The invention relates to a genetically engineered bacterium for treating inflammatory bowel disease and application thereof, and belongs to the technical field of biological medicine. Specifically, escherichia coli Nissle 1917 (Escherichia coli Nissle 1917, ECN) is taken as a chassis microorganism, and a therapeutic engineering strain is constructed through a multi-stage gene editing strategy: firstly, bile salt tolerance related protein is screened through bioinformatics, and based on a CRISPR-Cas9 mediated homologous recombination technology, a screened homologous protein coding sequence is directionally integrated into a genome, and then a recombinant vector is constructed; therefore, the bile salt tolerance of the strain is improved; secondly, a bile salt hydrolase coding gene is integrated in a genome, and the inflammatory bowel disease is treated by regulating bile acid metabolism. The engineering bacterium effectively treats inflammatory bowel diseases through a dual action mechanism of enhancing intestinal colonization ability and regulating bile acid metabolism.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and particularly relates to a genetically engineered bacterium for treating inflammatory bowel disease. Technical Background

[0002] Inflammatory bowel disease (IBD) mainly includes ulcerative colitis (UC) and Crohn's disease (CD), and is a chronic immune-mediated gastrointestinal inflammation. Epidemiological studies have shown that the global incidence and disease burden of IBD continue to rise, and it is expected that the patient population will expand significantly by 2050 (Wang S, Dong Z, Wan X. Global, Regional, and National Burden of Inflammatory Bowel Disease and Its Associated Anemia, 1990 to 2019 and Predictions to 2050: An Analysis of the Global Burden of Disease Study 2019. Autoimmun Rev. 2024;23(3):103498.). Existing IBD treatment methods have significant limitations: drug treatments (such as corticosteroids, immunosuppressants, and biologics) are prone to drug resistance and difficult to achieve long-term remission; surgical treatment can control the disease locally, but has problems such as a high postoperative recurrence rate and a high risk of complications (Vieujean S, Jairath V, Peyrin-Biroulet L, et al. Understanding the therapeutic toolkit for inflammatory bowel disease. Nat Rev Gastroenterol Hepatol. 2025.).

[0003] There are many challenges in existing methods for treating IBD, including side effects of drug treatments, poor patient compliance, poor long-term treatment effects, and ineffectiveness for some patients. In addition, the pathogenesis of IBD is complex, involving multiple factors such as genetics, environment, gut microbiota dysbiosis, and immune system abnormalities, which makes treatment more difficult.

[0004] In recent years, microbial therapy has provided new strategies for the treatment of IBD. Among them, Escherichia coli Nissle 1917 (ECN), as a safe probiotic, has been verified for its therapeutic potential through multiple studies: preclinical studies have shown that ECN can significantly reduce the disease activity index (DAI) and histopathological score of the colitis model, and can inhibit the process of intestinal fibrosis; clinical trials have confirmed that its efficacy is comparable to that of mesalazine, suitable for the maintenance treatment of UC in patients of all ages, and can reduce the recurrence risk in CD (Chen Caiping, Ren Hao, Long Tengfei, et al. Research progress on the therapeutic effect of Escherichia coli Nissle 1917 on inflammatory bowel disease [J]. Biotechnology Bulletin, 2023, 39(06): 109-118).

[0005] However, there are still limitations in using ECN alone, and the reasons are mainly in the following two aspects. First, ECN has limited tolerance to the intestinal bile acid environment. Second, bile acid metabolism disorders are closely related to the occurrence and development of IBD. Abnormal bile acid profiles can disrupt intestinal barrier function and exacerbate the inflammatory response (Sinha SR, Haileselassie Y, Nguyen LP, et al. Dysbiosis-Induced Secondary Bile Acid Deficiency Promotes Intestinal Inflammation [J]. Cell Host Microbe. 2020 Apr 8; 27(4): 659-670.e5.). ECN has relatively limited ability to regulate bile acid metabolism and is difficult to effectively improve the common bile acid profile disorders in IBD patients. Summary of the Invention

[0006] In view of the existing challenges in the treatment of inflammatory bowel disease (IBD), the present invention provides a gene-edited engineered bacterium based on Escherichia coli Nissle 1917 (ECN) and a preparation method thereof. By means of genetic engineering, the bile acid tolerance of ECN is enhanced, and its function of regulating the bile acid spectrum is strengthened, which is expected to make up for the deficiencies of existing probiotic therapies and provide a more effective solution for the treatment of IBD. In the present invention, through the CRISPR-Cas9-mediated homologous recombination technology, first, the coding sequence of the bile salt tolerance homologous protein is obtained by bioinformatics alignment screening and integrated into the ECN genome; at the same time, the coding gene of bile salt hydrolase (BSH) is integrated to enhance the bile acid metabolism ability, and a double-gene edited engineered bacterium is constructed. The engineered bacterium achieves an effective therapeutic effect on IBD by enhancing the intestinal colonization efficiency and the bile acid metabolism regulation ability.

[0007] The specific technical solution is as follows:

[0008] A genetically engineered bacterium, in which the coding genes of bile salt tolerance homologous protein and bile salt hydrolase are integrated into the genome of Escherichia coli Nissle 1917.

[0009] Preferably, the bile salt tolerance homologous protein is selected from at least one of CmeB, Betl, MdtM, AcrF or HK homologous protein, and the coding genes are shown in SEQ ID No: 1-5 in sequence. More preferably, it is CmeB.

[0010] Preferably, the bile salt hydrolase is selected from the bile salt hydrolase genes of the genus Bacteroides. Further preferably, the bile salt hydrolase gene is selected from at least one of the bile salt hydrolase genes of Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides uniformis or Bacteroides vulgatus. More preferably, it is Bacteroides uniformis, and the nucleotide sequence is shown in SEQ ID No: 8.

[0011] Preferably, a promoter is also integrated into the genome of the genetically engineered bacterium, and the promoter is selected from at least one of the hce promoter, trc promoter, tac promoter or PL phage promoter. More preferably, it is the hce promoter, and the nucleotide sequence is shown in SEQ ID No: 6.

[0012] Preferably, the integration sites of the bile salt-tolerant homologous protein, bile salt hydrolase or promoter are selected from at least one of the attλ, attB, malEK or yfgL sites of the genome of Escherichia coli Nissle 1917.

[0013] In a specific example of the present invention, the promoter hce is located upstream of the bile salt-tolerant protein CmeB homologous protein and is co-integrated into the malEK site of Escherichia coli Nissle 1917; the bile salt hydrolase BSH gene is integrated into the attB site of Escherichia coli Nissle 1917.

[0014] Another object of the present invention is to provide the use of the genetically engineered bacterium in the preparation of a drug for treating inflammatory bowel disease. The inflammatory bowel disease is selected from ulcerative colitis, Crohn's disease or DSS-induced colitis.

[0015] Another object of the present invention is to provide a drug for treating inflammatory bowel disease, which comprises the genetically engineered bacterium of the present invention and a pharmaceutically acceptable carrier.

[0016] Specifically, the drug is an oral preparation, selected from liquid preparations, capsules, powders, etc., and further preferably at least one of oral liquid, enteric-coated capsules, lyophilized powders or microencapsulated preparations.

[0017] The genetically engineered bacterium of the present invention uses Escherichia coli Nissle 1917 (Escherichia coli Nissle1917, ECN) as the chassis microorganism and is constructed by a multi-stage gene editing strategy. The specific steps are as follows:

[0018] 1. Through homologous recombination mediated by the CRISPR-Cas9 system, the integration of the bile salt-tolerant homologous protein-encoding gene and the BSH-encoding gene is completed in stages.

[0019] 2. Through antibiotic screening and primer verification, a double-gene edited strain is obtained.

[0020] In a specific example of the present invention, the genetically engineered bacterium is obtained by the following method:

[0021] 1) Prepare competent Escherichia coli Nissle1917 containing the pCas9 plasmid.

[0022] 2) Prepare the malEK-pTargetF plasmid and the homologous repair fragment;

[0023] 3) Electroporate the pTargetF and the homologous repair fragment into the competent cells prepared in step 1), and select positive clones.

[0024] 4) Eliminate the pCas9 plasmid and the pTargetF plasmid of the positive clones.

[0025] A specific example of the present invention is as follows:

[0026] 1) Transfer pCas9 into Escherichia coli Nissle 1917, and select positive clones. The obtained positive clones are placed in a shaker at 37°C at 200 rpm for enlarged culture until the OD approaches 0.6. After adding arabinose with a final concentration of 10 mM for induction, centrifuge at 4°C and 8000g for 10 min to harvest the bacteria, and prepare competent Escherichia coli Nissle 1917 containing pCas9.

[0027] 2) Use primers p1 and p2 to reverse amplify the pTargetF plasmid, transfer the amplified fragment into DH5α, and sequence to verify that the sgRNA site in the pTargetF plasmid in the clone has been changed to malEK. Enlarge the culture of the positive clone and extract the malEK-pTargetF plasmid. Use Escherichia coli Nissle 1917 as a template and primers p3, p4, p5, and p6 to amplify the upstream and downstream homologous arms respectively. Use the synthetic expression frame of the bile salt tolerance protein CmeB homologous sequence as a template and primers p7 and p8 to amplify, and then use primers p3 and p6 for overlap extension PCR of the upstream and downstream homologous arms and the CmeB expression frame to obtain a homologous repair fragment.

[0028] 3) Electroporate the malEK-pTargetF plasmid and the homologous repair fragment obtained in step 2) into the competent cells prepared in step 1), and spread them on an LB plate containing kanamycin (50 μg / mL) and spectinomycin (50 μg / mL), and culture at 30°C for 12 h. Use primers p9 and p10 to verify the positive clones.

[0029] 4) Inoculate the obtained positive clones into LB containing IPTG (0.5 mM), culture in a shaker at 37°C at 200 rpm for 12 h, and then spread them on an LB plate. After the plate is statically cultured at 37°C for 12 h, select the clones and inoculate them on an LB plate containing kanamycin (50 μg / mL) and spectinomycin (50 μg / mL) to verify the plasmid disappearance situation.

[0030] The primers described in steps 2) and 3) are:

[0031] p1: 5’-AACGAACGTACTAGTATTATACCTAGGAC-3’,

[0032] p2: 5’-GTCCTAGGTATAATACTAGTACGTTCGTTGTAGTGCTTTAGTTTTAGAGCTAGA AATAG-3’,

[0033] p3: 5’-CGTCAGCGATATCACTCGGC-3’,

[0034] p4: 5’-GGAATCTGTGAAGGAGAGATCCCTTACATGACCTCGGTTTAGT-3’,

[0035] p5: 5’-CTCTCCTGAGTAGGACAAATATCATGGCGATTTTATGTGCGC-3’,

[0036] p6: 5’-CCATAATTCACTTTACTGGTGTCGA-’,

[0037] p7: 5’-TGAACTAAACCGAGGTCATGTAAGGGATCTCTCCTTCACAGATTCCCAA-3’,

[0038] p8: 5’-GATGCGCACATAAAATCGCCATGATATTTGTCCTACTCAGGAGAGCG-3’,

[0039] p9: 5’-AGGGGACATATTGATGAAGATGGG-3’,

[0040] p10: 5’-CGTTCTGTGCTTTGATGGCG-3’.

[0041] Advantages of the present invention:

[0042] Escherichia coli Nissle 1917 (ECN), one of the most studied probiotics currently, does not carry pathogenic factors and is non-pathogenic. In addition, ECN has the functions of intestinal epithelial adhesion, protection and repair of the intestinal mucosal barrier; it can also participate in the body's immune regulation, balance the secretion of immune factors, enhance the host's immune ability, and thus relieve and treat inflammation, having natural advantages in the treatment of IBD.

[0043] BSH can hydrolyze the amide bond of bile acids, thereby regulating bile acid metabolism and improving the symptoms of IBD. Bile acids are one of the main survival and colonization challenges for intestinal microorganisms, and only probiotics with strong bile acid tolerance can stably colonize in the intestine.

[0044] The present invention uses ECN as the chassis microorganism, which has the characteristics of high safety and reduced unnecessary side effects. Through gene editing means, a gene-edited engineering bacterium with ECN as the chassis bacterium is constructed, enabling the strain to enhance its tolerance to bile salts, effectively regulate the bile acid pool, and improve IBD symptoms. This lays a foundation for the further development of probiotic products that can improve the bile acid metabolism disorder in IBD patients. At the same time, the engineered probiotic provided by the present invention can be used as an oral probiotic, which is convenient to use and helps improve the compliance of patients. Description of the Drawings

[0045] Figure 1 For the PCR results of verifying the knock-in of hce and different bile salt-tolerant homologous proteins by agarose gel electrophoresis.

[0046] Figure 2 For the bile salt tolerance test results of the engineered bacteria with the knock-in of hce and different bile salt-tolerant homologous proteins.

[0047] Figure 3 For the PCR results of verifying the knock-in of different promoters and CmeB homologous proteins by agarose gel electrophoresis.

[0048] Figure 4 For the bile salt tolerance test results of the engineered bacteria with the knock-in of different promoters and CmeB homologous proteins.

[0049] Figure 5 For the expression of BSH protein in the engineered bacteria with BSH from different sources.

[0050] Figure 6 For the PCR results of verifying the knock-in of BSH by agarose gel electrophoresis.

[0051] Figure 7 For the body weight change curves of mice in each group.

[0052] Figure 8 For the DAI index curves of mice in each group.

[0053] Figure 9 For the H&E staining images of the colon tissues of mice in each group.

[0054] Figure 10 For the fecal bile acid metabolism of mice in each group. Detailed Embodiments

[0055] The following illustrates the specific steps of the present invention through examples, but is not limited by the examples.

[0056] The terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art, unless otherwise specified. The present invention will be further described in detail below with reference to specific examples and data. It should be understood that these examples are only for illustrative purposes and do not limit the scope of the present invention in any way.

[0057] In the following examples, various processes and methods not described in detail are conventional methods well known in the art.

[0058] The reagents involved in the experiment are as follows:

[0059] LB liquid medium: 5 g of yeast extract, 10 g of tryptone, 10 g of NaCl, made up to 1 L with tap water, natural pH. Sterilized at 121 °C for 20 min.

[0060] SOC liquid medium: 20 g of tryptone, 5 g of yeast extract, 0.5 g of NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM D-glucose, made up to 1 L with tap water. Sterilized by autoclaving at 115 °C for 20 minutes. After cooling to room temperature, 5 mL of 1 M glucose solution (pre-prepared and filtered through a 0.2 μm filter membrane for sterilization) was added.

[0061] The plasmid extraction kit was purchased from TIANGEN, the gel extraction kit was purchased from OMEGA, the seamless cloning kit was selected from Beyotime, the DNA restriction endonuclease was purchased from NEB, the PCR enzyme was purchased from Novoprotein, and the DH5α competent cells were purchased from Tsingke.

[0062] Unless otherwise specified, reagents or drugs can be obtained through commercial channels. For methods such as gene amplification involved, unless otherwise specified, they are carried out according to conventional molecular biology experimental operations or according to the reagent product instructions.

[0063] Example 1 Homologous alignment and screening of bile salt tolerance proteins

[0064] Collect the bile salt tolerance protein sequences, including CmeB, BetL, MdtM, AcrF and HK sequences, and their GenBank IDs are shown in Table 1. Use the BlastP tool to perform a homology alignment with the ECN genome, and select the sequences with a similarity greater than 30% and a coverage greater than 70% as candidate sequences.

[0065] Table 1

[0066] Protein name GenBank ID ECN genomic homologous sequence CmeB ABC59231.1 SEQ ID No: 1 BetL CAD00170.1 SEQ ID No: 2 MdtM CCI76867.1 SEQ ID No: 3 AcrF CAJ1296896.1 SEQ ID No: 4 HK KII20902.1 SEQ ID No: 5

[0067] 1) The homologous sequences obtained by alignment, the promoter hce (SEQ ID No: 6), and the terminator rrnB T1 (SEQ ID No: 7) were used to construct a synthetic expression cassette, which was then directionally integrated into the malEK locus of the ECN genome through CRISPR-Cas9-mediated homologous recombination technology. Subsequently, the successful gene knock-in was verified by PCR amplification and agarose gel electrophoresis. Among them, Figure 1 shows the PCR verification results of different engineered bacteria. Lanes 1, 2, 3, 4, and 5 represent the engineered bacteria corresponding to the homologous proteins CmeB, BetL, HK, MdtM, and Acrf, respectively. The primers used for verification are listed in Table 2.

[0068] Table 2

[0069] Engineered bacteria Forward primer (5'→3') Reverse primer (5'→3') hce-CmeB-rrnB T1 AGGGGACATATTGATGAAGATGGG CGTTCTGTGCTTTGATGGCG hce-BetL-rrnB T1 GCGGCATGTCTTTCTATATTCCA GCGGCCTCAATCGTCTGT hce-HK-rrnB T1 CCAGCAATGTTTTATAGGGGACA AGCGAGCCTTCTACGGGAA hce-MdtM-rrnB T1 CCAGCAATGTTTTATAGGGGACA CCATAACCGCAATGATGGCA hce-Acrf-rrnB T1 GCGGCATGTCTTTCTATATTCCA TGGCGAGCTGGAGTTTGTTC

[0070] 2) The wild-type ECN and the engineered bacteria ECN-hce-CmeB, ECN-hce-BetL, ECN-hce-MdtM, ECN-hce-AcrF, and ECN-hce-HK were respectively mixed with bile salt solutions containing 1% cholic acid (CA), deoxycholic acid (DCA), and chenodeoxycholic acid (CDCA), and co-incubated at 37 °C for 4 hours. The survival rate was determined by the plate counting method. The results showed that the survival rate of ECN-hce-CmeB was the highest, significantly higher than that of the wild-type ECN, verifying the improved bile salt tolerance (see Figure 2 ).

[0071] 3) The hce promoter was replaced with other promoters, including the tac promoter, trc promoter, and PL phage promoter, and synthetic expression cassettes were constructed by respectively combining them with the CmeB homologous protein sequence and the terminator rrnB T1. Similarly, through CRISPR-Cas9-mediated homologous recombination technology, the corresponding engineered bacteria were constructed according to the method in 2). Among them, Figure 3 shows the PCR verification results of different engineered bacteria. Lanes 1, 2, 3, and 4 represent the engineered bacteria corresponding to the hce, tac, trc, and PL promoters, respectively. The primers used for verification are listed in Table 3.

[0072] Table 3

[0073] Engineered bacteria Forward primer (5'→3') Reverse primer (5'→3') hce-CmeB-rrnB T1 AGGGGACATATTGATGAAGATGGG CGTTCTGTGCTTTGATGGCG tac-CmeB-rrnB T1 CATCGGCTCGTATAATGATGCC CGCGTACTGTGAACCGAACA trc-CmeB-rrnB T1 GACAATTAATCATCCGGCTCGT CTGGAATTTGTTCAGTTCATTCGG PL-CmeB-rrnB T1 GTGCTCAGTATCACCGCCAG CGTTAGCTGGAATTTGTTCAGT

[0074] 4) The wild-type ECN and the engineered bacteria ECN-hce-CmeB, ECN-tac-CmeB, ECN-trc-CmeB, and ECN-PL-CmeB were subjected to the bile salt tolerance experiment according to the method in 3). The results showed that the survival rate of ECN-hce-CmeB was the highest, significantly higher than that of the wild-type ECN, and the effect of the hce promoter was better than that of other promoters (see Figure 4 ).

[0075] Taking the optimal bile salt-tolerant homologous protein CmeB homologous protein and the optimal promoter hce screened out in Example 1 as examples, the construction process of the genetically engineered bacterium ECN-hce-CmeB is described in detail below.

[0076] Example 2 Construction of the genetically engineered bacterium ECN-hce-CmeB

[0077] 1) Transfer pCas9 into Escherichia coli Nissle1917, and select positive clones. The obtained positive clones were placed in a shaker at 37°C at 200 rpm for enlarged culture until the OD was close to 0.6. After adding arabinose with a final concentration of 10 mM for induction, the cells were harvested by centrifugation at 4°C and 8000 g for 10 min to prepare competent Escherichia coli Nissle1917 containing pCas9.

[0078] 2) Use primers p1 and p2 to reverse amplify the pTargetF plasmid, transfer the amplified fragment into DH5α, and sequence to verify that the sgRNA site in the pTargetF plasmid in the clone has been changed to malEK. Expand the culture of the positive clone and extract the malEK-pTargetF plasmid. Using Escherichia coli Nissle1917 as a template, upstream and downstream homologous arms were amplified with primers p3, p4, p5, and p6 respectively. Using the synthetic expression frame of the bile salt-tolerant protein CmeB homologous sequence as a template, it was amplified with primers p7 and p8, and then upstream and downstream homologous arms and CmeB expression frame overlap extension PCR were performed with primers p3 and p6 to obtain a homologous repair fragment.

[0079] 3) Electroporate the malEK-pTargetF plasmid and the homologous repair fragment obtained in step 2) into the competent cells prepared in step 1), and spread them on an LB plate containing kanamycin (50 μg / mL) and spectinomycin (50 μg / mL), and culture at 30°C for 12 h. Use primers p9 and p10 to verify positive clones.

[0080] 4) Inoculate the obtained positive clones into LB containing IPTG (0.5 mM), culture at 37°C in a shaker at 200 rpm for 12 h, and then spread them on an LB plate. After the plate was statically cultured at 37°C for 12 h, select clones and inoculate them on an LB plate containing kanamycin (50 μg / mL) and spectinomycin (50 μg / mL) to verify the plasmid disappearance situation.

[0081] The primers described in steps 2) and 3) are:

[0082] p1: 5’-AACGAACGTACTAGTATTATACCTAGGAC-3’,

[0083] p2: 5’-GTCCTAGGTATAATACTAGTACGTTCGTTGTAGTGCTTTAGTTTTAGAGCTAGA AATAG-3’,

[0084] p3: 5’-CGTCAGCGATATCACTCGGC-3’,

[0085] p4: 5’-GGAATCTGTGAAGGAGAGATCCCTTACATGACCTCGGTTTAGT-3’,

[0086] p5: 5’-CTCTCCTGAGTAGGACAAATATCATGGCGATTTTATGTGCGC-3’,

[0087] p6: 5’-CCATAATTCACTTTACTGGTGTCGA-’,

[0088] p7: 5’-TGAACTAAACCGAGGTCATGTAAGGGATCTCTCCTTCACAGATTCCCAA-3’,

[0089] p8: 5’-GATGCGCACATAAAATCGCCATGATATTTGTCCTACTCAGGAGAGCG-3’,

[0090] p9: 5’-AGGGGACATATTGATGAAGATGGG-3’,

[0091] p10: 5’-CGTTCTGTGCTTTGATGGCG-3’.

[0092] Expression of BSH proteins from different sources in Example 3

[0093] 1) Collect BSH proteins from different sources, construct pET-28a(+) expression plasmids, and transform the expression plasmids into BL21(DE3) competent cells. Specifically, take 3 μL of the expression plasmid and transfer it into the thawed BL21(DE3) competent cells, let it stand on ice for 30 min, then heat shock in a 42°C water bath for 60 - 90 s, quickly transfer it to an ice bath, and let it stand for 2 min. Add 700 μL of SOC medium, mix well, and recover at 37°C and 200 rpm for 60 min. Take 50 μL of the bacterial solution and spread it on SOB medium containing ampicillin (100 μg / mL), invert the plate and place it in a 37°C incubator for overnight culture.

[0094] 2) Select positive transformants for resuscitation and activation. Add 500 μL of the activated transformants to 50 mL of LB liquid medium, and simultaneously add kanamycin to a final concentration of 100 μg / mL. Incubate the medium in a shaker at 37 °C until OD 600 = 0.5, then add IPTG to a final concentration of 0.5 mM for induction. The induction temperature is 37 °C and the time is 4 h

[0095] 3) WB verification. After collecting the bacteria, subject them to ultrasonic lysis treatment, and take the supernatant for SDS-PAGE (12% separating gel). Subsequently, transfer the protein to a PVDF membrane, incubate it successively with a primary anti-His tag antibody and an HRP-labeled secondary antibody, and finally observe the results by chemiluminescence development. As Figure 5 shown, lane 0 is the negative control, and lanes 1 - 7 represent the BSH proteins from sources numbered 1 - 7 respectively. Only the protein band of number 5 can be detected. This protein is derived from Bacteroides uniformis, and its BSH protein is approximately 40 kDa in size, showing a specific band; the expression products of the BSH proteins of the remaining strains were not detected (see Table 4 for details).

[0096] Table 4

[0097] Serial number Genus Protein sequences ID Whether it can be expressed 1 Enterococcus faecalis WP_002367364.1 No 2 Anaerobutyricum hallii WP_022170704.1 No 3 Streptococcus infantarius WP_014334522.1 No 4 Lactobacillus acidophilus WP_003547395.1 No 5 Bacteroides uniformis WP_005829400.1 Yes 6 Bifidobacterium longum WP_007052221.1 No 7 Blautia hansenii WP_003020309.1 No

[0098] Taking the BSH gene (SEQ ID No: 8) that was verified to be expressible in Example 3 as an example, the construction process of the genetically engineered bacterium ECN-CmeB-BSH is described in detail

[0099] Example 4 Construction of the Genetically Engineered Bacterium ECN-CmeB-BSH

[0100] 1) Take the ECN-hce-CmeB engineered bacterium finally obtained in Example 1, and reintroduce the pCas9 plasmid into it according to the method in step 1 of Example 1 to prepare competent cells containing pCas9.

[0101] 2) Use primers p11 and p12 to reverse amplify the pTargetF plasmid, transfer the amplified fragment into DH5α, and sequence to verify that the sgRNA site in the pTargetF plasmid in the clone has been changed to attB. Expand the culture of the positive clone and extract the attB-pTargetF plasmid. Use primers p13 and p14, p15 and p16 to amplify the upstream and downstream homologous arms respectively using Escherichia coli Nissle 1917 as the template, use primers p17 and p18 to amplify the BSH gene that was verified to be expressible in Example 3 as the template, use primers p19 and p20 to amplify the hce sequence using the hce sequence as the template, and then use primers p13 and p16 for overlap extension PCR of the upstream and downstream homologous arms, hce, and BSH to obtain the homologous repair fragment.

[0102] 3) Electroporate the attB-pTargetF plasmid and the homologous repair fragment obtained in step 2) into the competent cells prepared in step 1), spread them on an LB plate containing kanamycin (50 μg / mL) and spectinomycin (50 μg / mL), and culture at 30 °C for 12 h. Verify the positive clones using primers p21 and p22. As Figure 6 shown, verify the successful knock-in by PCR amplification and agarose gel electrophoresis. Lane 1 represents the negative control, and lane 2 represents the positive clone band.

[0103] 4) Inoculate the obtained positive clones into LB containing IPTG (0.5 mM), culture at 200 rpm on a shaker at 37 °C for 12 h, and then spread them on an LB plate. After statically culturing the plate at 37 °C for 12 h, select the clones and inoculate them onto an LB plate containing kanamycin (50 μg / mL) and spectinomycin (50 μg / mL) to verify the plasmid disappearance situation

[0104] The primers described in steps 2) and 3) are:

[0105] p11: 5’-ATAAAAAAGCACTAGTATTATACCTAGGAC-3’,

[0106] p12: 5’-AATACTAGTGCTTTTTTATACTAACTTGAGTTTTAGAGCTAGAAATAGCA-3’,

[0107] P13: 5’-TCTTCACATCAATCGGTTTTTCACCC-3’,

[0108] P14: 5’-AGGAGAGATCTAAAAAAGCAGGCTTCAACGGATTCATTTT-3’,

[0109] P15: 5’-GAAAATTGAATACTAACTTGAGCGAAACGGGAAGG-3’,

[0110] P16: 5’-TTACGATGGCGATAATATTTCACCGCA-3’,

[0111] P17: 5’-GCTGGAACCGATGGCAAAAAGAATTCCTATCCTGCTG-3’,

[0112] P18: 5’-CAAGTTAGTATTCAATTTTCACGGGAGCTATCGG-3’,

[0113] P19: 5’-TGCTTTTTTAGATCTCTCCTTCACAGATTCCCAATCT-3’,

[0114] p20: 5’-TTTTTGCCATCGGTTCCAGCTCCTTTTTTCAGAAG-3’,

[0115] P21: 5’-AATGGGGTGGTAGCGAACTG-3’,

[0116] P22: 5’-AAACCGCTACCGCTACCAAA-3’.

[0117] Example 5 investigated the improvement effect of the engineered bacteria on inflammatory bowel disease

[0118] The specific steps are as follows:

[0119] 1. Grouping of mice, model construction and administration of drugs

[0120] C57BL / 6 mice were adaptively fed for 1 week in an SPF environment and randomly divided into 4 groups with 8 mice in each group: untreated Control group (treated with only PBS), Model group (treated with 2.5% DSS and sterile PBS by gavage), ECN-BSH treatment group (treated with 2.5% DSS and ECN-BSH engineered bacteria by gavage), and ECN-CmeB-BSH treatment group (treated with 2.5% DSS and ECN-CmeB-BSH engineered bacteria by gavage). The dose of bacteria by gavage was 1×10 9 CFU / bacterial solution, 200 μL / 25 g per day. The specific experiment was divided into five stages: 1) Adaptation period (from day -7 to day 0), mice were adaptively raised in an SPF-class animal house, and their basic body weight and health status were monitored; 2) DSS modeling period (from day 0 to day 7), the Model group and the treatment groups drank 2.5% DSS water to induce colitis, and the Control group drank sterile water; 3) Strain intervention period (from day 3 to day 10), the treatment groups were gavaged with the corresponding bacterial solution from day 3 of modeling, and the Model group and the Control group were gavaged with PBS; 4) Observation and monitoring period (from day 0 to day 14), the body weight, fecal characteristics and activity status of the mice were recorded daily, and the DAI was calculated; 5) Sample collection and endpoint analysis (day 14), the mice were sacrificed, and colon tissues and fecal samples were collected for subsequent detection.

[0121] 2. Experimental procedures

[0122] 1) Establishment of DSS-induced colitis model

[0123] DSS (molecular weight 36 - 50 kDa) was dissolved in sterile water at a final concentration of 2.5% (w / v) and prepared freshly before use. The Model group and the treatment groups freely drank DSS water for 7 days, and the Control group drank sterile water.

[0124] 2) Preparation of Bacterial Solution and Gavage

[0125] Inoculate the engineered bacteria ECN - BSH and ECN - CmeB - BSH into LB liquid medium respectively, and culture them with shaking at 37°C until OD 600 = 1.0. Centrifuge to collect the bacteria, and resuspend them in sterile PBS to 1×10 9 CFU / mL. Starting from the 3rd day of model establishment, gavage 200 μL of bacterial solution (or PBS) at a fixed time every day for 7 consecutive days.

[0126] 3) Disease Activity Index (DAI) Scoring

[0127] Observe the body weight, stool characteristics and occult blood of the animals every day, record the following indicators according to the table below and calculate DAI (total score 0 - 12):

[0128]

[0129] 4) H&E Staining of Colonic Tissue

[0130] Take about 1 cm of intestinal segment from the distal colonic tissue for formalin fixation, and then perform H&E staining and tissue morphology analysis.

[0131] 5) Determination of Fecal Bile Acids

[0132] a. LC - QQQ - MS Sample Preparation

[0133] Weigh 30 ± 5 mg of fecal samples, add 50% acetonitrile aqueous solution according to the ratio of 1:10. Vortex for 10 min, centrifuge at 12000 rpm at 4°C for 15 min, take the supernatant and remove impurities through a 0.22 μm filter membrane. Take 100 μL of the filtered supernatant, add 100 μL of DCA - d4 internal standard, vortex - mix for 1 minute, and then centrifuge at 12000 rpm at 14°C for 15 min again. Aspirate 150 μL of the supernatant, centrifuge again, and finally aspirate 10 μL of the supernatant and transfer it to an injection vial, and store it at 4°C for subsequent analysis.

[0134] b. LC - QQQ - MS Chromatography / Mass Spectrometry Conditions

[0135] Chromatographic conditions: The chromatographic column was Waters ACQUITY UPLC HSS T3 (100 mm × 2.1 mm, 1.8 μm); mobile phase A was water (containing 0.1% formic acid), and mobile phase B was acetonitrile (containing 0.1% formic acid). The mobile phase gradient was as follows: 0 - 1 min, 5% B - 25% B; 1 - 9 min, 25% - 30% B; 9 - 10 min, 30% - 40% B; 10 - 17 min, 40% - 45% B; 17 - 18.5 min, 45% - 95% B; 18.5 - 20.5 min, 95% B. The running time for each sample was 20.5 min, the column equilibration time was 3 min, and the column effluent was directly introduced into the mass spectrometry system for detection; flow rate: 0.4 mL·min -1 ; Temperature of the autosampler: 4°C; column temperature: 50°C; injection volume: 5 μL. Mass spectrometry detection conditions: Nebulizer flow rate 2.0 L / min, drying gas and heater flow rates were both 10.0 L / min, interface temperature 350°C, DL temperature 250°C.

[0136] 3. Efficacy of the engineered bacteria

[0137] The comparison of the body weight changes of mice is as Figure 7 shown. According to this figure, it can be seen that the body weight of the model group decreased significantly after DSS induction. All treatment groups alleviated the trend of body weight loss in mice, and among them, the ECN-CmeB-BSH group showed the best protective effect.

[0138] The comparison of DAI scores is as Figure 8 shown. According to this figure, it can be seen that the control group mice were healthy and the DAI score was close to zero; while the mice in the DSS-induced colitis model group had severe symptoms and the DAI score increased significantly. After treatment with the engineered bacteria, the DAI score decreased. Further comparison found that the ECN-CmeB-BSH group had the most significant improvement effect, and its DAI score was close to that of the healthy group.

[0139] The H&E staining results of the distal colon of mice in each group showed the intestinal epithelial damage as Figure 9 shown. According to this figure, it can be seen that the control group showed normal intestinal tissue, without inflammatory cell infiltration, the crypt structure was intact, without ulcers or necrosis, and the mucosal layer was uniform and rich in goblet cells. The model group showed severe pathological changes, including severe inflammatory cell infiltration throughout the layer, complete loss of the crypt structure throughout the layer, extensive ulcers and necrosis, as well as mucosal shedding and reduced goblet cells. The pathological characteristics of the treatment groups were all improved, and among them, the ECN-CmeB-BSH group had the pathological characteristics closest to normal: very few inflammatory cell infiltrations, intact crypt structure, without ulcers or necrosis, and the number of goblet cells was close to the normal level.

[0140] The results of the quantitative analysis of fecal bile acid molecules in mice in each group are as Figure 10As shown. According to this figure, the DSS-induced colitis model group showed significant bile acid metabolic imbalance. After treatment with the engineered bacteria, the changing trend of bile acids in DSS-induced colitis mice was significantly reversed, especially the content of free bile acids was increased. Further comparison showed that the ECN-CmeB-BSH strain had the best effect, making its concentration tend to the normal group level.

[0141] In summary, these results demonstrate that the genetically engineered strain of the ECN-CmeB-BSH group can show significant therapeutic effects on DSS-induced murine colitis.

Claims

1. A genetically engineered bacterium, characterized in that, The coding genes of bile salt tolerance homologous proteins and bile salt hydrolases are integrated into the genome of Escherichia coli Nissle 1917.

2. The genetically engineered bacterium according to claim 1, wherein The bile salt tolerance homologous protein is selected from at least one of CmeB, BetL, MdtM, AcrF or HK homologous proteins, and the coding genes are successively shown as SEQ ID No: 1-5.

3. The genetically engineered bacterium according to claim 1, characterized in that, The bile salt hydrolase is selected from the genus Bacteroides.

4. The genetically engineered bacterium according to claim 1, wherein The bile salt hydrolase is selected from at least one of the bile salt hydrolase genes of Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides uniformis or Bacteroides vulgatus.

5. The genetically engineered bacterium according to claim 1, wherein A promoter is also integrated into the genome of Escherichia coli Nissle 1917, and is selected from at least one of the hce promoter, trc promoter, tac promoter or PL phage promoter.

6. The genetically engineered bacterium according to claim 5, wherein The integration site of the bile salt tolerance protein, bile salt hydrolase or promoter is selected from at least one of the attλ, attB, malEK or yfgL sites of the Escherichia coli Nissle 1917 genome.

7. The genetically engineered bacterium according to any one of claims 1-6, characterized in that, The hce promoter is located upstream of the bile salt tolerance homologous protein CmeB and is co-integrated into the malEK site of the Escherichia coli Nissle 1917 genome; the bile salt hydrolase BSH gene is integrated into the attB site of Escherichia coli Nissle 1917.

8. Use of the genetically engineered bacterium according to any one of claims 1-7 in the preparation of a medicament for treating inflammatory bowel disease.

9. The application according to claim 8, wherein The inflammatory bowel disease is selected from ulcerative colitis, Crohn's disease or DSS-induced colitis.

10. A drug for treating inflammatory bowel disease, characterized in that Comprising the genetically engineered bacterium according to any one of claims 1-7 and a pharmaceutically acceptable carrier.

Images