DsRNA preparation of targeted vesicular glutamate transporter for preventing and treating chilo suppressalis and application of dsRNA preparation

Abstract

The invention discloses a dsRNA preparation of a targeted vesicular glutamate transporter for preventing and treating chilo suppressalis and application. The method comprises the following steps: firstly, obtaining chilo suppressalis vGluT gene sequence information, synthesizing dsRNA according to the sequence information, and injecting a targeted chilo suppressalis vGluT gene dsRNA preparation until 6-instar larvae have a relatively high lethal phenomenon; a large amount of dsRNA expression is realized by establishing an escherichia coli dsRNA expression system; finally, the dsRNA is combined with nano-carrier chitosan, and the efficiency of preventing and treating chilo suppressalis larvae is confirmed by spraying a dsRNA preparation. The dsRNA preparation disclosed by the invention is high in gene silencing efficiency and has obvious phenotypic change after gene interference, and chilo suppressalis larvae can be effectively killed after dsRNA and chitosan are combined and sprayed; the invention solves the problem that the chilo suppressalis does not have an effective dsRNA preparation targeting the vGluT gene at present, and has a good application prospect in the aspect of research and development of novel insecticides.

Description

Technical Field

[0001] This application belongs to the field of biopesticides, and specifically relates to a dsRNA preparation targeting vesicular glutamate transporter for controlling Chilo suppressalis and its application. Background Art

[0002] Chilo suppressalis Walker is one of the most serious pests in rice production, causing an annual rice yield loss of over one million tons. The current control strategy highly relies on chemical insecticides. However, monitoring data shows that Chilo suppressalis populations in some major rice-producing areas have developed significant resistance to major categories of insecticides such as organophosphates, macrolides, and diamides. Therefore, researching and developing environmentally friendly new insecticides is of great significance for the prevention and control of Chilo suppressalis.

[0003] RNA interference (RNAi) is a phenomenon in which dsRNA causes sequence-specific degradation of the target gene mRNA, resulting in a decrease in the expression level of the target gene. RNAi has become an important tool for studying insect gene functions, and this technology has become a new pest control method in the field of plant protection: by inhibiting the transcription level of genes crucial for pest growth and development through RNAi to achieve the purpose of pest control. Therefore, applying RNAi technology to develop new insecticides is of great significance for pest control.

[0004] Glutamate mediates both excitatory synaptic transmission and participates in inhibitory neural signal conduction in insects. The normal functioning of these functions requires the participation of vesicular glutamate transporter (vGluT). The deletion of vGluT not only causes the death of mice but also results in disorders of motor coordination in Drosophila melanogaster. However, there is no relevant report on the research of the vGluT gene of Chilo suppressalis, nor on its application in RNAi-mediated pest control. Summary of the Invention

[0005] To solve the above problems, the present invention uses the vGluT of Chilo suppressalis as the target gene, provides a method for synthesizing dsRNA and its application in RNAi-mediated pest control, and constructs an Escherichia coli dsRNA expression vector to express dsRNA in large quantities, providing a novel control method for Chilo suppressalis control while reducing the control cost.

[0006] The technical solution adopted by the present invention to solve its technical problems is:

[0007] In the first aspect, the present invention protects a dsRNA molecule, the dsRNA targets the vGluT gene of Chilo suppressalis, and the vGluT gene is as shown in SEQ ID NO.1 or SEQ ID NO.13.

[0008] In a specific embodiment, the dsRNA molecule is composed of a sense strand and an antisense strand, and the nucleotide sequence of the sense strand is as shown in SEQ ID NO.15.

[0009] The dsRNA is prepared by the following method: designing and using a primer pair to amplify the vGluT gene, and then introducing the amplified vGluT gene fragment into Escherichia coli HT115 through a plasmid pET-2P containing a bidirectional T7 strong promoter to construct a strain expressing dsRNA targeting the vGluT gene, and extracting dsRNA from the bacterial solution.

[0010] In a second aspect, the present invention protects a biological material related to the dsRNA molecule described above, and the biological material is selected from at least one of (A1)-(A5):

[0011] (A1) A DNA molecule encoding the double-stranded RNA molecule described in any one of the above;

[0012] (A2) An expression cassette containing the DNA molecule described in (A1);

[0013] (A3) A recombinant vector containing the DNA molecule described in (A1) or a recombinant vector containing the expression cassette described in (A2);

[0014] (A4) A recombinant microorganism containing the DNA molecule described in (A1) or a recombinant microorganism containing the expression cassette described in (A2) or a recombinant microorganism containing the recombinant vector described in (A3);

[0015] (A5) A transgenic cell line containing the DNA molecule described in (A1) or a transgenic cell line containing the expression cassette described in (A2) or a transgenic cell line containing the recombinant vector described in (A3).

[0016] In a third aspect, the present invention protects a dsRNA preparation targeting the vGluT gene of Chilo suppressalis, and the preparation contains the dsRNA molecule described in any one of the above.

[0017] In a specific embodiment, the preparation further comprises the nanocarrier chitosan.

[0018] In a specific embodiment, the mass ratio of chitosan to dsRNA is 1 μg : 200-400 ng.

[0019] In a more specific embodiment, the mass ratio of chitosan to dsRNA can be 1 μg : 200 ng, 1 μg : 300 ng, 1 μg : 400 ng, etc., which can be selected according to actual needs in applications and is not limited thereto.

[0020] In a specific embodiment, the dsRNA preparation may also contain other biological or non-biological components, and those skilled in the art can add specific components according to actual needs.

[0021] Fourthly, the present invention protects the use of any of the dsRNA molecules described above, or the biological materials described above, or any of the dsRNA preparations described above in any one of the following (B1)-(B6):

[0022] (B1) Use in inhibiting the expression of the vGluT gene of Chilo suppressalis;

[0023] (B2) Use in preparing a product for inhibiting the expression of the vGluT gene of Chilo suppressalis;

[0024] (B3) Use in controlling Chilo suppressalis;

[0025] (B4) Use in preparing a product for controlling Chilo suppressalis;

[0026] (B5) Use in reducing the survival rate of Chilo suppressalis;

[0027] (B6) Use in preparing a product for reducing the survival rate of Chilo suppressalis.

[0028] Fifthly, the present invention protects a method for reducing the survival rate of Chilo suppressalis, which comprises contacting any of the dsRNA molecules described above or any of the dsRNA preparations described above with Chilo suppressalis, and waiting for the dsRNA molecule to enter the body of Chilo suppressalis to reduce the survival rate of Chilo suppressalis.

[0029] Sixthly, the present invention protects a method for preventing plants from being damaged by Chilo suppressalis, which comprises contacting any of the dsRNA molecules described above or any of the dsRNA preparations described above with Chilo suppressalis, and waiting for the dsRNA molecule to enter the body of Chilo suppressalis to reduce the survival rate of Chilo suppressalis, thereby preventing plants from being damaged by Chilo suppressalis.

[0030] In a specific embodiment, the plant is a crop that is easily damaged by Chilo suppressalis, such as rice, etc.

[0031] In a specific embodiment, the preparation can be contacted with Chilo suppressalis in various ways, such as by spraying.

[0032] It can be sprayed on the surface of the plant eaten by Chilo suppressalis.

[0033] Seventhly, the present invention protects a preparation method of a dsRNA preparation as described in any of the above, and the preparation method comprises the following steps:

[0034] a) Mixing the dsRNA solution and the chitosan solution according to the target mass ratio;

[0035] b) After treatment in a water bath at 55 ± 5 °C for 1 ± 0.5 minutes, vortex for 30 ± seconds;

[0036] c) Let it stand at room temperature to form a complex and obtain the dsRNA preparation.

[0037] The present invention has the following beneficial effects:

[0038] The dsRNA targeting the vGluT gene synthesized by the present invention can effectively kill the larvae of Chilo suppressalis. The Escherichia coli-mediated RNAi system based on the vGluT target constructed by the present invention can achieve large-scale production of dsRNA through Escherichia coli. The dsRNA preparation wrapped by the nanocarrier chitosan can effectively control Chilo suppressalis by spraying. Compared with the prior art, this dsRNA preparation has outstanding advantages such as strong targeting, environmental friendliness, and low production cost. Description of the Drawings

[0039] Figure 1 : Electrophoresis pattern of the cloned vGluT gene; where, M: 2K Plus Marker; Lanes 1-3: CsvGluT.

[0040] Figure 2 : Electrophoresis pattern of the synthesized dsRNA targeting the vGluT gene; where, M: 2K Marker; Lanes 1-2: dsvGluT.

[0041] Figure 3 : Agarose gel electrophoresis pattern of chitosan-wrapped dsRNA; where, M: Trans 2K DNA marker, Lane 1: dsRNA not wrapped with chitosan, Lane 2: mass ratio of chitosan to dsRNA is 1 µg : 300 ng, Lane 3: mass ratio of chitosan to dsRNA is 1 µg : 400 ng.

[0042] Figure 4 : Effects of injecting nano-dsRNA on the larvae of Chilo suppressalis: where, Figure 4 Figure A in shows the phenotypic changes of Chilo suppressalis in the control group and the treatment group after injecting dsRNA; Figure 4 Figure B in shows the comparison of the survival rates of larvae 72 h after injecting nano-dsvGluT; Figure 4 Figure C in shows the detection of the expression level of the vGluT gene in the larvae of Chilo suppressalis after injecting nano-dsvGluT.

[0043] Figure 5 : Schematic diagram of the dsRNA expression system based on Escherichia coli.

[0044] Figure 6: Agarose gel electrophoresis pattern of inducible expression of dsRNA; where, M: 2K Marker; Lane 1: dsvGluT.

[0045] Figure 7 : Effect of spraying dsRNA preparation on the survival rate of Chilo suppressalis larvae on rice leaves. Detailed implementation manners

[0046] The following examples are used to further illustrate the technical solutions of the present invention, but the protection scope of the present invention is not limited thereto. When the experimental conditions are not specified, they are all carried out according to the conventional operations in the art or the reagent instructions. The reagents / instruments without indicating the manufacturer are all commercially available conventional products.

[0047] Materials and basic methods:

[0048] 1. Test insects

[0049] The indoor insect source of Chilo suppressalis was provided by the Laboratory of Insect Physiology, Biochemistry and Molecular Biology, Nanjing Agricultural University. The breeding conditions were: temperature 27±1°C, relative humidity 60 - 80%, photoperiod L:D = 16:8 h; the test insects were bred in disposable plastic boxes and the fresh feed was replaced every three days.

[0050] 2. Plant materials

[0051] The rice seedlings were cultivated in the greenhouse of Nanjing Agricultural University, and healthy seedlings at 15 - 20 days old were selected for the experiment.

[0052] Through the existing transcriptome library of Chilo suppressalis, the full-length CDS sequence of CsvGluT was initially obtained in the present invention. First, a pair of primers CsvGluT-F and CsvGluT-R were designed at the 5' and 3' non-coding regions of the CDS sequence. Then, the RNA of Chilo suppressalis was extracted and reverse-transcribed into cDNA. Using this cDNA as a template and CsvGluT-F and CsvGluT-R as primers, a conventional PCR reaction was carried out to obtain the full-length CDS sequence of CsvGluT and ligate it to the pMD19-T cloning vector, which was then transformed into Escherichia coli competent cells (DH5α), shaken, and the bacterial liquid was sent for sequencing (Nanjing GenScript Co., Ltd.). The sequencing results were compared and verified with the full-length CDS sequence of CsvGluT obtained from the transcriptome. Subsequently, a 487 bp-length fragment was selected from the CsvGluT CDS sequence for designing and synthesizing dsRNA. First, the injection method was used for RNAi of the target gene to detect its inhibitory effect on the expression level of the target gene and the effect on the survival rate of Chilo suppressalis. Then, by constructing Escherichia coli expressing dsRNA, it was induced to produce a large amount of dsRNA, and the dsRNA was extracted from the bacterial liquid and wrapped with chitosan to form a dsRNA preparation for controlling Chilo suppressalis.

[0053] The following examples illustrate the preferred specific embodiments of the present invention, but the present invention is not limited thereto.

[0054] Example 1: Cloning and sequence verification of the CsvGluT gene

[0055] Using the existing Chilo suppressalis transcriptome database, the CsvGluT gene was obtained, and the full-length CDS sequence of CsvGluT (SEQ ID NO. 1) was initially obtained. The mRNA of the 4th instar larvae of Chilo suppressalis was extracted and reverse transcribed into cDNA. Using this cDNA as a template, CsvGluT-F and CsvGluT-R were designed as primers based on the 5' and 3' untranslated regions of the CsvGluT gene. After PCR amplification of the full-length CDS sequence, it was ligated into the pMD19-T cloning vector and transformed into Escherichia coli competent cells (DH5α). Four monoclonal colonies were picked and sent to Nanjing GenScript for sequencing to obtain the DNA sequence of the CsvGluT gene, as shown in the sequence represented by SEQ ID No. 1 in the sequence listing. According to the open reading frame (ORF) of this sequence, the amino acid sequence of the protein encoded by this gene was deduced, as shown in SEQ ID No. 2. Figure 1 The specific steps are as follows:

[0056] 1) Extraction, quality detection of Chilo suppressalis RNA and synthesis of the first strand of total cDNA;

[0057] 2) Synthesize the CsvGluT CDS fragment by PCR from the first strand of total cDNA;

[0058] CsvGluT-F: ACTCAGGAGTGCCGTGATTG, as shown in SEQ ID No. 3;

[0059] CsvGluT-R: TTAGTAGGTGCCGTCTTGAGTG, as shown in SEQ ID No. 4;

[0060] PCR amplification system (Vazyme company): 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 1 μL of template cDNA, 12.5 μL of 2 × Taq Max Master Mix, 9.5 μL of ddH2O.

[0061] PCR amplification conditions: 95°C × 3 min → (95°C × 15 sec → 60°C × 40 sec → 72°C × 15 sec) × 35 cycles → 72°C × 5 min, and the specific PCR amplification product is shown in

[0062] Figure 1 .

[0063] ​3) Construction of pMD19-CsvGluT Cloning Vector and Gene Base Analysis

[0064] The specific PCR amplification product was cloned into the pMD19-T vector of Takara to obtain the pMD19-CsvGluT vector, and then transferred into Escherichia coli (DH5α) by heat shock method. The DH5α bacterial solution containing the pMD19-CsvGluT vector was sent to Nanjing GenScript for sequencing, and the sequence SEQ ID No.1 in the sequence list was obtained. According to the open reading frame (ORF) of this sequence, the amino acid sequence of the protein encoded by this gene was deduced, as shown in SEQ ID No.2.

[0065] Example 2: Preparation of dsRNA Preparation and RNAi

[0066] The specific primers for the identified Chilo suppressalis vGluT gene were designed using the online dsRNA primer design tool E-RNAi. The dsRNA was synthesized using the T7 RiboMAX TM Express RNAi system kit. The synthesized dsRNA was encapsulated with chitosan, and the dsRNA preparation was injected into the 6th instar larvae of Chilo suppressalis for RNAi. After detecting the dsRNA preparation of Chilo suppressalis, the effect on the expression level of the CsvGluT gene in its body was detected.

[0067] The specific steps are as follows:

[0068] 1) Using the pMD19-CsvGluT cloning vector and GFP plasmid constructed in Example 1 as templates, the corresponding gene fragments were amplified by PCR using primers designed with T7 promoters (dsCsvGluT-T7-F / R and dsGFP-T7-F / R). Among them, the vGluT fragment is shown in SEQ ID No.13, the GFP fragment is shown in SEQ ID No.14, the dsvGluT fragment is shown in SEQ ID NO.15, and the dsGFP fragment is shown in SEQ ID NO.16.

[0069] PCR amplification primers:

[0070] dsCsvGluT-T7-F: taatacgactcactataggg CCATCATGTCACGGCATCTG, as shown in SEQ ID No.5;

[0071] dsCsvGluT-T7-R: taatacgactcactataggg TGATCAAATGCGGAATAGCACC, as shown in SEQ IDNo.6;

[0072] dsGFP-T7-F: taatacgactcactatagggAAGTTCAGCGTGTCCGGC, as shown in SEQ ID No. 7;

[0073] dsvGFP-T7-R: taatacgactcactataggg CACCTTGATGCCGTTCTTC, as shown in SEQ ID No. 8.

[0074] The PCR amplification system (purchased from Vazyme company) was the same as that in Example 1.

[0075] PCR amplification conditions: 95°C × 3 min → (95°C × 15 sec → 58°C × 8 sec → 72°C × 15 sec) × 35 cycles → 72°C × 5 min.

[0076] 2) The above PCR products were recovered by cutting the gel using the Axyprep DNA Gel Extraction Kit, and the recovered products were used as templates. Using the T7 RiboMAX TM Express RNAisystem kit to synthesize dsRNA. Take 1 µL of dsRNA, dilute it 10 times and then detect it. Use a UV spectrophotometer to detect its concentration and detect its quality by agarose gel electrophoresis.

[0077] 3) Chitosan encapsulation of dsRNA

[0078] Chitosan encapsulation of dsRNA: 25 µL of dsRNA (100 µg) was added to 50 µL of 0.1 M sodium sulfate and mixed well by pipetting. Then 100 µL of sodium acetate solution containing 5 µg / µL chitosan was added, and nuclease-free water was added to make up to 200 µL. After mixing the above solution, it was heated in a 55°C water bath for 1 min and then vortexed for 30 s to prepare the dsRNA preparation.

[0079] 4) RNAi of the vGluT gene in Chilo suppressalis

[0080] Use a Hamilton microsyringe to inject dsRNA into the intersegmental region of the tergite of the 6th instar larvae of Chilo suppressalis. The injection amount for each insect was 1 µg of dsRNA, and dsGFP with the same injection amount was used as a control. There were 6 replicates for each treatment, and 15 larvae for each replicate. Among them, 3 groups were observed and the development was statistically analyzed at 72 h, and the other 3 groups collected samples at 24 h and 48 h respectively. A total of three tubes were collected with 4 larvae in each tube, quickly frozen in liquid nitrogen, and stored at -80 o °C in a cryogenic refrigerator for standby, for relative expression analysis.

[0081] 5) The effect of dsRNA on the expression level of the CsvGluT gene in Chilo suppressalis

[0082] Quantitative primers for CsvGluT:

[0083] CsvGluT-F: CACAAGATAGGGGCGACCAC, as shown in SEQ ID No. 9;

[0084] CsvGluT-R: TGTGGTCTCATGGTCCAACG, as shown in SEQ ID No. 10.

[0085] Quantitative primers for the internal reference elongation factor:

[0086] elongation factor-F: TGAACCCCCATACAGCGAATCC, as shown in SEQ ID No. 11;

[0087] elongation factor-R: TCTCCGTGCCAACCAGAAATAGG, as shown in SEQ ID No. 12.

[0088] It was found by semi-quantitative RT-PCR that 24 hours and 48 hours after injecting the chitosan-dsvGluT complex, the expression levels of the vGluT gene in Chilo suppressalis were down-regulated by 41.1% and 32.01% respectively ( Figure 4 Figure C in ). This result indicates that dsRNA can significantly inhibit the expression of target genes, thus verifying the effectiveness of this dsRNA fragment in gene silencing. 72 hours after injection, the test insects in the treatment group showed significant abnormal phenotypes: the body wall shrank, accompanied by obvious browning, and at the same time, the degree of blackening in the head region was significantly aggravated ( Figure 4 Figure A in ). In contrast, the body walls of the individuals in the control group showed a normal stretched state, and their body colors remained healthy, conforming to the characteristics of normal development. Further statistical analysis showed that the cumulative mortality rate of the treatment group reached 34% after 72 hours, and there was a significant difference compared with the control group. (p < 0.05) ( Figure 4 Figure B in ).

[0089] Example 3: Large-scale expression of dsRNA in Escherichia coli and application of dsRNA preparations

[0090] Based on Example 2, specific primers dsvGluT-EcoRI-F, dsvGluT-EcoRI-R and dsGFP-EcoRI-F, dsGFP-EcoRI-R were designed according to the restriction enzyme sites on the pET-2P plasmid. By constructing expression vectors for CsvGluT dsRNA and GFP dsRNA, and then transferring them into competent HT115 cells, a bacterial solution containing dsvGluT and dsGFP was obtained. dsRNA was extracted from the bacterial solution, and the dsRNA extracted from the bacteria was encapsulated with chitosan. By allowing Chilo suppressalis to feed on rice leaves sprayed with the dsRNA preparation, its survival rate was observed.

[0091] The specific steps are as follows:

[0092] 1) Using the pMD19-CsvGluT and GFP plasmids constructed in Example 1, DNA fragments were amplified with primers dsvGluT-EcoRI-F, dsvGluT-EcoRI-R and dsGFP-EcoRI-F, dsGFP-EcoRI-R.

[0093] dsvGluT-EcoRI-F: CCATGGCGGCCGCGGGAATTC CCATCATGTCACGGCATCTG, as shown in SEQ ID No.17;

[0094] dsvGluT-EcoRI-R: GCTAGGGTACCAATCGAATTC TGATCAAATGCGGAATAGCACC, as shown in SEQ ID No.18;

[0095] dsGFP-EcoRI-F: CCATGGCGGCCGCGGGAATTC AAGTTCAGCGTGTCCGGC, as shown in SEQ ID No.19;

[0096] dsGFP-EcoRI-R: GCTAGGGTACCAATCGAATTC CACCTTGATGCCGTTCTTC, as shown in SEQ ID No.20;

[0097] The PCR amplification system (kit purchased from Vazyme) was the same as in Example 2.

[0098] The PCR amplification conditions (kit purchased from Vazyme) were the same as in Example 2.

[0099] 2) The above PCR products were recovered by gel cutting, and using the recovered products as templates, the CsvGluT / GFP gene fragments were inserted into the pET-2P vector linearized with the endonuclease EcoRI by homologous recombination (using a kit purchased from Vazyme), and the RNAi expression vector pET-2P-CsvGluT containing the CsvGluT / GFP gene fragment and the expression vector pET-2P-GFP were obtained respectively.

[0100] 3) The expression vectors pET-2P-CsvGluT and pET-2P-GFP were transformed into HT115 competent cells by heat shock method, and single colony screening was carried out on double-antibody plates (kanamycin 50 µg / mL, tetracycline 10 µg / mL). The bacterial solutions of dsvGluT and dGFP with correct sequence verification were mixed with LB double-antibody medium (kanamycin 50 µg / mL, tetracycline 10 µg / mL) at a volume ratio of 1:1000 respectively, and cultured in an incubator at 37°C and 200 rpm until OD 600 = 0.8 for use.

[0101] 4) When OD 600 = 0.8, IPTG was added to the bacterial solution to a concentration of 0.5 mM, and the centrifuge tube was put back into the constant temperature culture oscillator and continued to be cultured for 5 h;

[0102] 5) After the shaking culture was completed, 10 mL of the bacterial solution was taken into a 15 mL centrifuge tube, centrifuged at 8,000 g for 10 min, and the supernatant was discarded; 500 µL of STE buffer was added to suspend, transferred to a 2.0 mL centrifuge tube, and then 500 µL of isopentyl alcohol (phenol:chloroform:isopentyl alcohol = 25:24:1, pH = 8.0) was added, vortexed vigorously for 100 s, and centrifuged at 13,000 g for 5 min. The supernatant was the total nucleic acid extracted; 0.8 times the volume of isopropanol was used to precipitate the supernatant, centrifuged at 12,000 rpm at 4°C for 10 min; the supernatant was discarded, and the precipitate was washed with 75% ethanol; after drying, it was dissolved in nuclease-free water and the concentration of the product was detected using a spectrophotometer, and chitosan was used for encapsulation according to the concentration of the nucleic acid to ensure that the final concentration of dsRNA was 100 ng / µL.

[0103] 6) Plastic cups with a diameter of 5 cm and a height of 4.5 cm were selected, and about 20 germinated rice seeds were placed in each cup. The rice seedlings were used for testing when they grew to the three-leaf stage (about 10 days); about 2 mL of 1.5% agar aqueous solution was poured on the soil surface of the plastic cup, the soil at the cup mouth was sealed, and left to stand until solidified for later use.

[0104] Using a small sprayer, evenly spray the prepared dsRNA preparation on the rice leaves in small amounts and multiple times, and place the plants at room temperature to air dry naturally. After starving the second-instar larvae of Chilo suppressalis for two hours, transfer them onto the rice leaves, cover the rice with a transparent and breathable plastic cup to prevent external interference and the escape of experimental insects. Place the plants on a plant cultivation rack in a greenhouse (temperature 27 ± 1°C, humidity 65 ± 5%, photoperiod 14L:10D). Each experimental treatment is repeated 3 times, with 3 cups of rice for each repetition. 5 second-instar larvae of Chilo suppressalis are introduced into each cup of rice, and the mortality of the experimental insects is recorded every 24 hours.

[0105] After treatment with the dsRNA preparation targeting the vGluT gene, under the condition of continuous exposure in the greenhouse for 10 days, the cumulative mortality rate of Chilo suppressalis on the experimental group of rice plants reached 42.2%, showing a significant difference compared with the control group (4.4%). It is worth noting that the mortality data was statistically counted until the 10th day after the pesticide spraying. Combining with the continuous observation data, it shows that the preparation of the present invention can maintain an effective insecticidal concentration for about 10 days in the greenhouse simulation environment, demonstrating significant long-term prevention and control characteristics. While ensuring the safe production of food, this preparation strongly promotes the green and sustainable development of agricultural production.

[0106] The protection scope of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, all changes and advantages that can be conceived by those skilled in the art are included in the present invention, and the appended claims are used as the protection scope.

Claims

1. A dsRNA molecule, characterized in that, The dsRNA targets *Chilo suppressalis* vGluT gene, and the vGluT gene is as shown in SEQ ID NO.1 or SEQ ID NO.

13. The dsRNA molecule consists of a sense strand and an antisense strand, and the nucleotide sequence of the sense strand is as shown in SEQ ID NO.

15.

2. A biological material related to the dsRNA molecule according to claim 1, characterized in that, The biological material is selected from at least one of (A1)-(A4): (A1) A DNA molecule encoding the dsRNA molecule recited in claim 1; (A2) An expression cassette containing the DNA molecule recited in (A1); (A3) A recombinant vector containing the DNA molecule recited in (A1) or a recombinant vector containing the expression cassette recited in (A2); (A4) A recombinant microorganism containing the DNA molecule recited in (A1) or a recombinant microorganism containing the expression cassette recited in (A2) or a recombinant microorganism containing the recombinant vector recited in (A3).

3. A dsRNA preparation targeting Chilo suppressalis vGluT gene, characterized in that The preparation contains the dsRNA molecule recited in claim 1.

4. The dsRNA preparation according to claim 3, wherein The preparation further comprises the nano-carrier chitosan.

5. The dsRNA preparation according to claim 4, wherein The mass ratio of the chitosan to the dsRNA is 1 µg: 200-400 ng.

6. The dsRNA molecule recited in claim 1, or the biological material recited in claim 2, or the dsRNA preparation recited in any one of claims 3-5 is used in any one of the following (B1)-(B6): (B1) Application in suppressing the expression of the gene of Chilo suppressalis vGluT ; (B2) Use in the preparation of a product for inhibiting the expression of the Chilo suppressalis gene; vGluT ​ (B3) Use in preventing and controlling Chilo suppressalis; (B4) Use in preparing a product for preventing and controlling Chilo suppressalis; (B5) Use in reducing the survival rate of Chilo suppressalis; (B6) Use in preparing a product for reducing the survival rate of Chilo suppressalis.

7. A method for reducing the survival rate of Chilo suppressalis, characterized in that, Contact the dsRNA molecule recited in claim 1 or the dsRNA preparation recited in any one of claims 3-5 with Chilo suppressalis, and wait for the dsRNA molecule to enter the body of Chilo suppressalis to reduce the survival rate of Chilo suppressalis.

8. A method for preventing rice from being damaged by Chilo suppressalis, characterized in that, Contact the dsRNA molecule recited in claim 1 or the dsRNA preparation recited in any one of claims 3-5 with Chilo suppressalis, and wait for the dsRNA molecule to enter the body of Chilo suppressalis to reduce the survival rate of Chilo suppressalis, thereby preventing rice from being damaged by Chilo suppressalis.

9. A method for preparing a dsRNA preparation according to any one of claims 3-5, characterized in that, The method comprises the following steps: a) Mix the dsRNA solution and the chitosan solution according to the target mass ratio; b) After water bath treatment at 55±5°C for 1±0.5 minutes, vortex for 30±10 seconds; c) Let stand at room temperature to form a complex to obtain the dsRNA preparation.

Images