Preparation method and application of functional escherichia coli for expressing laccase
Genetically engineered the preparation of recombinant E. coli expressing laccase, which solves the problem of low electron transfer efficiency in microbial fuel cells, achieves efficient biopower generation and pollutant treatment, and improves the redox reaction rate and environmental friendliness.
Patent Information
- Application Number
- CN202510275071.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-07-29
AI Technical Summary
In existing microbial fuel cells, redox reactions rely on precious metal electrocatalysts, which are costly and cannot degrade pollutants and have low electron transfer efficiency, which limits their promotion in practical applications.
Recombinant E. coli expressing laccase was prepared by genetic engineering, using the copper ion active center it contained as the active site of the microbial fuel cell to promote electron transfer and redox reaction, using molecular oxygen in the air as electron acceptors, and only water is produced as a by-product.
It improves the electron transfer efficiency and redox reaction rate of microbial fuel cells, enhances biopower generation capacity and pollutant treatment capacity, and complies with the principle of green environmental protection.
Smart Images

Figure CN120384089A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomaterial chemistry, and specifically relates to a method for preparing a functionalized Escherichia coli expressing laccase and its application. Background Art
[0002] Microbial fuel cells use renewable microorganisms as catalysts to carry out natural oxidation processes at the anode, thereby generating current. It has been found in research that during the operation of microbial fuel cells, bacteria also grow at the cathode, and even some strains can significantly improve the output power of microbial fuel cells, such as Escherichia coli, Shewanella, etc. As early as 1997, researchers found that bacteria can grow on the cathode and use the active sites in their bodies to catalyze the reduction of oxygen. In subsequent research, it was found that a biofilm would be generated on the cathode surface of microbial fuel cells due to the presence of bacteria, thereby generating a high electron density. These research results have greatly promoted the development of biocathodes in microbial fuel cells, and the modification and improvement of biocathodes have become a hot research field and received extensive attention in the academic community.
[0003] Although microbial fuel cells have great application potential in theory, there are still some limitations. For example, the existing oxygen reduction reaction (ORR) of air cathodes still relies on noble metal electrocatalysts, which are not only costly but also unable to degrade pollutants, violating the original intention of sustainable development. At the same time, the performance is still limited by the relatively high transmembrane and cell-electrode interface electron transfer resistance. These resistances lead to a significant reduction in the electron transfer rate at the biocathode interface. In addition, the number of catalytically active proteins in natural cells is limited, and the cell membrane has poor conductivity, further restricting the catalytic activity and metabolic ability of microbial cells. The combined effect of these factors results in a relatively low overall performance of microbial fuel cells, seriously hindering their extensive promotion in practical applications.
[0004] To solve these problems, researchers tend to use genetic engineering methods to functionalize cells, promote electron transfer between microorganisms and cathode electrodes, or increase the active sites in natural cells, enhance the process of redox reactions, and provide a suitable microenvironment for the growth and natural catalytic process of microorganisms. Therefore, modifying natural cells through genetic engineering to research and develop new microbial cathode catalysts that can overcome low electron transfer efficiency, are inexpensive and easily available, and have good stability is very likely to provide a feasible strategy for overcoming the key challenges faced by current microbial fuel cells. Summary of the Invention
[0005] In view of the deficiencies of the prior art, the present invention provides a method for preparing a microbial catalyst with high catalytic efficiency and uses the same in a microbial fuel cell. The laccase used is a multi-copper oxidase, and the copper ions contained therein provide active sites for the microbial fuel cell, thereby regulating its electrocatalytic activity and metabolic ability, increasing the electron transfer efficiency, and promoting the redox reaction. It has the dual functions of efficient bioelectricity generation and pollutant treatment.
[0006] The first object of the present invention is to provide a method for preparing a recombinant Escherichia coli electrocatalyst expressing laccase.
[0007] The second object of the present invention is to provide the recombinant Escherichia coli expressing laccase obtained by the above preparation method, which can be used as an electrocatalyst.
[0008] The third object of the present invention is to provide the application of the above electrocatalyst in the preparation of the cathode of a microbial fuel cell.
[0009] To achieve the above invention objects, the present invention provides the following technical solutions:
[0010] A method for preparing a recombinant Escherichia coli electrocatalyst expressing laccase, comprising the following steps:
[0011] S1. According to the full-length cDNA sequence of the laccase gene, the cotA target gene is integrated into the vector plasmid to construct a recombinant expression plasmid, wherein the primer sequences of the cotA target gene are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively;
[0012] SEQ ID NO: 1
[0013] CCGAATTCGAGCTCC GTCGAC ATGACACTTGAAAAATTTGTGGATG
[0014] SEQ ID NO: 2
[0015] GTGGTGGTGGTGGTGCTCGAGTTATTTATGGGGATCAGTTATATCCATC
[0016] The underscore in the primer sequence SEQ ID NO: 1 represents the Sall restriction site, and the wavy line in the primer sequence SEQ ID NO: 2 represents the XhoI restriction site.
[0017] S2. The recombinant expression plasmid is introduced into Escherichia coli to prepare functionalized recombinant Escherichia coli.
[0018] Preferably, the vector is pet-22b+.
[0019] Preferably, the Escherichia coli in step S2 uses the biosafe Escherichia coli BL21(DE3) as the starting strain.
[0020] Furthermore, in step S2, transformation method is used for introduction, including the following steps:
[0021] S21. Add the recombinant expression plasmid into the competent cells, and place them on ice bath. Take the competent cells after ice bath, put them into a constant temperature water bath at 42°C for 90 s, and then place them on ice bath again for 2 - 5 min;
[0022] S22. Resuscitate and culture the LB liquid medium at 37°C and 200 rpm for 1 h; then centrifuge at 6000 rpm for 4 min, remove part of the supernatant, and resuspend and mix the remaining bacterial liquid;
[0023] S23. Spread the bacterial liquid containing Escherichia coli in the previous step onto the LB agar plate containing 100 μg / mL -1 antibiotic, and grow at 37°C for 14 h to obtain the functionalized recombinant Escherichia coli.
[0024] The present invention also claims the recombinant Escherichia coli electrocatalyst expressing laccase prepared by the described method.
[0025] Furthermore, it claims the application of the recombinant Escherichia coli expressing laccase as an electrocatalyst in the preparation of the cathode of a microbial fuel cell.
[0026] Furthermore, suspend the recombinant Escherichia coli electrocatalyst expressing laccase in the LB liquid medium, place the carbon cloth electrode in the LB liquid medium and co-incubate with the recombinant Escherichia coli, and finally obtain the carbon cloth electrode with the recombinant Escherichia coli biofilm expressing laccase attached, which is the cathode.
[0027] As a specific treatment, the treatment during the incubation process specifically includes the following steps:
[0028] S1. Inoculate the functionalized recombinant Escherichia coli into the LB liquid medium containing ampicillin, and place it in a shaking incubator at 37°C and 180 rpm for 12 - 16 h;
[0029] S2. Inoculate with an inoculum size of 2% - 3% into the LB medium containing 50 μg / ml ampicillin, place it in a shaking incubator, at 37°C and 180 rpm, culture for 2 - 2.5 h. When OD = 600 nm reaches 1.0, add isopropyl-β-D-thiogalactoside with a final concentration of 1.0 mmol / L, at 25°C and 180 rpm, induce for 12 h; then balance the cultured bacterial liquid and centrifuge at 5000 rpn for 4 min, and then pour out the supernatant; then centrifuge;
[0030] S3. Take 50 ml of LB solution (i.e., LB liquid medium) containing an antibiotic (ampicillin, to prevent the growth of miscellaneous bacteria and used to determine the growth of target colonies. Other antibiotics that meet the above requirements are acceptable, and the present application does not have strict restrictions), and mix it with the above-mentioned centrifuged bacterial solution. Then add the treated carbon cloth and shake for 24 - 27 h; thus obtained.
[0031] Preferably, the composition of the LB liquid medium is: 10 g of peptone, 5 g of yeast, and 10 g of sodium chloride are mixed in 1 L of ultrapure water.
[0032] Compared with the prior art, the beneficial effects of the present invention are:
[0033] First, the advantage of the active site. The active center of laccase contains copper ions [Cu(II)]. Its binding domain is mainly composed of histidine (His), cysteine (Cys), methionine (Met), etc., and contains a trinuclear Cu center for reducing O2 and an isolated Cu(II) (type 1) adjacent to the substrate site. Among them, type 1 Cu(II) extracts electrons from the substrate and transfers them to the trinuclear Cu position, and laccase can use molecular oxygen as an electron acceptor to oxidize a variety of phenolic and non-phenolic compounds and increase the active sites in Escherichia coli other than cytochrome c. Second, the advantage of being green and environmentally friendly. When oxidizing the substrate, it has the advantages of substrate specificity, mild reaction conditions, and being harmless to the environment. Moreover, it uses molecular oxygen in the air as an electron acceptor and only produces water as a by-product, which conforms to the principle of green environmental protection and enhances the oxygen reduction ability of microbial fuel cells. Description of the Drawings
[0034] Figure 1 It is the cyclic voltammetry test diagram of the functionalized Escherichia coli expressing laccase prepared in Example 1 of the present invention as a microbial catalyst.
[0035] Figure 2 It is the field emission scanning electron microscope diagram of the functionalized Escherichia coli expressing laccase prepared in Example 1 of the present invention as a microbial catalyst. Detailed Embodiments
[0036] Next, the technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments and comparative examples of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present invention.
[0037] The test methods used in the following embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.
[0038] Example 1: A preparation method of a functionalized Escherichia coli expressing laccase as an efficient microbial catalyst, comprising the following steps:
[0039] First step, preparing a functionalized Escherichia coli catalyst by plasmid construction:
[0040] Through literature research, we identified that the cotA gene in Bacillus subtilis has the potential to catalyze the oxygen reduction reaction, and recorded this gene fragment;
[0041] According to the full-length cDNA sequence information of the laccase (cotA) gene, specific primers were synthesized using Snapgene software. According to the pet-22b+ vector used, restriction enzyme sites were selected, and Sac I and Xho I restriction enzyme sites were added to the 5' end and 3' end respectively. The primer sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively. PCR amplification was performed using Takara LA Taq reagent. After the PCR amplification was completed, the product bands were detected by agarose gel electrophoresis, and then the target fragment was purified according to the instructions of the Sangon gel extraction kit. The purified DNA solution was ligated to the vector.
[0042] The primer sequence information is as follows:
[0043]
[0044] Note: The underscore represents the Sall restriction enzyme site, and the wavy line represents the XhoI restriction enzyme site.
[0045] Second step, preparing a functionalized Escherichia coli catalyst by introducing the plasmid into Escherichia coli using the transformation method:
[0046] The prepared plasmid was attached to the bottom of the centrifuge tube in the form of a thin film or powder, centrifuged, and dissolved in sterilized double-distilled water;
[0047] Take 100 μL of competent cells and melt them on ice;
[0048] Take 2 μL of the plasmid and immediately add it to the prepared 100 μL of competent cells, and flick it gently with your finger;
[0049] Ice bath for 30 min. Secondly, take out the competent cells after the ice bath, immediately place them in a 42 °C constant temperature water bath for 90 s, and then ice bath again for 5 min;
[0050] In a laminar flow hood, use a pipette to add 800 μL of pre-warmed LB liquid medium (the composition of LB is 1 L of ultrapure water, containing 10 g of peptone, 5 g of yeast, and 10 g of sodium chloride mixed) to an EP tube, and resuscitate and culture at 37 °C and 200 rpm for 1 h; centrifuge at 6000 rpm for 4 min, remove part of the supernatant, and resuspend and mix the remaining bacterial liquid; then spread the Escherichia coli bacterial liquid on an LB agar plate containing 100 μg / mL -1 antibiotics, and grow at 37 °C for 14 h to obtain functionalized Escherichia coli (ET).
[0051] Application of a functionalized Escherichia coli expressing laccase as an efficient microbial catalyst, including the following steps:
[0052] Inoculate the engineered strain into 5 mL of LB liquid medium containing 50 μg / ml ampicillin, and place it in an oscillating incubator to culture at 37 °C and 180 rpm for 12 h;
[0053] Inoculate at an inoculation amount of 2% into 100 mL of LB containing 50 μg / ml ampicillin, place it in an oscillating incubator at 37 °C, 180 rpm, for 2.5 h. When OD = 600 nm reaches 1.0, add IPTG with a final concentration of 1.0 mmol / L, and induce at 25 °C and 180 rpm for 12 h;
[0054] After leveling the cultured bacterial liquid, centrifuge at 5000 rpn for 4 min, and then pour out the supernatant;
[0055] Disperse and centrifuge twice after leveling with ultrapure water;
[0056] Take 50 ml of LB solution (i.e., LB liquid medium) containing antibiotics (the antibiotic is ampicillin to prevent the growth of miscellaneous bacteria and is used to determine the growth of target colonies) and mix it with the centrifuged bacterial liquid, add the treated carbon cloth, and shake for 24 h;
[0057] Construct an electrolytic cell and place it in a constant temperature water bath (37 °C), pour M9 buffer into it as the electrolyte, and saturate it with oxygen or nitrogen for testing.
[0058] The electrolytic cell is treated as follows: Weigh 11.3 g of purchased M9 medium (commercially available) powder and dissolve it in 979 ml of pure water. After autoclaving at high temperature and high pressure, add 20 ml of 20% D-glucose solution (sterile), 2 ml of 1.0 M MgSO4 solution (sterile), and 0.1 ml of 1.0 M CaCl2 solution (sterile) to prepare M9 complete medium as the electrolyte. The counter electrode uses a platinum electrode, the reference electrode uses a silver chloride electrode, and the working electrode is the carbon cloth loaded with Escherichia coli.
[0059] Example 2:
[0060] A preparation method of a functionalized Escherichia coli expressing laccase as an efficient microbial catalyst, comprising the following steps:
[0061] The first step is to prepare a functionalized Escherichia coli catalyst by plasmid construction:
[0062] Through literature research, we identified that the cotA gene in Bacillus subtilis has the potential to catalyze the oxygen reduction reaction, and recorded this gene fragment;
[0063] According to the full-length cDNA sequence information of the laccase (cotA) gene, specific primers were synthesized using Primerprimer 5 software. According to the pet-22b+ vector used, restriction enzyme sites were selected, and Sac I and Xho I restriction enzyme sites were added to the 5' end and 3' end respectively. PCR amplification was carried out using Takara LA Taq reagent. After PCR amplification, the product bands were detected by agarose gel electrophoresis, and then the target fragment was purified according to the instructions of the Sangon gel extraction kit. The purified DNA solution was ligated with the vector.
[0064] The second step is to use the transformation method to introduce the plasmid into Escherichia coli to prepare a functionalized Escherichia coli catalyst:
[0065] The prepared plasmid was attached to the bottom of the centrifuge tube in the form of a film or powder, centrifuged, and dissolved in sterilized double-distilled water;
[0066] Take 100 μL of competent cells and thaw them on ice;
[0067] Take 4 μL of the plasmid and immediately add it to the prepared 100 μL of competent cells, and flick it gently with your finger;
[0068] Ice bath for 30 min. Secondly, take out the competent cells after ice bath, immediately place them in a 42 °C constant temperature water bath for 60 s, and then ice bath for 5 min again;
[0069] In the ultra-clean workbench, use a pipette to add 500 μL of pre-warmed LB liquid medium to the EP tube, and resuscitate and culture for 1 h at 37 °C and 200 rpm; centrifuge at 5000 rpm for 3 min, remove part of the supernatant, and resuspend and mix the remaining bacterial liquid; then spread the bacterial liquid of Escherichia coli on an LB agar plate containing 100 μg mL -1 antibiotics and grow at 37 °C for 14 h to obtain functionalized Escherichia coli (ET).
[0070] An application of a functionalized Escherichia coli expressing laccase as an efficient microbial catalyst, comprising the following steps:
[0071] Inoculate the engineered strain into 3 mL of LB liquid medium containing 50 μg / ml ampicillin, and place it in an oscillating incubator for culturing at 37 °C and 180 rpm for 16 h;
[0072] Inoculate at an inoculation amount of 3% into 150 mL of LB containing 50 μg / ml ampicillin, place it in an oscillating incubator at 37 °C, 180 rpm for 2 h. When OD at 600 nm reaches 1.0, add IPTG with a final concentration of 1.0 mmol / L, and induce at 25 °C, 180 rpm for 12 h;
[0073] After leveling the cultured bacterial solution, centrifuge at 5000 rpn for 3 min, and then pour out the supernatant;
[0074] After leveling with ultrapure water, disperse and centrifuge twice;
[0075] Take 50 ml of LB solution containing antibiotics and mix it with the well - centrifuged bacterial solution, add the treated carbon cloth, and shake for 24 h;
[0076] Constitute an electrolytic cell and place it in a constant - temperature water bath (37 °C), pour M9 buffer solution into it, and saturate it with oxygen or nitrogen for testing.
[0077] Example 3:
[0078] A preparation method of a functionalized Escherichia coli expressing laccase as an efficient microbial catalyst, comprising the following steps:
[0079] The first step is to prepare a functionalized Escherichia coli catalyst through plasmid construction:
[0080] Through literature research, we identified that the cotA gene in Bacillus subtilis has the potential to catalyze the oxygen reduction reaction, and recorded this gene fragment;
[0081] According to the full - length cDNA sequence information of the laccase (cotA) gene, use Primerprimer 5 software to synthesize specific primers. Select restriction enzyme sites according to the pet - 22b+ vector used, add Sac I and Xho I restriction enzyme sites at the 5' end and 3' end respectively, use Takara LA Taq reagent for PCR amplification. After PCR amplification, detect the product bands by agarose gel electrophoresis, and then purify the target fragment according to the instructions of the biotool gel extraction kit. Connect the purified DNA solution with the vector.
[0082] The second step is to use the transformation method to introduce the plasmid into Escherichia coli to prepare a functionalized Escherichia coli catalyst:
[0083] The prepared plasmid adheres to the bottom of the centrifuge tube in the form of a film or powder, centrifuge, and dissolve it with sterilized double - distilled water;
[0084] Take 100 μL of competent cells and melt them on ice.
[0085] Take 4 μL of plasmid and immediately add it to the prepared 100 μL of competent cells, then flick gently with finger.
[0086] Incubate on ice for 30 min. Next, take out the competent cells after ice bath and immediately place them in a 42 °C constant temperature water bath for 60 s, then ice bath again for 2 min.
[0087] In a laminar flow hood, add 500 μL of pre-warmed LB liquid medium to an EP tube, and resuscitate and culture at 37 °C and 200 rpm for 1 h; centrifuge at 5000 rpm for 3 min, remove part of the supernatant, and resuspend and mix the remaining bacterial liquid; then spread the Escherichia coli bacterial liquid onto an LB agar plate containing 80 μg / mL -1 antibiotics and grow at 37 °C for 14 h to obtain functionalized Escherichia coli (ET).
[0088] Application of a functionalized Escherichia coli expressing laccase as a highly efficient microbial catalyst, including the following steps:
[0089] Inoculate the engineering strain into 5 mL of LB liquid medium containing 50 μg / ml ampicillin, and culture in a shaking incubator at 37 °C and 180 rpm for 16 h;
[0090] Inoculate at an inoculation amount of 3% into 150 mL of LB containing 50 μg / ml ampicillin, place in a shaking incubator at 37 °C and 180 rpm for 2 h. When OD at 600 nm reaches 1.0, add IPTG with a final concentration of 1.0 mmol / L, and induce at 25 °C and 180 rpm for 12 h;
[0091] After leveling the cultured bacterial liquid, centrifuge at 5000 rpn for 3 min, and then pour out the supernatant;
[0092] Level with ultrapure water and disperse and centrifuge twice;
[0093] Take 50 ml of LB solution containing antibiotics and mix it with the centrifuged bacterial liquid, add the treated carbon cloth, and shake for 27 h;
[0094] Construct an electrolytic cell and place it in a constant temperature water bath (37 °C), pour M9 buffer into it, and saturate it with oxygen or nitrogen for testing.
[0095] Effect verification:
[0096] Among them Figure 1It is a CV diagram. In the diagram, CC is a simple carbon cloth (without any modification); WT is wild Escherichia coli (without any modification); ET is a genetically engineered bacterium, that is, the final sample prepared in the examples. Since laccase can be expressed in this engineered bacterium, and the copper ions contained in laccase are the active center structure, laccase significantly improves the electron transfer efficiency and power output of MFC through its copper ion active center. Its mechanism of action includes cytochrome c as an efficient electron mediator, which makes up for the electron transfer barrier between laccase and the electrode. The redox reaction is accelerated by reducing the overpotential, increasing the catalytic activity, and enhancing the biocompatibility.
[0097] Through Figure 1 As can be seen from the CV diagram in, among the three test cells, the CV curve of the strain with genetic engineering modification shows the largest enclosed area and the largest peak current response. This observation indicates that the recombinant Escherichia coli after adding laccase has the fastest reaction kinetics and the highest capacity. The larger the peak current, the faster the redox reaction rate occurring on the electrode surface. This indicates higher catalyst activity, higher reactant concentration, or higher electron transfer efficiency. Therefore, Figure 1 it can be seen that ET has good performance.
[0098] Figure 2 It is a field emission scanning electron microscope image. The bright spots in the image are surviving bacteria, and the uniform dispersion indicates that the modified bacteria can grow normally without destroying their physiological reproduction.
[0099] Obviously, the above-mentioned embodiments of the present invention are merely examples for clearly illustrating the technical solutions of the present invention, rather than limitations on the specific implementation manners of the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the claims of the present invention shall be included in the protection scope of the claims of the present invention.
Claims
1. A method for preparing a functionalized recombinant Escherichia coli expressing laccase, characterized in that, It includes the following steps: S1. According to the full-length cDNA sequence of the laccase gene, the cotA target gene is integrated into the vector plasmid to construct a recombinant expression plasmid, wherein the primer sequences of the cotA target gene are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively; S2. The recombinant expression plasmid is introduced into Escherichia coli to prepare functionalized recombinant Escherichia coli.
2. The preparation method according to claim 1, characterized in that, The vector used is pet-22b+.
3. The preparation method according to claim 2, characterized in that, In step S2, the Escherichia coli described uses the biosafe Escherichia coli BL21(DE3) as the starting strain.
4. The preparation method according to claim 2 or 3, characterized in that, In step S2, the transformation method is used for introduction, including the following steps: S21. The recombinant expression plasmid is added to the competent cells and incubated on ice. Take the competent cells after ice incubation, place them in a 42°C constant temperature water bath for 90 s, and then incubate on ice again for 2 - 5 min; S22. The LB liquid medium is resuscitated and cultured at 37°C and 200 rpm for 1 h; then centrifuged at 6000 rpm for 4 min, part of the supernatant is removed, and the remaining bacterial solution is resuspended and mixed evenly; S23. Spread the bacterial liquid containing Escherichia coli in the previous step onto an LB agar plate containing 100 μg / mL -1 antibiotic, and grow it at 37 °C for 14 h to obtain functionalized recombinant Escherichia coli.
5. The recombinant Escherichia coli expressing laccase prepared by the method described in claim 1.
6. The application of the recombinant Escherichia coli expressing laccase described in claim 5 as an electrocatalyst in the preparation of the cathode of a microbial fuel cell.
7. The application according to claim 6, characterized in that, The recombinant Escherichia coli expressing laccase is suspended in the LB liquid medium, and the carbon cloth electrode is placed in the LB liquid medium and co-incubated with the recombinant Escherichia coli. Finally, the carbon cloth electrode with the recombinant Escherichia coli biofilm expressing laccase attached is obtained, which is the cathode.
8. The application according to claim 7, wherein The treatment during the incubation process specifically includes the following steps: S1. The functionalized recombinant Escherichia coli is inoculated into the LB liquid medium containing ampicillin, placed in a shaking incubator and cultured at 37°C and 180 rpm for 12 - 16 h; S2. Inoculate at an inoculation amount of 2% - 3% into the LB liquid medium containing 50 μg / ml ampicillin, place it in a shaking incubator, culture at 37°C and 180 rpm for 2 - 2.5 h. When OD = 600 nm reaches 1.0, add isopropyl-β-D-thiogalactoside with a final concentration of 1.0 mmol / L, culture at 25°C and 180 rpm for 12 h; then balance the cultured bacterial solution and centrifuge at 5000 rpn for 4 min, and then pour out the supernatant; then centrifuge; S3. Take 50 ml of the LB liquid medium solution containing antibiotics and mix it evenly with the above-mentioned well-centrifuged bacterial solution, add the treated carbon cloth, and shake for 24 - 27 h; thus obtained.
9. The application according to claim 8, wherein The LB liquid medium is a mixture of 1 L of ultrapure water, 10 g of peptone, 5 g of yeast, and 10 g of sodium chloride.