Use of gene FAP in preparation of medicine for non-alcoholic steatohepatitis

By designing and modifying siRNA molecules to silence the FAP gene and block its cleavage of FGF21, the problem of limited efficacy in treating MASH in existing technologies has been solved, achieving effective treatment of MASH and improving the body weight, liver health, and glucose metabolism in mice.

CN120400145BActive Publication Date: 2026-06-12JIANGNAN UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2025-04-03
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Current technologies lack effective therapeutic targets for treating non-alcoholic steatohepatitis (MASH), particularly failing to effectively block the cleavage of fibroblast activating protein (FAP) on fibroblast growth factor 21 (FGF21), resulting in limited drug efficacy.

Method used

The modified double-stranded small interfering RNA (siRNA) molecule was designed and used to specifically silence the expression of the FAP gene and block its cleavage of FGF21. By upregulating the expression of FGF21 protein in vivo through RNA interference technology, the therapeutic effect on MASH was achieved.

🎯Benefits of technology

It significantly inhibited disease progression in MASH model mice, improved weight loss, liver weight ratio, glucose metabolism capacity and liver damage, reduced lipid accumulation and fibrosis, and provided a more effective treatment option for MASH.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120400145B_ABST
    Figure CN120400145B_ABST
Patent Text Reader

Abstract

The application discloses application of a gene FAP in preparation of a drug for non-alcoholic steatohepatitis, and belongs to the technical field of biological medicine. The application proposes that silencing or interfering with expression of the gene FAP can be used for treating or assisting in treating non-alcoholic steatohepatitis. The application first proposes a new strategy of preparing a drug for treating non-alcoholic steatohepatitis by using siRNA, and carries out multi-angle and multi-level verification research, thereby providing a basis for design and clinical application of nucleic acid drugs, and having important clinical treatment significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the application of the FAP gene in the preparation of drugs for non-alcoholic steatohepatitis, and belongs to the field of biomedical technology. Background Technology

[0002] Metabolic dysfunction-associated fatty liver disease (MAFLD) is a liver disease associated with metabolic disorders. Previously known as non-alcoholic fatty liver disease (NAFLD), it encompassed a range of liver conditions from steatosis to nonalcoholic steatohepatitis (NASH). The new definition, Metabolic Dysfunction-Associated Steatohepatitis (MASH), emphasizes the role of metabolic abnormalities in disease progression. A diagnosis of MAFLD is made when the patient has hepatic steatosis and one of the following three conditions: type 2 diabetes, abnormal metabolism, or overweight / obesity. MAFLD is the most common chronic liver disease worldwide. MASH is an inflammatory subtype of MAFLD, characterized by steatosis, hepatocellular damage, and inflammation. Although MASH progresses very slowly, without treatment, over 20% of patients will eventually develop irreversible cirrhosis, and MASH patients have a relatively high risk of developing liver cancer. The core pathogenesis of MASH involves excessive accumulation of fatty acids in hepatocytes, triggering endoplasmic reticulum stress, oxidative stress, and inflammasome activation. These processes are closely related to hepatocyte damage, inflammation, and fibrosis, characteristic of the MASH phenotype. Currently, Resmetriom is the first FDA-approved drug for the treatment of MASH globally, while other drugs are still in clinical trials. Therefore, finding other effective therapeutic targets is another research hotspot in the treatment of MASH.

[0003] Fibroblast growth factor 21 (FGF21) is an atypical member of the FGF superfamily, capable of entering systemic circulation and regulating lipid and carbohydrate metabolism in an endocrine manner. FGF21 is a stress hormone, primarily derived from the liver, and possesses anti-obesity, insulin-sensitizing, and hepatoprotective properties. Its protective effect against MASH targets its pathological features, including reducing fatty acid accumulation, hepatocyte steatosis, and alleviating inflammation and fibrosis. FGF21 can increase adiponectin levels while inhibiting tumor necrosis factor-α (TNF-α) levels, thereby reducing free fatty acid accumulation, inhibiting endoplasmic reticulum stress, reactive oxygen species accumulation, and apoptosis, thus reducing hepatic stellate cell activation and inflammatory cell accumulation, achieving anti-fibrotic and anti-inflammatory effects.

[0004] Fibroblast activation protein (FAP) is a type II transmembrane serine protease, a member of the proline peptidase family, possessing dipeptidyl peptidase and endopeptidase activities. FAP is a site-specific endopeptidase of human FGF21, but it cannot cleave mouse FGF21. FAP exists in the blood in a soluble form and can inhibit the beneficial activity of endogenous FGF21 protein. FAP cleaves the C-terminus of human FGF21 by 10 amino acids, preventing FGF21 from binding to its corresponding receptor and reducing its titer in cell signaling analysis by 380-fold, thus producing inactive FGF21.

[0005] Small nucleic acid drugs exert their effects through RNA interference (RNAi), selectively targeting specific sites with high specificity. They can also extend drug targets to upstream RNAs of functional proteins, regulating target gene expression at the post-transcriptional level. In the early stages of siRNA therapy development, many drugs were designed based on completely unmodified or slightly modified siRNAs to reach appropriate tissues and then silence target genes. These molecules can mediate gene silencing in vivo. However, these approaches may exhibit limited efficacy and potential off-target effects. This invention aims to prepare modified siRNA drugs with RNA interference effects in cells and mice, targeting the identified effective therapeutic target FAP for MASH, to reduce FAP expression and delay MASH progression. Summary of the Invention

[0006] The technical problem this invention aims to solve is to find effective therapeutic targets and provide an effective nucleic acid drug for treating MASH, namely the nucleic acid drug siFAP, to significantly improve the efficacy of MASH treatment. Research results show that administering different concentrations of siFAP via tail vein injection to genetically engineered mice and wild-type mice fed an MASH model (using a fragment of humanized FGF21) fed an MCD diet reduces FAP protein expression while upregulating FGF21 protein expression. This invention applies siFAP to genetically engineered mice and wild-type mice fed an MASH model (using a fragment of humanized FGF21) fed an MCD diet, verifying that FAP can cleave the fragment of humanized FGF21 but not mouse FGF21, and simultaneously verifying the drug's therapeutic effect on MASH. Results show that siFAP can block the cleavage of the fragment of humanized FGF21 gene, and siFAP can effectively inhibit disease progression in MASH model mice by protecting FGF21.

[0007] The first technical solution provided by this invention is a double-stranded siRNA molecule, as shown below:

[0008] The siRNA molecule that inhibits FAP gene expression comprises a double-stranded siRNA molecule having complementary RNA single strands shown in SEQ ID NO.1 and RNA single strands shown in SEQ ID NO.2; each nucleotide in the siRNA is independently modified or unmodified.

[0009] In some embodiments, at least one nucleotide in the double-stranded siRNA molecule is a modified nucleotide.

[0010] In some embodiments, all nucleotides in the double-stranded siRNA molecule are modified nucleotides.

[0011] In some embodiments, the modification is selected from phosphorothioate, 2'-F, 2'-OMe, 2'-Ara-F, 2'-O-MOE, m 6 A or m 5 At least one of C.

[0012] In some embodiments, the modified molecule is as shown in any one of (1) to (7):

[0013]

[0014] In some embodiments, the double-stranded siRNA molecule is shown as any one of siFAP-1 to siFAP-16: siFAP-1:

[0015] 5'(A)-[A]-(C)[A](U)[C](U)[A](CAG)[A](A)[U](U)[A](G)[C](A)[U](U)3';

[0016] 5'[A]-(A)-[U](G)[C](U)[A](A)[U](U)[CUG](U)[A](G)[A](U)[G](U)[U]-(U)-[C]3';siFAP-2:

[0017] 5'(A)-[ A ]-(C)[ A ](U)[ C ](U)[ A ](CAG)[ A ](A)[ U ](U)[ A ](G)[ C ](A)[ U ](U)3';

[0018] 5'[ A ]-(A)-[ U ](G)[ C ](U)[ A ](A)[ U ](U)[ CUG ](U)[ A ](G)[ A ](U)[ G ](U)[ U ]-(U)-[ C ]3';siFAP-3:

[0019] 5'( A )-[A]-( C )[A]( U )[C]( U )[A]( CAG )[A]( A )[U]( U )[A]( G )[C]( A )[U]( U )3';

[0020] 5'[A]-( A )-[U]( G )[C]( U )[A]( A )[U]( U )[CUG]( U )[A]( G )[A]( U)[G]( U )[HER]-( U )-[C]3';cFAP-4:

[0021] 5'( A )-[ A ]-( C )[ A ]( U )[ C ]( U )[ A ]( CAG )[ A ]( A )[ U ]( U )[ A ]( G )[ C ]( A )[ U ]( U )3'?

[0022] 5'[ A ]-( A )-[ U ]( G )[ C ]( U )[ A ]( A )[ U ]( U )[ CUG ]( U )[ A ]( G )[ A ]( U )[ G ]( U )[ U ]-( U )-[ C ]3';cFAP-5:

[0023] 5'(A*)-[A*]-(C)[A*](U)[C](U)[A*](CA*G)[A*](A*)[U](U)[A*](G)[C](A*)[U](U)3':

[0024] 5'[A*]-(A*)-[U](G)[C](U)[A*](A*)[U](U)[CUG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C]3';siFAP-6:

[0025] 5'(A)-[A]-(C')[A](U)[C'](U)[A](C'AG)[A](A)[U](U)[A](G)[C'](A)[U](U)3':

[0026] 5'[A]-(A)-[U](G)[C'](U)[A](A)[U](U)[C'UG](U)[A](G)[A](U)[G](U)[U]-(U)-[C']3';

[0027] siFAP-7:

[0028] 5′(A*)-[ A* ]–(C)[ A* ](HER)[ C ](HER)[ A* ](CA*G)[ A* ](YOUR*)[ U ](HER)[ A* ](G)[ C ](YOUR*)[ U ](U)3';

[0029] 5'[ A* ]-(YOUR*)-[ U ](G)[ C ](HER)[ A* ](YOUR*)[ U ](HER)[ CUG ](HER)[ A* ](G)[ A* ](HER)[ G ](HER)[ U ]-(HER)-[ C ]3';cFAP-8:

[0030] 5'( A* )-[YOUR*]-( C )[YOUR*]( U )[C]( U )[YOUR*]( CA*G )[YOUR*]( A* )[HER]( U )[YOUR*]( G )[C]( A* )[HER]( U )3'?

[0031] 5′[A*]-( A* )-[HER]( G )[C]( U )[YOUR*]( A* )[HER]( U )[CUG](U )[A*]( G )[A*l]( U )[G]( U )[U]-( U )-[C]3';siFAP-9:

[0032] 5'( A* )-[ A* ]-( C )[ A* ]( U )[ C ]( U )[ A* ]( CA*G )[ A* ]( A* )[ U ]( U )[ A* ]( G )[ C ]( A* )[ U ]( U )3';

[0033] 5'[ A* ]-( A* )-[ U ]( G )[ C ]( U )[ A* ]( A* )[ U ]( U )[ CUG ]( U )[ A* ]( G )[ A* ]( U )[ G ]( U )[ U ]-( U )-[ C ]3';siFAP-10:

[0034] 5'(A)-[ A ]-(C')[ A ](U)[ C '](U)[ A ](C'AG)[ A ](A)[ U ](U)[ A ](G)[ C '](A)[ U ](U)3';

[0035] 5'[ A ]-(YOUR)-[ U ](G)[ C '](HER)[ A ](YOUR)[ U ](HER)[ C ' UG ](HER)[ A ](G)[ A ](HER)[ G ](HER)[ U ]-(HER)-[ C ']3';

[0036] siFAP-11:

[0037] 5'( A )-[YOUR]-( C ')[YOUR]( U )[C']( U )[YOUR]( C ' AG )[YOUR]( A )[HER]( U )[YOUR]( G )[C']( A )[HER]( U )3'?

[0038] 5'[A]-( A )-[HER]( G )[C']( U )[YOUR]( A )[HER]( U )[C'UG]( U )[YOUR]( G )[YOUR]( U )[G]( U )[HER]-( U )-[C']3':

[0039] siFAP-12:

[0040] 5'( A )-[ A ]-( C ')[ A ]( U )[ C ']( U )[ A ]( C ' AG )[ A ]( A )[ U ]( U )[A ]( G )[ C ']( A )[ U ]( U )3'?

[0041] 5'[ A ]-( A )-[ U ]( G )[ C ']( U )[ A ]( A )[ U ]( U )[ C ' UG ]( U )[ A ]( G )[ A ]( U )[ G ]( U )[ U ]-( U )-[ C ']3';

[0042] siFAP-13:

[0043] 5'(A*)-[A*]-(C')[A*](U)[C'](U)[A*](C'A*G)[A*](A*)[U](U)[A*](G)[C'](A*)[U](U)3':

[0044] 5'[A*]-(A*)-[U](G)[C'](U)[A*](A*)[U](U)[C'UG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C']3';siFAP-14:

[0045] 5′(A*)-[ A* ]-(C')[ A* ](HER)[ C '](HER)[ A* ](C'A*G)[ A* ](YOUR*)[ U ](HER)[ A* ](G)[ C '](YOUR*)[ U ](U)3';

[0046] 5'[ A* ]-(YOUR*)-[ U ](G)[C '](HER)[ A* ](YOUR*)[ U ](HER)[ C ' UG ](HER)[ A* ](G)[ A* ](HER)[ G ](HER)[ U ]-(HER)-[ C ']3';cFAP-15:

[0047] 5'( A* )-[YOUR*]-( C ')[YOUR*]( U )[C']( U )[YOUR*]( C ' A*G )[YOUR*]( A* )[HER]( U )[YOUR*]( G )[C']( A* )[HER]( U )3'?

[0048] 5′[A*]-( A* )-[HER]( G )[C']( U )[YOUR*]( A* )[HER]( U )[C'UG]( U )[YOUR*]( G )[YOUR*]( U )[G]( U )[HER]-( U )-[C']3':

[0049] siFAP-16:

[0050] 5'( A* )-[ A* ]-( C ')[ A* ]( U )[ C ']( U )[ A* ]( C ' AG )[ A* ]( A* )[ U ]( U )[ A* ]( G )[ C ']( A* )[ U ](U )3';

[0051] 5'[ A* ]-( A* )-[ U ]( G )[ C ']( U )[ A* ]( A* )[ U ]( U )[ C ' UG ]( U )[ A* ]( G )[ A* ]( U )[ G ]( U )[ U ]-( U )-[ C ']3';

[0052] Wherein, A-, U-, C-, and G- represent phosphorothioate-modified ribonucleotides A, U, C, and G, respectively;

[0053] (A), (U), (C) and (G) represent ribonucleotides A, U, C and G modified by 2'-F, respectively;

[0054] [A], [U], [C], and [G] represent ribonucleotides A, U, C, and G modified with 2'-OMe, respectively;

[0055] (A) , (U) , (C) and (G) These represent ribonucleotides A, U, C, and G modified with 2'-Ara-F, respectively.

[0056] [A] , [U] , [C] and [G] These represent ribonucleotides A, U, C, and G modified with 2'-O-MOE, respectively.

[0057] A*, U*, C*, and G* represent the distances from m... 6 A-modified ribonucleotides A, U, C, and G;

[0058] A', U', C', and G' represent the distances from m... 5 C-modified ribonucleotides A, U, C, and G.

[0059] The second technical solution provided by the present invention is an expression vector carrying the siRNA described in the first technical solution.

[0060] The third technical solution provided by the present invention is a host cell containing the siRNA described in the first technical solution, or a host cell transformed with the expression vector described in the second technical solution.

[0061] The fourth technical solution provided by this invention is a pharmaceutical composition containing the siRNA described in the first technical solution, or the expression vector described in the second technical solution, or the host cell described in the third technical solution.

[0062] In some embodiments, the pharmaceutical composition contains a pharmaceutically acceptable carrier or excipient.

[0063] In some embodiments, the pharmaceutically acceptable carrier includes liposomes, microcells, metal particles, or polymer particles.

[0064] The fifth technical solution provided by the present invention is the use of the siRNA described in the first technical solution, or the expression vector described in the second technical solution, or the host cell described in the third technical solution in the preparation of a drug for the prevention, relief and / or treatment of non-alcoholic steatohepatitis.

[0065] In some implementations, the application includes at least one of the following functions:

[0066] (1) Reduce the individual's liver weight / body weight ratio;

[0067] (2) Improves an individual's glucose metabolism capacity;

[0068] (3) Repairing individual liver damage;

[0069] (4) Reduces individual liver TG and TC levels;

[0070] (5) Alleviate the degree of liver fibrosis in individuals.

[0071] Beneficial effects

[0072] 1. This invention is the first to propose that interfering with or silencing the expression of the FAP gene can improve MASH. The MASH model constructed by feeding mice with fragments of humanized FGF21 gene-engineered mice fed with MCD diet can improve the degree of weight loss, improve the liver weight-to-body weight ratio, and improve the glucose metabolism capacity of mice. It improves the development of MASH from three aspects: liver injury, liver lipid accumulation and fibrosis.

[0073] 2. This invention is the first to propose a method for preparing a drug to treat MASH using the nucleic acid drug siFAP, which will promote the application of nucleic acid drugs in the clinical treatment of MASH and is of great significance. Drug research, from compound molecule to actual clinical application, takes an average of 8-10 years and requires substantial human and material resources, resulting in huge time and economic costs. The solution of this invention can significantly shorten the time from drug discovery to clinical translation. Attached Figure Description

[0074] Figure 1 This figure shows the expression levels of the FAP gene in the liver tissues of 4T1 mouse breast cancer cell lines transfected with three siFAPs and successfully modeled with MASH, after tail vein injection of the three siFAPs in humanized FGF21 gene-engineered mice and wild-type mice. Figure A shows the relative expression levels of the FAP gene in the 4T1 cell line after transfection with the three siFAPs; Figure B shows the relative expression levels of the FAP gene in the liver of humanized FGF21 gene-engineered mice; and Figure C shows the relative expression levels of the FAP gene in the liver of wild-type mice.

[0075] Figure 2 This figure shows the expression levels of the FAP gene in the liver tissues of humanized FGF21 genetically engineered mice and wild-type mice after tail vein injection of the third siFAP-1 to the third siFAP-16 fragments following successful transfection of the 4T1 mouse breast cancer cell line and the MASH model. Figure A shows the relative expression levels of the FAP gene after transfection of the third siFAP-1 to the third siFAP-16 fragments in the 4T1 cell line; Figure B shows the relative expression levels of the FAP gene in the liver of humanized FGF21 genetically engineered mice after tail vein injection of the third siFAP-1 to the third siFAP-16 fragments; Figure C shows the relative expression levels of the FAP gene in the liver of wild-type mice after tail vein injection of the third siFAP-1 to the third siFAP-16 fragments.

[0076] Figure 3 Figure 1 shows the changes in body weight and liver weight / body weight in fragment-humanized FGF21 genetically engineered mice and wild-type mice after tail vein injection of the third siFAP-16 following successful MASH modeling. Figure A shows the body weight changes in wild-type mice from 10 weeks of age to 17 weeks of age; Figure B shows the body weight changes in fragment-humanized FGF21 mice from 10 weeks of age to 17 weeks of age; Figure C shows the liver weight / body weight changes in both mouse types during the modeling period from 10 to 15 weeks of age; Figure D shows the liver weight / body weight changes in both groups of mice after successful modeling at 15 weeks of age following drug intervention.

[0077] Figure 4Figure 1 shows the glucose tolerance test results of fragment-humanized FGF21 gene-engineered mice and wild-type mice at different modeling times. Figure A shows the glucose tolerance results of two groups of mice from 10 weeks of age to 12 weeks of age after modeling; Figure B shows the glucose tolerance results of two groups of mice at 15 weeks of age after 5 weeks of modeling; Figure C shows the glucose tolerance results of two groups of mice at 17 weeks of age after simultaneous administration of the drug for 2 weeks after 7 weeks of modeling.

[0078] Figure 5 This figure shows the changes in serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels, indicators of liver injury, in humanized FGF21 genetically engineered mice and wild-type mice at different modeling and drug administration times. Figures A and C show the changes in serum AST and ALT levels in wild-type mice from 10 weeks of age to 17 weeks of age, respectively; Figures B and D show the changes in serum AST and ALT levels in fragment-humanized FGF21 mice from 10 weeks of age to 17 weeks of age, respectively; Figures E and F show the changes in serum AST and ALT levels in the two groups of mice at different drug administration times within the same modeling period.

[0079] Figure 6 This figure shows the changes in liver triglycerides (TG) and total cholesterol (TC) in humanized FGF21 genetically engineered mice and wild-type mice at different modeling and drug administration times. Figures A and C show the changes in liver TG and TC in wild-type mice from 10 weeks of age to 17 weeks of age, respectively; Figures B and D show the changes in liver TG and TC in fragment-humanized FGF21 mice from 10 weeks of age to 17 weeks of age, respectively; Figures E and F show the changes in liver TG and TC in the two groups of mice at different drug administration times at the same modeling time.

[0080] Figure 7 These are liver staining sections from humanized FGF21 genetically engineered mice and wild-type mice at different modeling times and drug administration time segments. Figure A shows HE staining of the two groups of mice at different time points; Figure B shows Oil Red O staining of the two groups of mice at different time points; Figure C shows Sirius Red staining of the two groups of mice at different time points; Figure D shows Masson staining of the two groups of mice at different time points. Detailed Implementation

[0081] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0082] Raw materials used in the examples:

[0083] 1. C57BL / 6J wild-type mice were purchased from Cyagen (Suzhou) Biotechnology Co., Ltd.

[0084] 2. The C57BL / 6J fragment humanized FGF21 genetically engineered mice were purchased from Cyagen (Suzhou) Biotechnology Co., Ltd.

[0085] 3. The mouse breast cancer cell line 4T1 is derived from ATCC.

[0086] 4. siNC is derived from Jiangsu Saisuofei Biotechnology, and its specific sequence is as follows:

[0087] 5'UUCUCCGAACGUGUCACGUTT 3';

[0088] 5'ACGUGACACGUUCGGAGAATT 3'.

[0089] Example 1: Synthesis of Unmodified siRNA and LNP-siFAP

[0090] siRNAs were designed based on the full-length FAP mRNA sequence. The activity of all candidate siRNAs was evaluated according to the basic design principles of siRNAs, and the initial siRNAs were designed and synthesized. All sequences were obtained from the NCBI gene database.

[0091] The first type:

[0092] 5'GGGUGUUUAUGAAGUUGAAGA 3' (SEQ ID NO. 3);

[0093] 5'UUCAACUUCAUAAACACCCAG 3' (SEQ ID NO. 4);

[0094] The second type:

[0095] 5'GUCAGAAGUUCAAGUGCUA 3' (SEQ ID NO. 5);

[0096] 5'UAGCACUUGAACUUCUGACUU 3' (SEQ ID NO. 6);

[0097] The third type:

[0098] 5'AACAUCUACAGAAUUAGCAUU 3' (SEQ ID NO. 1);

[0099] 5'AAUGCUAAUUCUGUAGAUGUUUC 3' (SEQ ID NO. 2).

[0100] Synthesis of LNP-siFAP:

[0101] 1. Determine the N / P (6) ratio and phospholipid concentration (12 mM, 7.5 mg / mL);

[0102] 2. Prepare a compound lipid ethanol solution: Dlin-MC3-DMA / DSPC / cholesterol / PEG-2000-DMG = 50 / 10 / 38.5 / 1.5 (mM);

[0103] 3. siRNA quantification was performed using an Invitrogen Qubit 4 instrument with sodium citrate buffer as the solvent.

[0104] 4. Microfluidic mixing: Load the chip into the adapter and pre-rinse the chip using ethanol and sodium citrate buffer. Assemble the prepared compound lipid ethanol solution, siRNA-sodium citrate buffer, collection tube, and waste tube, with one side containing the compound lipid ethanol solution and the other side containing the siRNA-sodium citrate buffer;

[0105] 5. LNP-siFAP was synthesized at a flow rate ratio of 1:3 and a total flow rate of 16 ml / min;

[0106] 6. Particle size and PDI detection;

[0107] 7. Ultrafiltration;

[0108] 8. Determine the encapsulation efficiency and utilization rate of LNP:

[0109] Encapsulation rate (%) = [(reading after demulsification - reading before demulsification) / reading after demulsification] * 100%;

[0110] RNA utilization rate (%) = [(reading after demulsification - reading before demulsification) * final product volume / total RNA input] * 100%.

[0111] Measurement results:

[0112] The initial particle size of the LNP synthesis product was 77.66 ± 1.16 nm.

[0113] The initial product PDI from the LNP synthesis was 0.038 ± 0.031.

[0114] LNP ultrafiltration final product particle size: 136.2±1.16nm

[0115] LNP ultrafiltration final product PDI: 0.078 ± 0.012

[0116] Encapsulation percentage (%) = [(68.5ng - 3.7ng) / (68.5ng)] * 100% = 94.6%

[0117] RNA utilization rate (%) = [(68.5ng - 3.7ng) * (5000ul) / (3.5mg)] * 100% = 92.6%.

[0118] Example 2: Screening of siFAP and verification of knockdown effect and interference capability.

[0119] I. In vitro experiments

[0120] The three siFAPs in Example 1 were transfected into the mouse breast cancer cell line 4T1 when it reached the logarithmic growth phase. After 36 hours, the cells were treated and RNA was collected. Gene expression was verified by qRT-PCR.

[0121] II. In vivo experiments

[0122] (I) Method for constructing humanized FGF21 gene-engineered mice:

[0123] 1. Vector design, construction, and in vitro transcription: Cyagen Suzhou Biotechnology Co., Ltd. designed the sequences of gRNA and Donor Oligo based on gene information and experimental requirements, synthesized Donor Oligo, constructed the gRNA vector, and performed in vitro transcription on the gRNA vector and Cas9 vector.

[0124] 2. Microinjection and identification of F0 generation C57BL / 6J mice: gRNA and Cas9 mRNA were co-injected with Donor Oligo into fertilized eggs. The microinjected fertilized eggs were returned to the oviduct of surrogate mice. After birth, the mice were identified by PCR and sequencing, and positive F0 mice were obtained.

[0125] 3. Breeding and identification of F1 generation mice: Sexually mature positive F0 mice were bred with wild-type mice to obtain F1 generation mice (heterozygous).

[0126] 4. Breeding and identification of humanized FGF21 mice: Sexually mature F1 mice were used for breeding to obtain homozygous FGF21 mice, and gene identification was performed by PCR and sequencing.

[0127] (II) Construction of the MASH model mouse and experimental grouping:

[0128] Sixty 10-week-old C57BL / 6J mice and 60 wild-type mice of the same age were genetically engineered with the humanized FGF21 gene. Each group was divided into four groups: control group, model group, drug-treated group (LNP-siFAP synthesized from three siFAPs), drug-treated empty vector group (LNP-siNC), and drug-treated empty vector group. Each group contained at least 15 mice. The control group was fed a normal diet, while the other groups were fed an MCD diet for 7 weeks. At 15 weeks of age, mice were administered the drug via tail vein injection at a dose of 2 mg / kg, once every 3 days for two weeks. At 12, 15, and 16 weeks of age, at least 3 mice from each group were sacrificed for tissue collection. At 17 weeks of age, all mice were sacrificed for tissue collection. Blood and tissues were stored at -80°C for subsequent experiments. Gene expression was validated using qRT-PCR.

[0129] III. Experimental Results

[0130] The results are as follows Figure 1 As shown in Table 1, in the 4T1 cell line, transfection with the third type of siFAP knocked down FAP to 0.287, successfully and significantly reducing FAP expression. In the liver tissue of fragment-humanized FGF21 mice, injection of LNP-siFAP (the third type of siFAP) knocked down FAP to 0.284. In the liver of wild-type mice, injection of LNP-siFAP (the third type of siFAP) knocked down FAP to 0.220. Therefore, it can be seen that the siRNAs designed in Example 1 of this invention all have the ability to interfere with the expression of target genes to a certain extent, but the third type of siFAP has a superior ability to interfere with gene expression, thus warranting further research on the third type of siFAP.

[0131] Table 1. Relative expression levels of FAP gene in cells and tissues after addition of different types of siFAP.

[0132]

[0133] Example 3 modifies the third type of siFAP and verifies its knockdown effect and interference capability.

[0134] The third siFAP obtained from the screening in Example 2 was modified with bases and synthesized at a biotechnology company, wherein: A-, U-, C-, and G- represent phosphorothioate-modified ribonucleotides A, U, C, and G, respectively;

[0135] (A), (U), (C) and (G) represent ribonucleotides A, U, C and G modified by 2'-F, respectively;

[0136] [A], [U], [C], and [G] represent ribonucleotides A, U, C, and G modified with 2'-OMe, respectively;

[0137] (A) , (U) , (C) and (G) These represent ribonucleotides A, U, C, and G modified with 2'-Ara-F, respectively.

[0138] [A] , [U] , [C] and [G] These represent ribonucleotides A, U, C, and G modified with 2'-O-MOE, respectively.

[0139] A*, U*, C*, and G* represent the distances from m... 6 A-modified ribonucleotides A, U, C, and G;

[0140] A', U', C', and G' represent the distances from m... 5 C-modified ribonucleotides A, U, C, and G;

[0141] The base modification sequences for siFAP (the third type of siRNA mentioned above) are shown below: siFAP-1 to siFAP-16: siFAP-1:

[0142] 5'(A)-[A]-(C)[A](U)[C](U)[A](CAG)[A](A)[U](U)[A](G)[C](A)[U](U)3';

[0143] 5'[A]-(A)-[U](G)[C](U)[A](A)[U](U)[CUG](U)[A](G)[A](U)[G](U)[U]-(U)-[C]3';

[0144] siFAP-2:

[0145] 5'(A)-[ A ]-(C)[ A ](U)[ C ](U)[ A (CAG) A ](A)[ U ](U)[ A ](G)[ C ](A)[ U ](U)3';

[0146] 5'[ A ]-(A)-[ U ](G)[ C ](U)[ A ](A)[ U ](U)[ CUG ](U)[ A ](G)[ A ](U)[ G ](U)[ U ]-(U)-[ C ]3';

[0147] siFAP-3:

[0148] 5'( A )-[A]-( C )[A]( U )[C]( U )[A]( CAG )[A]( A )[U]( U )[A]( G )[C]( A )[U]( U )3';

[0149] 5'[A]-( A )-[U]( G )[C]( U )[A]( A )[U]( U )[CUG]( U )[A]( G )[A]( U )[G]( U )[U]-( U )-[C]3';

[0150] siFAP-4:

[0151] 5'( A )-[ A ]-( C )[ A ]( U )[ C ]( U )[ A ]( CAG )[ A ]( A )[ U ]( U )[ A ]( G )[ C ]( A )[ U ]( U )3';

[0152] 5'[ A ]-( A )-[ U ](G )[ C ]( U )[ A ]( A )[ U ]( U )[ CUG ]( U )[ A ]( G )[ A ]( U )[ G ]( U )[ U ]-( U )-[ C ]3'?

[0153] siFAP-5:

[0154] 5'(A*)-[A*]-(C)[A*](U)[C](U)[A*](CA*G)[A*](A*)[U](U)[A*](G)[C](A*)[U](U)3':

[0155] 5'[A*]-(A*)-[U](G)[C](U)[A*](A*)[U](U)[CUG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C]3';siFAP-6:

[0156] 5'(A)-[A]-(C')[A](U)[C'](U)[A](C'AG)[A](A)[U](U)[A](G)[C'](A)[U](U)3':

[0157] 5'[A]-(A)-[U](G)[C'](U)[A](A)[U](U)[C'UG](U)[A](G)[A](U)[G](U)[U]-(U)-[C']3';

[0158] siFAP-7:

[0159] 5′(A*)-[ A* ]–(C)[ A* ](HER)[ C ](HER)[ A* ](CA*G)[ A* ](YOUR*)[ U ](HER)[ A* ](G)[ C ](YOUR*)[ U ](U)3';

[0160] 5'[ A*]-(A*)-[ U ](G)[ C ](U)[ A* ](A*)[ U ](U)[ CUG ](U)[ A* ](G)[ A* ](U)[ G ](U)[ U ]-(U)-[ C ]3';siFAP-8:

[0161] 5'( A* )-[A*]-( C )[A*]( U )[C]( U )[A*]( CA*G )[A*]( A* )[U]( U )[A*]( G )[C]( A* )[U]( U )3';

[0162] 5'[A*]-( A* )-[U]( G )[C]( U )[A*]( A* )[U]( U )[CUG]( U )[A*]( G )[A*l]( U )[G]( U )[U]-( U )-[C]3';

[0163] siFAP-9:

[0164] 5'( A* )-[ A* ]-( C )[ A* ]( U )[ C ]( U )[ A* ]( CA*G )[ A* ]( A* )[ U ]( U )[ A* ]( G )[ C ]( A* )[ U ]( U )3';

[0165] 5'[ A* ]-( A* )-[ U ]( G )[ C ]( U )[ A* ]( A* )[ U ]( U )[ CUG ]( U )[ A* ]( G )[ A* ]( U )[ G ]( U )[ U ]-( U )-[ C ]3';

[0166] siFAP-10:

[0167] 5'(A)-[ A ]-(C')[ A ](U)[ C '](U)[ A ](C'AG)[ A ](A)[ U ](U)[ A ](G)[ C '](A)[ U ](U)3';

[0168] 5'[ A ]-(A)-[ U ](G)[ C '](U)[ A ](A)[ U ](U)[ C ' UG ](U)[ A ](G)[ A ](U)[ G ](U)[ U ]-(U)-[ C ']3';

[0169] siFAP-11:

[0170] 5'( A )-[A]-( C ')[A]( U )[C']( U )[A]( C ' AG )[A](A )[HER]( U )[YOUR]( G )[C']( A )[HER]( U )3'?

[0171] 5'[A]-( A )-[HER]( G )[C']( U )[YOUR]( A )[HER]( U )[C'UG]( U )[YOUR]( G )[YOUR]( U )[G]( U )[HER]-( U )-[C']3':

[0172] siFAP-12:

[0173] 5'( A )-[ A ]-( C ')[ A ]( U )[ C ']( U )[ A ]( C ' AG )[ A ]( A )[ U ]( U )[ A ]( G )[ C ']( A )[ U ]( U )3'?

[0174] 5'[ A ]-( A )-[ U ]( G )[ C ']( U )[ A ]( A )[ U ]( U )[ C ' UG ]( U )[ A ]( G )[ A ]( U )[ G ]( U )[U ]-( U )-[ C ']3';

[0175] siFAP-13:

[0176] 5'(A*)-[A*]-(C')[A*](U)[C'](U)[A*](C'A*G)[A*](A*)[U](U)[A*](G)[C'](A*)[U](U)3':

[0177] 5'[A*]-(A*)-[U](G)[C'](U)[A*](A*)[U](U)[C'UG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C']3';

[0178] siFAP-14:

[0179] 5′(A*)-[ A* ]-(C')[ A* ](HER)[ C '](HER)[ A* ](C'A*G)[ A* ](YOUR*)[ U ](HER)[ A* ](G)[ C '](YOUR*)[ U ](U)3';

[0180] 5'[ A* ]-(YOUR*)-[ U ](G)[ C '](HER)[ A* ](YOUR*)[ U ](HER)[ C ' UG ](HER)[ A* ](G)[ A* ](HER)[ G ](HER)[ U ]-(HER)-[ C ']3';

[0181] siFAP-15:

[0182] 5'( A* )-[YOUR*]-( C ')[YOUR*]( U )[C']( U )[YOUR*]( C ' A*G )[YOUR*]( A* )[HER]( U )[YOUR*](G )[C']( A* )[HER]( U )3'?

[0183] 5′[A*]-( A* )-[HER]( G )[C']( U )[YOUR*]( A* )[HER]( U )[C'UG]( U )[YOUR*]( G )[YOUR*]( U )[G]( U )[HER]-( U )-[C']3':

[0184] siFAP-16:

[0185] 5'( A* )-[ A* ]-( C ')[ A* ]( U )[ C ']( U )[ A* ]( C ' AG )[ A* ]( A* )[ U ]( U )[ A* ]( G )[ C ']( A* )[ U ]( U )3'?

[0186] 5'[ A* ]-( A* )-[ U ]( G )[ C ']( U )[ A* ]( A* )[ U ]( U )[ C ' UG ]( U )[ A* ]( G )[ A* ]( U )[ G ]( U )[ U ]-( U )-[C ']3'.

[0187] The 16 modified siFAPs were named siFAP-1 to siFAP-16. They were transfected into the 4T1 mouse breast cancer cell line during its logarithmic growth phase. After 36 hours, the cells were treated, RNA was collected, and FAP gene expression was verified using qRT-PCR. LNP-modified siFAPs were prepared according to the method described in Example 1. The FAP gene expression level in mouse tissues was verified using the modeling method and administration route described in Example 2.

[0188] Table 2. Relative expression levels of FAP gene in cells and tissues after addition of different types of the third siFAP.

[0189]

[0190]

[0191] The results are as follows Figure 2 As shown in Table 2, whether in the 4T1 cell line or the mouse model, transfection with the third type of siFAP-1 to the third type of siFAP-16 resulted in better FAP knockdown than the third type of siFAP, indicating that the modification enhanced the gene expression interference ability of the siRNA. After tail vein injection of the third type of siFAP-1 to the third type of siFAP-16 into fragment-humanized FGF21 mice, the third type of siFAP-16 showed the best effect, knocking down the FAP gene to 0.077. Therefore, the third type of siFAP-16 was selected for subsequent studies, and different indicators were observed after tail vein injection in mice to verify its efficacy.

[0192] Example 4: Changes in body weight and blood glucose levels in MASH mice after tail vein injection of the third type of siFAP-16

[0193] (I) Method for constructing humanized FGF21 gene-engineered mice:

[0194] The method described in Example 2 is used for construction.

[0195] (II) Construction of the MASH model mouse and experimental grouping:

[0196] Sixty 10-week-old C57BL / 6J mice (genetically engineered with humanized FGF21) and 60 wild-type mice of the same age were selected and divided into four groups: control group, model group, drug-treated group (LNP-siFAP synthesized from the third type of siFAP-16), and drug-treated empty vector group (LNP-siNC). Each group contained at least 15 mice. The control group was fed a normal diet, while the other groups were fed an MCD diet for 7 weeks. At 15 weeks of age, mice were administered the drug via tail vein injection at a dose of 2 mg / kg, once every 3 days for 2 weeks. Mouse body weight was measured weekly to observe changes in body weight. At 12, 15, and 17 weeks of age, after fasting for 16 hours, fasting blood glucose was measured in each group. Subsequently, each group of mice was injected intraperitoneally with 20% glucose solution, and blood glucose was measured and recorded at five time points: 15 min, 30 min, 60 min, 90 min, and 120 min. The data were then used for data analysis. Mice in each group were sacrificed at 12, 15, and 16 weeks of age for sampling at least 3 mice. All mice were sacrificed at 17 weeks of age for sampling. Blood and tissues were stored in a -80°C freezer for subsequent experiments.

[0197] (III) Test Results

[0198] Figure 3 A represents the weight changes of wild-type mice. From the start of modeling at 10 weeks of age to 17 weeks of age, the weight of the mice gradually decreased. Figure 3 B shows the weight changes of fragment-humanized FGF21 mice. From 10 weeks of age (the initial modeling process) to 15 weeks of age, mice were administered the drug via tail vein injection for two consecutive weeks until 17 weeks of age. The mice's weight gradually decreased, but the weight loss after tail vein injection was less than that in the modeling group. The weight changes of the mice are shown in Table 3. Figure 3 C represents the liver weight / body weight of mice in each group. As the modeling time increases, the liver weight / body weight of the modeling group continuously increases. Figure 3 D represents the liver weight / body weight of the mice after drug administration. It was found that after intravenous injection of the drug into mice with the humanized FGF21 gene fragment, the liver weight / body weight decreased significantly. The liver weight of the mice is shown in Table 4. Figure 4 A, 4B, and 4C are line graphs and area under the curve (AUC) histograms of glucose tolerance tests in mice at 12, 15, and 17 weeks of age, respectively. It can be seen that the glucose metabolism of mice was slightly improved after administration.

[0199] In summary, the third siFAP-16 significantly knocked down the FAP gene in mouse liver, increased the expression of endogenous FGF21, slightly improved weight loss, significantly improved liver weight / body weight, and slightly improved glucose metabolism in mice after administration.

[0200] Table 3. Changes in body weight of mice in different groups at different ages.

[0201]

[0202] Table 4. Liver weight to body weight ratio of 17-week-old mice in different groups

[0203]

[0204]

[0205] Example 4: Effects of the third type of siFAP-16 on liver injury, fat accumulation, and fibrosis in MASH model mice.

[0206] Sixty 10-week-old C57BL / 6J mice and 60 wild-type mice of the same age, genetically engineered with the humanized FGF21 gene, were used. Each group was divided into four subgroups: control group, model group, drug-treated group, and empty vector group, with at least 15 mice in each group. The control group was fed a normal diet, while the other groups were fed an MCD diet for 7 weeks. At 15 weeks of age, mice were administered siFAP-16 via tail vein injection at a dose of 2 mg / kg, once every 3 days for two weeks. At 12, 15, 16, and 17 weeks of age, at least three mice from each group were sacrificed for tissue collection. At 17 weeks of age, all mice were sacrificed for tissue collection. Blood and tissue samples were stored at -80°C for subsequent experiments. Serum AST and ALT levels were measured using a Nanjing Jiancheng reagent kit. Blood was collected from the mouse eyeballs, allowed to stand at room temperature for 60 min, centrifuged at 5000 rpm for 30 min at 10°C, and the supernatant was used as a sample for analysis. The levels of TG and TC in mouse liver were detected using a Nanjing Jiancheng reagent kit. Mouse liver was mixed with physiological saline in a specific ratio and added to EP tubes. The liver was then homogenized using a tissue homogenizer and centrifuged at 2500 rpm for 10 min. The supernatant was collected as a sample for analysis. Mouse liver was also fixed with 4% paraformaldehyde overnight, embedded, sectioned, and stained to observe the effects of the drug on fat accumulation and fibrosis.

[0207] The results are as follows Figures 5-7 As shown. Figure 5 A and 5C show the changes in serum AST and ALT in wild-type mice from 10 weeks of age to 17 weeks of age. As the modeling time increases, serum AST and ALT levels continuously increase, indicating significant liver damage. Figure 5 B and 5D are fragments of humanized FGF21 mice. As the modeling time increases, the serum AST and ALT levels of these mice continuously increase, and the increase is more significant than that of wild-type mice. Figure 5 As can be seen from E and 5F, after administration, the serum AST and ALT levels of fragment-humanized FGF21 mice decreased significantly, indicating significant efficacy and the ability to repair liver damage.

[0208] Figure 6 A and 6C show the changes in liver TG and TC in wild-type mice from 10 weeks of age to 17 weeks of age. With the increase of modeling time, TG in the liver increased significantly. Figure 6 B and 6D are fragments of humanized FGF21 mice. As the modeling time increased, the liver TG level in these mice increased significantly. Figure 6 As can be seen from E and 6F, the liver TG and TC levels of fragment-humanized FGF21 mice decreased after drug administration.

[0209] Figure 7 A shows HE staining of fragment-humanized FGF21 mice and wild-type mice at different modeling and drug administration times; 7B shows Oil Red O staining; 7C shows Sirius Red staining; and 7D shows Masson staining. As shown in the figures, from 10 weeks of age to 15 weeks of age, followed by continuous drug administration for 2 weeks to 17 weeks of age, with increasing modeling time, fragment-humanized FGF21 mice showed more severe liver lipid accumulation and fibrosis than wild-type mice, and the therapeutic effect after drug administration was more pronounced in fragment-humanized FGF21 mice than in wild-type mice.

[0210] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A siRNA molecule that inhibits FAP gene expression, characterized in that, A double-stranded siRNA molecule composed of complementary RNA single strands shown in SEQ ID NO.1 and SEQ ID NO.2; each nucleotide in the siRNA is independently modified or unmodified.

2. The siRNA molecule according to claim 1, characterized in that, At least one nucleotide in the double-stranded siRNA molecule is a modified nucleotide.

3. The siRNA molecule according to claim 1 or 2, characterized in that, The modification is selected from phosphorothioate, 2'-F, 2'-OMe, 2'-Ara-F, 2'-O-MOE, m 6 A or m 5 At least one of C.

4. The siRNA molecule according to any one of claims 1 to 3, characterized in that, The double-stranded siRNA molecules are shown in any one of the groups siFAP-1 to siFAP-16: siFAP-1: 5' (A)-[A]-(C)[A](U)[C](U)[A](CAG)[A](A)[U](U)[A](G)[C](A)[U](U) 3'; 5' [A]-(A)-[U](G)[C](U)[A](A)[U](U)[CUG](U)[A](G)[A](U)[G](U)[U]-(U)-[C]3'; siFAP-2: 5' (A)-[ A ]-(C)[ A ](U)[ C ](U)[ A ](CAG)[ A ](A)[ U ](U)[ A ](G)[ C ](A)[ U ](U) 3'; 5' [ A ]-(AND)-[ U ](MR)[ C ](IN)[ A ](AND)[ U ](IN)[ CUG ](IN)[ A ](MR)[ A ](IN)[ G ](IN)[ U ]-(IN)-[ C ]3'; siFAP-3: 5' ( A )-[A]-( C )[A]( U )[C]( U )[A]( CAG )[A]( A )[U]( U )[A]( G )[C]( A )[U]( U ) 3'; 5' [A]-( A )-[U]( G )[C]( U )[A]( A )[U]( U )[CUG]( U )[A]( G )[A]( U )[G]( U )[U]-( U )-[C]3'; siFAP-4: 5' ( A )-[ A ]-( C )[ A ]( U )[ C ]( U )[ A ]( CAG )[ A ]( A )[ U ]( U )[ A ]( G )[ C ]( A )[ U ]( U ) 3'; 5' [ A ]-( A )-[ U ]( G )[ C ]( U )[ A ]( A )[ U ]( U )[ CUG ]( U )[ A ]( G )[ A ]( U )[ G ]( U )[ U ]-( U )-[ C ]3'; siFAP-5: 5' (A*)-[A*]-(C)[A*](U)[C](U)[A*](CA*G)[A*](A*)[U](U)[A*](G)[C](A*)[U](U)3'; 5' [A*]-(A*)-[U](G)[C](U)[A*](A*)[U](U)[CUG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C] 3'; siFAP-6: 5' (A)-[A]-(C')[A](U)[C'](U)[A](C'AG)[A](A)[U](U)[A](G)[C'](A)[U](U) 3'; 5' [A]-(A)-[U](G)[C'](U)[A](A)[U](U)[C'UG](U)[A](G)[A](U)[G](U)[U]-(U)-[C'] 3'; siFAP-7: 5' (A*)-[ A* ]-(C)[ A* ](U)[ C ](U)[ A* ](CA*G)[ A* ](A*)[ U ](U)[ A* ](G)[ C ](A*)[ U ](U)3'; 5' [ A* ]-(AND*)-[ U ](MR)[ C ](IN)[ A* ](AND*)[ U ](IN)[ CUG ](IN)[ A* ](MR)[ A* ](IN)[ G ](IN)[ U ]-(IN)-[ C ] 3'; siFAP-8: 5' ( A* )-[A*]-( C )[A*]( U )[C]( U )[A*]( CA*G )[A*]( A* )[U]( U )[A*]( G )[C]( A* )[U]( U )3'; 5' [A*]-( A* )-[U]( G )[C]( U )[A*]( A* )[U]( U )[CUG]( U )[A*]( G )[A*l]( U )[G]( U )[U]-( U )-[C] 3'; siFAP-9: 5' ( A* )-[ A* ]-( C )[ A* ]( U )[ C ]( U )[ A* ]( CA*G )[ A* ]( A* )[ U ]( U )[ A* ]( G )[ C ]( A* )[ U ]( U )3'; 5' [ A* ]-( A* )-[ U ]( G )[ C ]( U )[ A* ]( A* )[ U ]( U )[ CUG ]( U )[ A* ]( G )[ A* ]( U )[ G ]( U )[ U ]-( U )-[ C ] 3'; siFAP-10: 5' (A)-[ A ]-(C')[ A ](U)[ C '](U)[ A ](C'AG)[ A ](A)[ U ](U)[ A ](G)[ C '](A)[ U ](U) 3'; 5' [ A ]-(AND)-[ U ](MR)[ C '](IN)[ A ](AND)[ U ](IN)[ C ' UG ](IN)[ A ](MR)[ A ](IN)[ G ](IN)[ U ]-(IN)-[ C '] 3'; siFAP-11: 5' ( A )-[A]-( C ')[A]( U )[C']( U )[A]( C ' AG )[A]( A )[U]( U )[A]( G )[C']( A )[U]( U ) 3'; 5' [A]-( A )-[AT]( G )[C']( U )[AND]( A )[AT]( U )[C'UG]( U )[AND]( G )[AND]( U )[G]( U )[AT]-( U )-[C'] 3'; siFAP-12: 5' ( A )-[ A ]-( C ')[ A ]( U )[ C ']( U )[ A ]( C ' AG )[ A ]( A )[ U ]( U )[ A ]( G )[ C ']( A )[ U ]( U ) 3'; 5' [ A ]-( A )-[ U ]( G )[ C ']( U )[ A ]( A )[ U ]( U )[ C ' UG ]( U )[ A ]( G )[ A ]( U )[ G ]( U )[ U ]-( U )-[ C '] 3'; siFAP-13: 5' (A*)-[A*]-(C')[A*](U)[C'](U)[A*](C'A*G)[A*](A*)[U](U)[A*](G)[C'](A*)[U](U) 3'; 5' [A*]-(A*)-[U](G)[C'](U)[A*](A*)[U](U)[C'UG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C'] 3'; siFAP-14: 5' (A*)-[ A* ]-(C')[ A* ](U)[ C '](U)[ A* ](C'A*G)[ A* ](A*)[ U ](U)[ A* ](G)[ C '](A*)[ U ](U) 3'; 5' [ A* ]-(AND*)-[ U ](MR)[ C '](IN)[ A* ](AND*)[ U ](IN)[ C ' UG ](IN)[ A* ](MR)[ A* ](IN)[ G ](IN)[ U ]-(IN)-[ C '] 3'; siFAP-15: 5' ( A* )-[A*]-( C ')[A*]( U )[C']( U )[A*]( C ' A*G )[A*]( A* )[U]( U )[A*]( G )[C']( A* )[U]( U ) 3'; 5' [A*]-( A* )-[AT]( G )[C']( U )[AND*]( A* )[AT]( U )[C'UG]( U )[AND*]( G )[AND*]( U )[G]( U )[AT]-( U )-[C'] 3'; siFAP-16: 5' ( A* )-[ A* ]-( C ')[ A* ]( U )[ C ']( U )[ A* ]( C ' AG )[ A* ]( A* )[ U ]( U )[ A* ]( G )[ C ']( A* )[ U ]( U ) 3'; 5' [ A* ]-( A* )-[ U ]( G )[ C ']( U )[ A* ]( A* )[ U ]( U )[ C ' UG ]( U )[ A* ]( G )[ A* ]( U )[ G ]( U )[ U ]-( U )-[ C '] 3'; Wherein, A-, U-, C-, and G- represent phosphorothioate-modified ribonucleotides A, U, C, and G, respectively; (A), (U), (C) and (G) represent ribonucleotides A, U, C and G modified by 2'-F, respectively; [A], [U], [C], and [G] represent ribonucleotides A, U, C, and G modified with 2'-OMe, respectively; (A) , (U) , (C) and (G) These represent ribonucleotides A, U, C, and G modified with 2'-Ara-F, respectively. [A] , [U] , [C] and [G] These represent ribonucleotides A, U, C, and G modified with 2'-O-MOE, respectively. A*, U*, C*, and G* represent the distances from m... 6 A-modified ribonucleotides A, U, C, and G; A', U', C', and G' represent the distances from m... 5 C-modified ribonucleotides A, U, C, and G.

5. An expression vector carrying the siRNA according to any one of claims 1 to 4.

6. A host cell containing the siRNA of any one of claims 1 to 4 or transformed with the expression vector of claim 5.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition contains the siRNA according to any one of claims 1 to 4, or the expression vector according to claim 5, or the host cell according to claim 6.

8. The composition according to claim 7, characterized in that, The pharmaceutical composition contains a pharmaceutically acceptable carrier or excipient; the pharmaceutically acceptable carrier includes liposomes, microcells, metal particles or polymer particles.

9. The use of the siRNA according to any one of claims 1 to 4, or the expression vector according to claim 5, or the host cell according to claim 6 in the preparation of a medicament for the prevention, relief and / or treatment of non-alcoholic steatohepatitis.

10. The application according to claim 9, characterized in that, The application includes at least one of the following functions: (1) Reduce the individual's liver weight / body weight ratio; (2) Improves an individual's glucose metabolism capacity; (3) Repairing individual liver damage; (4) Reduces individual liver TG and TC levels; (5) Alleviate the degree of liver fibrosis in individuals.