Compositions and methods for modulating MAPT

Abstract

The present disclosure relates to small interfering RNA (siRNA) molecules targeting MAPT for use in the treatment of tauopathies and adeno-associated virus (AAV) particles encoding the molecules.

Description

[0001] Related applications

[0002] This application claims priority to U.S. Provisional Application No. 63 / 477,736, filed on December 29, 2022; the entire contents of which are hereby incorporated by reference in their entirety.

[0003] Sequence Listing

[0004] This application is filed with a sequence listing in electronic format. The sequence listing file, named V2071-3010PCT_SL.xml, was created on December 13, 2023 and is 2,478,152 bytes in size. The electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0005] The present disclosure generally relates to compositions and methods for the vectored delivery of agents, such as RNA agents, that inhibit mutant, variant, or wild-type human microtubule-associated protein tau (MAPT) genes, mRNAs, and / or proteins. Background Art

[0006] Tauopathies, also referred to as tau associated diseases in this article, are a group of heterogeneous neurodegenerative diseases characterized by the dysfunction and / or aggregation of microtubule associated protein tau (MAPT) (also referred to as Tau in this article), which is encoded by the MAPT gene. Tau is generally a known soluble protein associated with microtubules based on its phosphorylation degree. In taupathies, tau becomes highly phosphorylated, misfolded and aggregates into neurofibrillary tangles (NFTs) of paired helical filaments (PHFs), torsion bands or straight filaments. These NFTs are considered to indicate impending neuronal cell degeneration to a great extent, and this may cause extensive neuronal cell loss, thereby causing various behaviors and cognitive defects, and may also be fatal. At present, the available treatment options for taupathies are very limited, usually only alleviating symptoms and supportive therapy. Thus, medically, there is a need for improved compositions and methods for preventing, treating and diagnosing the disease (comprising taupathies and related neurodegenerative disorders) relevant to abnormal tau expression. Summary of the Invention

[0007] The present disclosure provides encoding for the agent (such as RNA agent) of targeting MAPT to regulate, for example, suppress AAV particles and the use method thereof of MAPT gene expression and / or MAPT protein production.In some embodiments, for targeting MAPT, for example, the agent of MAPT gene, mRNA or protein (such as tau protein) is the RNA agent for targeting MAPT, for example, the siRNA duplex for targeting MAPT.In some embodiments, the agent for targeting MAPT comprises the regulatory polynucleotide encoding for the siRNA duplex for targeting MAPT.Method is used for treating the disease related to MAPT expression (such as, abnormal expression) of experimenter in need, such as tau disease, including but not limited to Alzheimer's disease (Alzheimer's disease, AD), frontotemporal dementia (FTD) and / or Dravet syndrome (DS).

[0008] Therefore, in one aspect, the present disclosure provides short interfering ribonucleic acids (siRNA) for inhibiting the expression of microtubule-associated protein tau (MAPT), wherein the short interfering ribonucleic acid (siRNA) comprises a sense strand sequence and an antisense strand sequence, wherein the antisense sequence is complementary to at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides comprising 0, 1, 2 or 3 mismatches of a MAPT sequence comprising a nucleotide sequence comprising SEQ ID NO: 5024 or a nucleotide sequence provided in Table 3 or Table 19. In some embodiments, the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 consecutive nucleotides that differ from any one of the antisense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B by 3, 2, 1, or 0 nucleotides; and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 consecutive nucleotides that differ from any one of the sense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B by 3, 2, 1, or 0 nucleotides, wherein the sense strand sequence and the antisense strand sequence comprise a region of complementarity of at least 15 nucleotides. In some embodiments, the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 consecutive nucleotides from any one of the antisense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B; and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 consecutive nucleotides from any one of the sense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B, wherein the sense strand sequence and the antisense strand sequence comprise a complementary region of at least 15 nucleotides. In some embodiments, the antisense strand sequence comprises the nucleotide sequence of any one of the antisense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B; and the sense strand sequence comprises the nucleotide sequence of any one of the sense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B, wherein the sense strand sequence and the antisense strand sequence comprise a complementary region of at least 15 nucleotides.

[0009] In yet another aspect, the present disclosure provides a short interfering ribonucleic acid (siRNA) for inhibiting the expression of microtubule-associated protein tau (MAPT), the short interfering ribonucleic acid (siRNA) comprising a sense strand sequence and an antisense strand sequence, wherein: (i) the antisense strand sequence comprises at least 20 or 21 consecutive nucleotides of any one of SEQ ID NO: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104 or 5128; and the sense strand sequence comprises SEQ ID NO: NO:4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 5014, 4910, 4930 , 4950, 4970, 4990, 5010, 5077, 5084, 5088, 5092, 5096, 5098, 5101, 5108, 5112, 5116, 5120, 5122, 5125, 5132, 5136, 5140, 5144 or 5146; wherein the sense strand sequence and the antisense strand sequence comprise a complementary region of at least 15 nucleotides.

[0010] In yet another aspect, the present disclosure provides an adeno-associated virus (AAV) viral genome comprising a nucleotide sequence located between two inverted terminal repeats (ITRs), wherein the nucleotide sequence encodes an siRNA for inhibiting MAPT, wherein the siRNA comprises a sense strand sequence and an antisense strand sequence, wherein: (i) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104, or 5128; and (ii) the sense strand sequence comprises SEQ ID NOs: NO:4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5 002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 5014, 4910, 4930, 4 at least 19, 20 or 21 consecutive nucleotides of any one of 5120, 5122, 5125, 5132, 5136, 5140, 5144 or 5146; wherein the sense strand sequence and the antisense strand sequence comprise a complementary region of at least 15 nucleotides.

[0011] In another aspect, the present disclosure provides regulatory polynucleotides encoding siRNAs for targeting MAPT as described herein. In some embodiments, the regulatory polynucleotide further comprises a 5' flanking region, a loop region, and / or a 3' flanking region.

[0012] In another aspect, the present disclosure provides an AAV particle comprising a promoter operably linked to a nucleic acid encoding a regulatory polynucleotide comprising an siRNA for targeting MAPT as described herein.

[0013] On the other hand, present disclosure provides the method for preparing AAV particles comprising AAV capsid protein (e.g., AAV capsid variants), wherein the AAV particle encoding is used to target the siRNA of MAPT described herein. In some embodiments, the method includes providing a host cell comprising the viral genome encoding the siRNA described herein and incubating the host cell under conditions suitable for the viral genome being encapsulated in the AAV capsid protein, e.g., the AAV capsid variants, thereby preparing AAV particles.

[0014] In yet another aspect, the present disclosure provides methods for delivering siRNA for inhibiting MAPT to cells. In some embodiments, the method comprises administering an effective amount of siRNA or AAV particles encoding the siRNA described herein.

[0015] In yet another aspect, the present disclosure provides a method for treating a subject having or diagnosed with a genetic disorder (e.g., a monogenic disorder or a polygenic disorder). The method comprises administering an effective amount of siRNA or an AAV particle encoding the siRNA described herein.

[0016] In yet another aspect, the present disclosure provides a method of treating a subject having or diagnosed as having a neurological disorder (e.g., a neurodegenerative disorder). The method comprises administering an effective amount of siRNA or AAV particles encoding the siRNA described herein.

[0017] In yet another aspect, the present disclosure provides a method for treating a subject having or diagnosed with a disorder associated with tau expression (e.g., abnormal tau expression). The method comprises administering an effective amount of siRNA or AAV particles encoding the siRNA described herein.

[0018] In yet another aspect, the present disclosure provides a method for treating a subject having or diagnosed with a tauopathy, wherein the method comprises administering an effective amount of siRNA or an AAV particle encoding the siRNA described herein.

[0019] In some embodiments, the genetic disorder, neurological disorder (e.g., neurodegenerative disorder), disorder associated with tau expression (e.g., abnormal tau expression), and / or tauopathy is Alzheimer's disease, frontotemporal dementia (FTD), frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17), frontotemporal lobar degeneration (FTLD), Dravet syndrome, a neurodegenerative disease, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), progressive supranuclear palsy (PSP), Down's syndrome, Pick's disease, corticobasal degeneration (CBD), corticobasal syndrome, amyotrophic lateral sclerosis (ALS), a prion disease, CJD, multiple system atrophy, mild cognitive impairment, tangle-only dementia, or progressive subcortical gliosis.

[0020] The implementation plans listed

[0021] 1. a short interfering ribonucleic acid (siRNA) for suppressing the expression of microtubule associated protein tau (MAPT), described short interfering ribonucleic acid (siRNA) comprises sense strand sequence and antisense strand sequence, wherein said antisense sequence is complementary to at least 15,16,17,18,19,20 or 21 continuous nucleotides of 0,1,2 or 3 mispairings of the MAPT sequence that comprises the nucleotide sequence that comprises SEQ ID NO:5024 or the nucleotide sequence provided in Table 3 or Table 19.

[0022] 2. The siRNA of embodiment 1, wherein the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides with 0, 1, 2, or 3 mismatches to an exon of the MAPT sequence, wherein the exon comprises nucleotides 1277 to 1332 of SEQ ID NO: 5024, nucleotides 1712-1977 of SEQ ID NO: 5024, or nucleotides 2266-6644 of SEQ ID NO: 5024.

[0023] 3. The siRNA of embodiment 1 or 2, wherein the antisense strand is complementary to at least 15, 16, 17, or 18 consecutive nucleotides that have 0, 1, 2, or 3 mismatches with nucleotides 1300-1317, 1305-1322, 1860-1877, 2279-2297, 2286-2303, 2402-2419, 2581-2958, 2584-2601, 2633-2650, or 2634-2653 of SEQ ID NO: 5024.

[0024] 4. The siRNA of any one of embodiments 1 to 3, wherein the sense strand comprises:

[0025] (i) at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides comprising 0, 1, 2 or 3 mismatches with a MAPT sequence comprising the nucleotide sequence of SEQ ID NO: 5024 or the nucleotide sequence provided in Table 3 or Table 19;

[0026] (ii) at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that have 0, 1, 2, or 3 mismatches with an exon of the MAPT sequence, wherein the exon comprises nucleotides 1277 to 1332 of SEQ ID NO: 5024, nucleotides 1712 to 1977 of SEQ ID NO: 5024, or nucleotides 2266 to 6644 of SEQ ID NO: 5024; or

[0027] (iii) at least 15, 16, 17, or 18 consecutive nucleotides that have 0, 1, 2, or 3 mismatches with nucleotides 1300-1317, 1305-1322, 1860-1877, 2279-2297, 2286-2303, 2402-2419, 2581-2958, 2584-2601, 2633-2650, or 2634-2653 of SEQ ID NO:5024.

[0028] 5. The siRNA of any one of embodiments 1 to 4, wherein the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 consecutive nucleotides that differ by 3, 2, 1, or 0 nucleotides from any of the antisense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B.

[0029] 6. The siRNA of any one of embodiments 1 to 5, wherein the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 contiguous nucleotides that differ by 3, 2, 1, or 0 nucleotides from any of the sense strand sequences provided in Table 4, Table 5, Table 9A, or Table 9B.

[0030] 7. The siRNA of any one of embodiments 1 to 6, wherein the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 consecutive nucleotides that differ from any one of the antisense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B by 3, 2, 1, or 0 nucleotides; and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, 21 consecutive nucleotides that differ from any one of the sense strand sequences provided in Table 3, Table 4, Table 5, Table 9A, or Table 9B by 3, 2, 1, or 0 nucleotides, wherein the sense strand sequence and the antisense strand sequence comprise a complementary region of at least 15 nucleotides.

[0031] 8. The siRNA of embodiment 7, wherein the complementary region is 15-30, 19-21, or 25-30 nucleotides in length, such as 17, 18, 20, 21, 22, 25, or 30 nucleotides in length.

[0032] 9. The siRNA of any one of embodiments 1 to 8, wherein:

[0033] (i) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4700 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4502-4505 by 3, 2, 1, or 0 nucleotides;

[0034] (ii) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4920 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998 by 3, 2, 1, or 0 nucleotides;

[0035] (iii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4697 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4495-4499 by 3, 2, 1, or 0 nucleotides;

[0036] (iv) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4908 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006 by 3, 2, 1, or 0 nucleotides;

[0037] (v) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4690 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4480-4484 by 3, 2, 1, or 0 nucleotides;

[0038] (vi) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4924 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022 by 3, 2, 1, or 0 nucleotides;

[0039] (vii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4694 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4492 by 3, 2, 1, or 0 nucleotides; (viii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4691 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4485-4489 by 3, 2, 1, or 0 nucleotides;

[0040] (ix) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4916 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014 by 3, 2, 1, or 0 nucleotides;

[0041] (x) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4701 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4506-4510 by 3, 2, 1, or 0 nucleotides;

[0042] (xi) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4912 by 3, 2, 1, or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides that differ from the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010 by 3, 2, 1, or 0 nucleotides;

[0043] (xii) the antisense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4687 by 3, 2, 1 or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4477 by 3, 2, 1 or 0 nucleotides; (xiii) the antisense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4712 by 3, 2, 1 or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4521 by 3, 2, 1 or 0 nucleotides; (xiv) the antisense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: ID NO: 4696 differs from the nucleotide sequence of SEQ ID NO: 4696 by at least 15, 16, 17, 18 or 19 consecutive nucleotides by 3, 2, 1 or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4494 by 3, 2, 1 or 0 nucleotides; or

[0044] (xv) the antisense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4718 by 3, 2, 1 or 0 nucleotides, and the sense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 4527 by 3, 2, 1 or 0 nucleotides.

[0045] 10. The siRNA according to any one of claims 1 to 9, wherein:

[0046] (i) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4700, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4502-4505;

[0047] (ii) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998;

[0048] (iii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4697, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4495-4499;

[0049] (iv) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, or 5006;

[0050] (v) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4690, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4480-4484;

[0051] (vi) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022;

[0052] (vii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4694, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4492;

[0053] (viii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4691, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4485-4489;

[0054] (ix) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014;

[0055] (x) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4701, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4506-4510;

[0056] (xi) the antisense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010;

[0057] (xii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4687, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4477;

[0058] (xiii) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4712, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4521;

[0059] (xiv) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4696, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4494; or

[0060] (xv) the antisense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO:4718, and the sense strand sequence comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO:4527.

[0061] 11. A short interfering ribonucleic acid (siRNA) for inhibiting the expression of microtubule-associated protein tau (MAPT), the short interfering ribonucleic acid (siRNA) comprising a sense strand sequence and an antisense strand sequence, wherein:

[0062] (i) the antisense strand sequence comprises at least 20 or 21 consecutive nucleotides of any one of SEQ ID NO: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104 or 5128; and

[0063] (ii) the sense strand sequence comprises SEQ ID NO: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, at least 20 or 21 consecutive nucleotides of any one of 5014, 4910, 4930, 4950, 4970, 4990, 5010, 5077, 5084, 5088, 5092, 5096, 5098, 5101, 5108, 5112, 5116, 5120, 5122, 5125, 5132, 5136, 5140, 5144, or 5146;

[0064] The sense strand sequence and the antisense strand sequence comprise a complementary region of at least 15 nucleotides.

[0065] 12. An adeno-associated virus (AAV) viral genome comprising a nucleotide sequence located between two inverted terminal repeats (ITRs), wherein the nucleotide sequence encodes an siRNA for inhibiting MAPT, wherein the siRNA comprises a sense strand sequence and an antisense strand sequence, wherein:

[0066] (i) the antisense strand sequence comprises at least 19, 20 or 21 consecutive nucleotides of any one of SEQ ID NO: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104 or 5128; and

[0067] (ii) the sense strand sequence comprises SEQ ID NO: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 50 at least 19, 20, or 21 consecutive nucleotides of any one of 5140, 5144, or 5146;

[0068] The sense strand sequence and the antisense strand sequence comprise a complementary region of at least 15 nucleotides.

[0069] 13. The siRNA of any one of embodiments 8 to 11 or the AAV viral genome of embodiment 12, wherein the complementary region comprises at least 18, 19, or 20 nucleotides.

[0070] 14. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of embodiment 12 or 13, wherein the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912.

[0071] 15. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 14, wherein the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010.

[0072] 16. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 15, wherein:

[0073] (i) the antisense strand sequence comprises at least 19, 20 or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 19, 20 or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4906, 4926, 4946, 4966, 4986 or 5006;

[0074] (ii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4918, 4938, 4958, 4978, or 4998;

[0075] (iii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4922, 4942, 4962, 4982, 5002, or 5022;

[0076] (iv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4910, 4930, 4950, 4970, 4990, or 5010;

[0077] (v) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4914, 4934, 4954, 4974, 4994, or 5014;

[0078] (vi) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 5101, 5108, 5112, 5116, 5120, or 5122;

[0079] (vii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5125, 5132, 5136, 5140, 5144, or 5146;

[0080] (viii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5077, 5084, 5088, 5092, 5096, or 5098; or

[0081] (ix) the antisense strand sequence comprises at least 19, 20 or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057, and the sense strand sequence comprises at least 19, 20 or 21 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5054, 5060, 5064, 5066, 5070 or 5074.

[0082] 17. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4906.

[0083] 18. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4918.

[0084] 19. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4922.

[0085] 20. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4966.

[0086] 21. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4970.

[0087] 22. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4978.

[0088] 23. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4982.

[0089] 24. The siRNA of any one of embodiments 1 to 10 or the AAV viral genome of any one of embodiments 12 to 16, wherein:

[0090] (i) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4910;

[0091] (ii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4914;

[0092] (iii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5054;

[0093] (iv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4926;

[0094] (v) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4930;

[0095] (vi) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4934;

[0096] (vii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4938;

[0097] (viii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4942;

[0098] (ix) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5060;

[0099] (x) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4946;

[0100] (xi) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4950;

[0101] (xii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4954;

[0102] (xiii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4958;

[0103] (xiv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4962;

[0104] (xv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5064;

[0105] (xvi) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4974;

[0106] (xvii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5066;

[0107] (xviii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4986;

[0108] (xix) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4990;

[0109] (xx) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4994;

[0110] (xxi) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4998;

[0111] (xxii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5002;

[0112] (xxiii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5070;

[0113] (xxiv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5006;

[0114] (xxv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5010;

[0115] (xxvi) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5014;

[0116] (xxvii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4958;

[0117] (xxviii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5022;

[0118] (xxvii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5074;

[0119] (xxix) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5077;

[0120] (xxx) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5084;

[0121] (xxxi) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5088;

[0122] (xxxii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5092;

[0123] (xxxiii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5096;

[0124] (xxxiv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5098;

[0125] (xxxv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5101;

[0126] (xxxvi) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5108;

[0127] (xxxvii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5112;

[0128] (xxxviii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5116;

[0129] (xxxix) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5120;

[0130] (xl) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5122;

[0131] (xli) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5125;

[0132] (xlii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5132;

[0133] (xliii) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5136;

[0134] (xliv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5140;

[0135] (xlv) the antisense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 19, 20, or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5144; or

[0136] (xlvi) the antisense strand sequence comprises at least 19, 20 or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO:5128; and the sense strand sequence comprises at least 19, 20 or 21 consecutive nucleotides from the nucleotide sequence of SEQ ID NO:5146.

[0137] 25. The siRNA of any one of embodiments 1 to 11 or 13 or the AAV viral genome of any one of embodiments 12 to 24, wherein the antisense strand sequence comprises at least 20 consecutive nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912.

[0138] 26. The siRNA of any one of embodiments 1 to 11, 13, or 25, or the AAV viral genome of any one of embodiments 12 to 25, wherein the sense strand sequence comprises at least 20 consecutive nucleotides of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010.

[0139] 27. The siRNA of any one of embodiments 1 to 11, 13, 25, or 26, or the AAV viral genome of any one of embodiments 12 to 26, wherein:

[0140] (i) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4906, 4926, 4946, 4966, 4986, or 5006;

[0141] (ii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4918, 4938, 4958, 4978, or 4998;

[0142] (iii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4922, 4942, 4962, 4982, 5002, or 5022;

[0143] (iv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4910, 4930, 4950, 4970, 4990, or 5010;

[0144] (v) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4914, 4934, 4954, 4974, 4994, or 5014;

[0145] (vi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5101, 5108, 5112, 5116, 5120, or 5122;

[0146] (vii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5125, 5132, 5136, 5140, 5144, or 5146;

[0147] (viii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5077, 5084, 5088, 5092, 5096 or 5098; or

[0148] (ix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5054, 5060, 5064, 5066, 5070 or 5074.

[0149] 28. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 17 or 25 to 27, wherein the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4906.

[0150] 29. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 18, or 25 to 27, wherein the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4918.

[0151] 30. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 19, or 25 to 27, wherein the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4922.

[0152] 31. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 20, or 25 to 27, wherein the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4966.

[0153] 32. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 21, or 25 to 27, wherein the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4970.

[0154] 33. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 22, or 25 to 27, wherein the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4978.

[0155] 34. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16, 23, or 25 to 27, wherein the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4982.

[0156] 35. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 27, or the AAV viral genome of any one of embodiments 11 to 16 or 24 to 27, wherein:

[0157] (i) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4910;

[0158] (ii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4914;

[0159] (iii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5054;

[0160] (iv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4926;

[0161] (v) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4930;

[0162] (vi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4934;

[0163] (vii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4938;

[0164] (viii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4942;

[0165] (ix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5060;

[0166] (x) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4946;

[0167] (xi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4950;

[0168] (xii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4954;

[0169] (xiii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4958;

[0170] (xiv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4962;

[0171] (xv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5064;

[0172] (xvi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4974;

[0173] (xvii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5066;

[0174] (xviii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4986;

[0175] (xix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4990;

[0176] (xx) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4994;

[0177] (xxi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4998;

[0178] (xxii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5002;

[0179] (xxiii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5070;

[0180] (xxiv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5006;

[0181] (xxv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5010;

[0182] (xxvi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5014;

[0183] (xxvii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4958;

[0184] (xxviii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5022;

[0185] (xxvii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5074;

[0186] (xxix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5077;

[0187] (xxx) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5084;

[0188] (xxxi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5088;

[0189] (xxxii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5092;

[0190] (xxxiii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5096;

[0191] (xxxiv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5098;

[0192] (xxxv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5101;

[0193] (xxxvi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5108;

[0194] (xxxvii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5112;

[0195] (xxxviii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5116;

[0196] (xxxix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5120;

[0197] (xl) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5122;

[0198] (xli) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5125;

[0199] (xlii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5132;

[0200] (xliii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5136;

[0201] (xliv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5140;

[0202] (xlv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5144; or

[0203] (xlvi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5146.

[0204] 36. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 35, or the AAV viral genome of any one of embodiments 12 to 35, wherein the antisense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912.

[0205] 37. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 36, or the AAV viral genome of any one of embodiments 12 to 36, wherein the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010.

[0206] 38. The siRNA of any one of embodiments 1 to 11, 13, or 25 to 37, or the AAV viral genome of any one of embodiments 12 to 37, wherein:

[0207] (i) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4906, 4926, 4946, 4966, 4986 or 5006;

[0208] (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4918, 4938, 4958, 4978, or 4998;

[0209] (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4922, 4942, 4962, 4982, 5002, or 5022;

[0210] (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4910, 4930, 4950, 4970, 4990, or 5010;

[0211] (v) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4914, 4934, 4954, 4974, 4994, or 5014;

[0212] (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 5101, 5108, 5112, 5116, 5120, or 5122;

[0213] (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 5125, 5132, 5136, 5140, 5144, or 5146;

[0214] (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 5077, 5084, 5088, 5092, 5096 or 5098; or

[0215] (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 5054, 5060, 5064, 5066, 5070 or 5074.

[0216] 39. The siRNA of any one of embodiments 1 to 11, 13, 25 to 28, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 17, 25 to 28, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4906.

[0217] 40. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 29, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 18, 25 to 27, 29, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4918.

[0218] 41. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 30, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 30, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4922.

[0219] 42. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 31, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 31, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4966.

[0220] 43. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 32, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 62, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4970.

[0221] 44. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 33, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 33, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4978.

[0222] 45. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 34, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 34, or 36 to 39, wherein the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4982.

[0223] 46. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 35, or 36 to 39, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 35, or 36 to 39, wherein:

[0224] (i) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4910;

[0225] (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4914;

[0226] (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5054;

[0227] (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4926;

[0228] (v) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4930;

[0229] (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4934;

[0230] (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4938;

[0231] (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4942;

[0232] (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5060;

[0233] (x) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4946;

[0234] (xi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4950;

[0235] (xii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4954;

[0236] (xiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4958;

[0237] (xiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4962;

[0238] (xv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5064;

[0239] (xvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4974;

[0240] (xvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5066;

[0241] (xviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4986;

[0242] (xix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4990;

[0243] (xx) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4994;

[0244] (xxi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4998;

[0245] (xxii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5002;

[0246] (xxiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5070;

[0247] (xxiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5006;

[0248] (xxv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5010;

[0249] (xxvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5014;

[0250] (xxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4958;

[0251] (xxviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5022;

[0252] (xxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5074;

[0253] (xxix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5077;

[0254] (xxx) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5084;

[0255] (xxxi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5088;

[0256] (xxxii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5092;

[0257] (xxxiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5096;

[0258] (xxxiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5098;

[0259] (xxxv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5101;

[0260] (xxxvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5108;

[0261] (xxxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5112;

[0262] (xxxviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5116;

[0263] (xxxix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5120;

[0264] (x1) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5122;

[0265] (xli) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5125;

[0266] (xlii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5132;

[0267] (xliii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5136;

[0268] (xlv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5140;

[0269] (xliv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5144; or

[0270] (xlvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5146.

[0271] 47. The siRNA of any one of embodiments 1 to 11 or 13 to 46, or the AAV viral genome of any one of embodiments 12 to 46, wherein:

[0272] (i) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4700, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4502-4505;

[0273] (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4918, 4938, 4958, 4978, or 4998;

[0274] (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4697, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4495-4499;

[0275] (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4906, 4926, 4946, 4966, 4986, or 5006;

[0276] (v) the antisense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4690, and the sense strand sequence comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 4480-4484;

[0277] (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4922, 4942, 4962, 4982, 5002, or 5022;

[0278] (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4694, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4492;

[0279] (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4691, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4485-4489;

[0280] (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4914, 4934, 4954, 4974, 4994, or 5014;

[0281] (x) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4701, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 4506-4510;

[0282] (xi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4910, 4930, 4950, 4970, 4990, or 5010;

[0283] (xii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4687, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4477;

[0284] (xiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4712, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4521;

[0285] (xiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4696, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4494; or

[0286] (xv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4718, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4527.

[0287] 48. The siRNA of any one of embodiments 1 to 11 or 13 to 47 or the AAV viral genome of any one of embodiments 12 to 47, wherein

[0288] (i) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4420, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4434;

[0289] (ii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4905, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907;

[0290] (iii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4421, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4435;

[0291] (iv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4909, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911;

[0292] (v) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4422, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4436;

[0293] (vi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4913, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4915;

[0294] (vii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4423, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4437;

[0295] (viii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4917, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919;

[0296] (ix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4424, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4438;

[0297] (x) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4921, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923;

[0298] (xi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4410, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4434;

[0299] (xii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4925, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907;

[0300] (xiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4411, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4435;

[0301] (xiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4929, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911;

[0302] (xv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4412, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4436;

[0303] (xvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4933, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4915;

[0304] (xvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4413, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4437;

[0305] (xviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4937, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4419;

[0306] (xix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4414, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4438;

[0307] (xx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4941, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923;

[0308] (xxi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4415, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4434;

[0309] (xxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4945, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907;

[0310] (xxiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4416, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4435;

[0311] (xxiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4949, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911;

[0312] (xxv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4417, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4436;

[0313] (xxvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4953, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4915;

[0314] (xxvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4418, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4437;

[0315] (xxviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4957, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919;

[0316] (xxix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4419, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4438;

[0317] (xxx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4961, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923;

[0318] (xxxi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4420, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4434;

[0319] (xxxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4965, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907;

[0320] (xxxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4421, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4435;

[0321] (xxxiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4969, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911;

[0322] (xxxiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4422, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4436;

[0323] (xxxv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4973, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4915;

[0324] (xxxvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4423, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4437;

[0325] (xxxvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4977, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919;

[0326] (xxxviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4424, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4438;

[0327] (xxxix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4981, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923;

[0328] (x1) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4425, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4434;

[0329] (xli) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4985, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907;

[0330] (xlii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4426, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4435;

[0331] (xliii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4989, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911;

[0332] (xliv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4427, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4436;

[0333] (xlv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4993, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4915;

[0334] (xlvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4428, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4437;

[0335] (xlvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4997, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919;

[0336] (xlviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4429, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4438;

[0337] (xlix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5001, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923;

[0338] (1) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4430, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4434;

[0339] (li) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5005, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907;

[0340] (lii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4431, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4435;

[0341] (liii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5009, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911;

[0342] (liv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4432, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4436;

[0343] (lv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5013, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4915;

[0344] (lvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4433, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4438;

[0345] (lvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5021, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923;

[0346] (lviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5053, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5056;

[0347] (11) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5059, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5056;

[0348] (1x) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5063, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5056;

[0349] (1xi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5065, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5056;

[0350] (lxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5069, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5056;

[0351] (1xiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5073, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5056;

[0352] (lxiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5076, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5079;

[0353] (lxv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5083, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5079;

[0354] (lxvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5087, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5079;

[0355] (lxvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5091, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5079;

[0356] (lxviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5095, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5079;

[0357] (lxix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5097, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5079;

[0358] (1xx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5100, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5103;

[0359] (lxxi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5107, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5103;

[0360] (lxxii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5111, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5103;

[0361] (lxxiii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5115, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5103;

[0362] (1xxiv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5119, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5103;

[0363] (lxxv) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5121, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5103;

[0364] (lxxvi) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5124, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5127;

[0365] (lxxvii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5131, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5127;

[0366] (lxxviii) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5135, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5127;

[0367] (1xxix) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5139, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5127;

[0368] (lxxx) the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5143, and the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5127; or

[0369] (lxxxi) The nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5145, and the nucleotide sequence encoding the antisense strand comprises the nucleotide sequence of SEQ ID NO: 5127.

[0370] 49. The siRNA of any one of embodiments 1 to 11, 13, 25 to 28, 36 to 39, 47 or 48, or the AAV viral genome of any one of embodiments 11 to 17, 25 to 28, 36 to 39 or 47 or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4905.

[0371] 50. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 29, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 18, 25 to 27, 29, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4917.

[0372] 51. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 30, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 30, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4921.

[0373] 52. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 31, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 31, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4965.

[0374] 53. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 32, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 62, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4969.

[0375] 54. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 33, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 33, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4977.

[0376] 55. The siRNA of any one of embodiments 1 to 11, 13, 25 to 27, 34, 36 to 39, 47, or 48, or the AAV viral genome of any one of embodiments 11 to 16, 19, 25 to 27, 34, 36 to 39, 47, or 48, wherein the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4981.

[0377] 56. The siRNA of any one of embodiments 1 to 11 or 13 to 55, or the AAV viral genome of any one of embodiments 12 to 55, wherein the sense strand sequence, the antisense strand sequence, or both the sense strand sequence and the antisense strand sequence comprise at least 15-30, 19-21, or 25-30 nucleotides in length, e.g., 17, 18, 20, 21, 22, 25, or 30 nucleotides in length.

[0378] 57. The siRNA of any one of embodiments 1 to 11 or 13 to 56, or the AAV viral genome of any one of embodiments 12 to 56, wherein the sense strand sequence, the antisense strand sequence, or both the sense strand sequence and the antisense strand sequence comprise an overhang of 1 or 2 nucleotides, e.g., an overhang at the 5' end of the sense strand sequence and / or the 3' end of the antisense strand sequence.

[0379] 58. The siRNA of any one of embodiments 1 to 11 or 13 to 57, or the AAV viral genome of any one of embodiments 12 to 57, wherein:

[0380] (i) the sense strand and the antisense strand each contain a mismatch; and / or

[0381] (ii) The antisense strand and the target sequence both contain a mismatch.

[0382] 59. A regulatory polynucleotide comprising the siRNA of any one of embodiments 1 to 12 or 13 to 58.

[0383] 60. The AAV viral genome of any one of embodiments 13 to 58, wherein the nucleotide sequence further encodes a regulatory polynucleotide comprising the sense strand sequence and the antisense strand sequence.

[0384] 61. The regulatory polynucleotide of embodiment 59 or the AAV viral genome of embodiment 60, wherein the regulatory polynucleotide further comprises one, two, three, or all of the following:

[0385] (i) 5' flanking region;

[0386] (ii) the ring area; and

[0387] (iii) 3' flanking region.

[0388] 62. The regulatory polynucleotide of embodiment 61 or the AAV viral genome of embodiment 61, wherein:

[0389] (i) the 5' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4878-4886; a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; a nucleotide sequence comprising one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4878-4886; or a nucleotide sequence comprising one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4878-4886;

[0390] (ii) the loop region comprises the nucleotide sequence of any one of SEQ ID NOs: 4887-4896; a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; a nucleotide sequence comprising one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4887-4896; or a nucleotide sequence comprising one, two, three, or four, but not more than five, modified nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4887-4896; and / or

[0391] (iii) the 3' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4897-4904; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4897-4904; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4897-4904.

[0392] 63. The regulatory polynucleotide of embodiment 61 or 62 or the AAV viral genome of embodiment 61 or 62, wherein:

[0393] (i) the nucleotide sequence encoding the 5' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4353-4361; a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; a nucleotide sequence comprising one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4353-4361; or a nucleotide sequence comprising one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4353-4361;

[0394] (ii) the nucleotide sequence encoding the loop region comprises the nucleotide sequence of any one of SEQ ID NOs: 4362-4371; a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; a nucleotide sequence comprising one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4362-4371; or a nucleotide sequence comprising one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4362-4371; and / or

[0395] (iii) the nucleotide sequence encoding the 3' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4372-4379; a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; a nucleotide sequence comprising one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4372-4379; or a nucleotide sequence comprising one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4372-4379.

[0396] 64. The regulatory polynucleotide of any one of embodiments 59 or 61 to 63, or the AAV viral genome of any one of embodiments 60 to 63, wherein the regulatory polynucleotide comprises:

[0397] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4879;

[0398] (ii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4887; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4887; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides from the nucleotide sequence of SEQ ID NO: 4887; or a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides from the nucleotide sequence of SEQ ID NO: 4887; and

[0399] (iii) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898.

[0400] 65. The regulatory polynucleotide of any one of embodiments 59 or 61 to 63, or the AAV viral genome of any one of embodiments 60 to 63, wherein the regulatory polynucleotide comprises:

[0401] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879;

[0402] (ii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888; and

[0403] (iii) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898.

[0404] 66. The regulatory polynucleotide of any one of embodiments 59 or 61 to 63, or the AAV viral genome of any one of embodiments 60 to 63, wherein the regulatory polynucleotide comprises:

[0405] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879;

[0406] (ii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4887; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4887; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4887; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4887; and

[0407] (iii) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4899; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4899; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4899; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4899.

[0408] 67. The regulatory polynucleotide of any one of embodiments 59 or 61 to 63, or the AAV viral genome of any one of embodiments 60 to 63, wherein the regulatory polynucleotide comprises:

[0409] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4880; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4880; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4880; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4880;

[0410] (ii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4891; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4891; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4891; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4891; and

[0411] (iii) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4900; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4900; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4900; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to SEQ ID NO: 4900.

[0412] 68. The regulatory polynucleotide of any one of embodiments 59 or 61 to 67, or the AAV viral genome of any one of embodiments 62 to 67, wherein the regulatory polynucleotide comprises, in 5' to 3' order:

[0413] (i) the 5' flanking region, the sense strand sequence, the loop region, the antisense strand sequence and the 3' flanking region; or

[0414] (ii) the 5' flanking region, the antisense strand sequence, the loop region, the sense strand sequence and the 3' flanking region.

[0415] 69. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 67, or 68, wherein the regulatory polynucleotide comprises:

[0416] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4880; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4880; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4880; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4880;

[0417] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4906;

[0418] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4891; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4891; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4891; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4891;

[0419] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4908; and

[0420] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4900; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4900; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4900; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to SEQ ID NO: 4900.

[0421] 70. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, or 67 to 69, or the AAV viral genome of any one of embodiments 60 to 63, or 67 to 69, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises:

[0422] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4355; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4355; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4355; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4355;

[0423] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4905;

[0424] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4366; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4366; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4366; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4366;

[0425] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4907; and

[0426] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4375; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO:4375.

[0427] 71. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 67, or 68, wherein the regulatory polynucleotide comprises:

[0428] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4880; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4880; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4880; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4880;

[0429] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4918;

[0430] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4891; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4891; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4891; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4891;

[0431] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4920; and

[0432] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4900; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4900; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4900; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to SEQ ID NO: 4900.

[0433] 72. The regulatory polynucleotide of any one of embodiments 59, 61-63, 67, 68, or 71, or the AAV viral genome of any one of embodiments 60-63, 67, 68, or 71, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises:

[0434] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4355; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4355; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4355; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4355;

[0435] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4917;

[0436] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4366; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4366; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4366; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4366;

[0437] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4919; and

[0438] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4375; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO:4375.

[0439] 73. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 67, or 68, wherein the regulatory polynucleotide comprises:

[0440] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4880; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4880; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4880; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4880;

[0441] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4922;

[0442] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4891; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4891; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4891; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4891;

[0443] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4924; and

[0444] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4900; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4900; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4900; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to SEQ ID NO: 4900.

[0445] 74. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, 68, or 73, or the AAV viral genome of any one of embodiments 60 to 63, 67, 68, or 73, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises:

[0446] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4355; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4355; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4355; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4355;

[0447] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4921;

[0448] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4366; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4366; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4366; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4366;

[0449] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4923; and

[0450] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO:4375; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4375; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4375; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO:4375.

[0451] 75. The regulatory polynucleotide of any one of embodiments 59, 60 to 63, 65, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 65, or 68, wherein the regulatory polynucleotide comprises:

[0452] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879;

[0453] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4966;

[0454] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888;

[0455] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4908; and

[0456] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898.

[0457] 76. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, or 76, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, or 76, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises:

[0458] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4354; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4354; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4354; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4354;

[0459] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4965;

[0460] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4363; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4363; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4363; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4363;

[0461] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4907; and

[0462] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4373.

[0463] 77. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 65, or 68, wherein the regulatory polynucleotide comprises:

[0464] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879;

[0465] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4970;

[0466] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888;

[0467] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4912; and

[0468] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898.

[0469] 78. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, or 77, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, or 77, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises:

[0470] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4354; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4354; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4354; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4354;

[0471] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4969;

[0472] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4363; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4363; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4363; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4363;

[0473] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4911; and

[0474] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4373.

[0475] 79. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 65, or 68, wherein the regulatory polynucleotide comprises:

[0476] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879;

[0477] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4978;

[0478] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888;

[0479] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4920; and

[0480] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898.

[0481] 80. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, or 79, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, or 79, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises:

[0482] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4354; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4354; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4354; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4354;

[0483] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4977;

[0484] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4363; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4363; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4363; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4363;

[0485] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4919; and

[0486] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4373.

[0487] 81. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, or 68, or the AAV viral genome of any one of embodiments 60 to 63, 65, or 68, wherein the regulatory polynucleotide comprises:

[0488] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879;

[0489] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4982;

[0490] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888;

[0491] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4924; and

[0492] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898.

[0493] 82. The regulatory polynucleotide of any one of embodiments 59, 61-63, 65, 68, or 81, or the AAV viral genome of any one of embodiments 60-63, 65, 68, or 81, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises:

[0494] (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4354; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4354; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4354; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4354;

[0495] (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4981;

[0496] (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4363; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4363; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4363; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4363;

[0497] (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4923; and

[0498] (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4373.

[0499] 83. The regulatory polynucleotide of any one of embodiments 59 or 61 to 82 or the AAV viral genome of any one of embodiments 62 to 82, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises a nucleotide sequence of the nucleotide sequence of any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto.

[0500] 84. The regulatory polynucleotide of any one of embodiments 59, 61-63, 67-70, or 83, or the AAV viral genome of any one of embodiments 60-63, 67-70, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4405, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0501] 85. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, 68, 71, 72, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 67, 68, 71, 72, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4408, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0502] 86. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 67, 68, 73, 74, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 67, 68, 73, 74, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4409, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0503] 87. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, 75, 76, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, 75, 76, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4390, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0504] 88. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, 77, 78, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, 77, 78, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4391, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0505] 89. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, 79, 80, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, 79, 80, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4393, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0506] 90. The regulatory polynucleotide of any one of embodiments 59, 61 to 63, 65, 68, 81, 82, or 83, or the AAV viral genome of any one of embodiments 60 to 63, 65, 68, 81, 82, or 83, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of SEQ ID NO: 4394, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0507] 91. An adeno-associated virus (AAV) viral genome comprising a promoter operably linked to a nucleic acid encoding a regulatory polynucleotide as described in any one of embodiments 59 to 90 or a siRNA as described in any one of embodiments 1 to 11 or 13 to 58.

[0508] 92. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 90, wherein the AAV viral genome further comprises a promoter operably linked to a nucleotide sequence encoding the sense strand sequence and the antisense strand sequence or a regulatory polynucleotide.

[0509] 93. The AAV viral genome of embodiment 92, wherein the promoter is a ubiquitin promoter.

[0510] 94. The AAV viral genome of embodiment 92, wherein the promoter is a cell- or tissue-specific promoter.

[0511] 95. The AAV viral genome of any one of embodiments 92 to 94, wherein the promoter is selected from the group consisting of human elongation factor 1 alpha-subunit (EF1α), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken beta-actin (CBA) and its derivative CAG, beta glucuronidase (GUSB) or ubiquitin C (UBC), neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-β), intercellular adhesion molecule 2 (ICAM-2), synaptophysin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca2+ / calmodulin Protein-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or neurofilament heavy chain (NFH), β-globin minigene nβ2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), cardiovascular promoters (e.g., αMHC, cTnT and CMV-MLC2k), liver promoters (e.g., hAAT, TBG), skeletal muscle promoters (e.g., desmin, MCK, C512) or functional fragments thereof, such as truncations, or functional variants.

[0512] 96. The AAV viral genome of any one of embodiments 92 to 95, wherein the promoter comprises a CBA promoter or a variant thereof.

[0513] 97. The AAV viral genome of any one of embodiments 92 to 95, wherein the promoter comprises the nucleotide sequence of any one of the nucleotide sequences provided in Table 2; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to any one of the nucleotide sequences provided in Table 2; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity with any one of the nucleotide sequences provided in Table 2.

[0514] 98. The AAV viral genome of any one of embodiments 92 to 97, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 5199.

[0515] 99. The AAV viral genome of any one of embodiments 92 to 97, wherein the AAV viral genome further comprises a polyA signal sequence.

[0516] 100. The AAV viral genome of embodiment 99, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476.

[0517] 101. The AAV viral genome of any one of embodiments 26 to 32, wherein the AAV viral genome further comprises an inverted terminal repeat (ITR) sequence.

[0518] 102. The AAV viral genome of embodiment 101, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197, 5200, 4469 or 4470; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO: 5197, 5200, 4469 or 4470; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 5197, 5200, 4469 or 4470.

[0519] 103. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 102, wherein the AAV viral genome comprises an ITR sequence located 5′ relative to the nucleic acid encoding the regulatory polynucleotide or siRNA.

[0520] 104. The AAV viral genome of embodiment 103, wherein the ITR located 5′ relative to the nucleic acid encoding the regulatory polynucleotide or siRNAR comprises the nucleotide sequence of SEQ ID NO: 5197 or 4469; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO: 5197 or 4469; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 5197 or 4469.

[0521] 105. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 104, wherein the AAV viral genome comprises an ITR sequence located 3′ relative to the nucleic acid encoding the regulatory polynucleotide or siRNA.

[0522] 106. The AAV viral genome of embodiment 103, wherein the ITR located 3′ relative to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises the nucleotide sequence of SEQ ID NO: 5200 or 4470; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO: 5200 or 4470; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 5200 or 4470.

[0523] 107. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 106, wherein the AAV viral genome comprises an ITR sequence located 5' relative to the nucleic acid encoding the regulatory polynucleotide or siRNA and an ITR sequence located 3' relative to the nucleic acid encoding the regulatory polynucleotide or siRNA.

[0524] 108. The AAV viral genome of any one of embodiments 105 to 107, wherein:

[0525] (i) the ITR sequence located 5' to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; and

[0526] (ii) the ITR sequence located 3' to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises a nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0527] 109. The AAV viral genome of any one of embodiments 105 to 107, wherein:

[0528] (i) the ITR sequence located 5' to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises the nucleotide sequence of SEQ ID NO: 4469; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4469; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4469; and

[0529] (ii) the ITR sequence located 3' to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises the nucleotide sequence of SEQ ID NO: 4470; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4470; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4470.

[0530] 110. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 109, wherein the AAV viral genome further comprises an enhancer, a Kozak sequence, an intron region, and / or an exon region.

[0531] 111. The AAV viral genome of embodiment 110, wherein the enhancer comprises:

[0532] (i) CMV enhancer or a variant thereof; or

[0533] (ii) the nucleotide sequence of SEQ ID NO: 4471 or 4472; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471 or 4472; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 4471 or 4472.

[0534] 112. The AAV viral genome of embodiment 110 or 111, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 4471.

[0535] 113. An AAV viral genome as described in any one of embodiments 12 to 58 or 60 to 112, comprising a CMVie enhancer or a variant thereof; and a CBA promoter or a variant thereof; optionally wherein the CMVie enhancer or a variant thereof is present at 5' relative to the CBA promoter or a variant thereof.

[0536] 114. The AAV viral genome of any one of embodiments 110 to 113, wherein the enhancer and the promoter comprise the nucleotide sequence of SEQ ID NO: 4473 or 4474; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO: 4473 or 4474; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 4473 or 4474.

[0537] 115. The AAV viral genome of any one of embodiments 110 to 114, wherein the intron comprises:

[0538] (i) human beta globin intron (hBG intron) or a variant thereof; or

[0539] (ii) the nucleotide sequence of SEQ ID NO:4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO:4475; or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:4475.

[0540] 116. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 115, wherein the AAV viral genome further comprises a nucleotide sequence encoding a miR binding site, e.g., a miR binding site that modulates, e.g., reduces, expression of a payload encoded by the viral genome in a cell or tissue expressing the corresponding miRNA.

[0541] 117. The AAV viral genome of embodiment 116, wherein the encoded miR binding site modulates, e.g., reduces, expression of the encoded payload in cells or tissues of the DRG, liver, heart, hematopoietic lineage, or a combination thereof.

[0542] 118. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 117, wherein the AAV viral genome comprises at least 1-5 copies of the encoded miR binding site, e.g., at least 1, 2, 3, 4, or 5 copies, optionally wherein the at least 1-5 copies are contiguous (e.g., not separated by a spacer) or the at least 1-5 copies are separated by a spacer.

[0543] 119. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 118, wherein the AAV viral genome is self-complementary.

[0544] 120. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 118, wherein the AAV viral genome is single-stranded.

[0545] 121. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 120, wherein the AAV viral genome further comprises a nucleotide sequence encoding a Rep protein, e.g., a nonstructural protein, wherein the Rep protein comprises a Rep78 protein, a Rep68, a Rep52 protein, and / or a Rep40 protein (e.g., a Rep78 and Rep52 protein).

[0546] 122. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 121, wherein the AAV viral genome comprises, in 5' to 3' order:

[0547] (i) ITR;

[0548] (ii) an enhancer (e.g., a CMV enhancer or a variant thereof);

[0549] (iii) a promoter (eg, a CBA promoter or a variant thereof);

[0550] (iv) an intron (eg, an hBG intron or a variant thereof);

[0551] (v) a nucleic acid sequence encoding a regulatory polynucleotide (e.g., a regulatory polynucleotide as described in any one of embodiments 59 to 90);

[0552] (vi) a polyA signal sequence; and

[0553] (vii)ITR.

[0554] 123. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0555] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0556] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0557] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0558] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0559] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0560] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0561] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0562] 124. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0563] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0564] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0565] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0566] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0567] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises any one of SEQ ID NO: 4405, 4408, 4409, 4390, 4391, 4393, or 4394, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto;

[0568] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0569] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0570] 125. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0571] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0572] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0573] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0574] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0575] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4405, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0576] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0577] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0578] 126. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0579] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0580] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0581] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0582] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0583] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4408, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0584] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0585] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0586] 127. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0587] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0588] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0589] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0590] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0591] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4409, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0592] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0593] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0594] 128. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0595] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0596] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0597] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0598] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0599] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4390, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0600] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0601] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0602] 129. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0603] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0604] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0605] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0606] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0607] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4391, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0608] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0609] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0610] 130. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0611] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0612] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0613] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0614] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0615] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4393, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0616] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0617] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0618] 131. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0619] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197;

[0620] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471;

[0621] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0622] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0623] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4394, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0624] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0625] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

[0626] 132. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 122, wherein the AAV viral genome comprises, in 5' to 3' order:

[0627] (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 4469; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4469; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4469;

[0628] (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4472; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4472; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4472;

[0629] (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199;

[0630] (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475;

[0631] (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto;

[0632] (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; and

[0633] (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 4470; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4470; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4470.

[0634] 133. The AAV viral genome of any one of embodiments 12 to 58 or 60 to 132, comprising the nucleotide sequence of any one of SEQ ID NOs: 4439-4468 or 5149-5196, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NOs: 4439-4468 or 5149-5196.

[0635] 134. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, or 110 to 133, comprising the nucleotide sequence of any one of SEQ ID NOs: 5149-5196, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 5149-5196.

[0636] 135. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, 110 to 133, or 134, comprising the nucleotide sequence of any one of SEQ ID NOs: 5173, 5195, 5196, 5182, 5183, 5184, or 5185, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 5173, 5195, 5196, 5182, 5183, 5184, or 5185.

[0637] 136. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, 110 to 125, or 133 to 135, comprising the nucleotide sequence of SEQ ID NO: 5173, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5173.

[0638] 137. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, 110 to 124, 126, or 133 to 135, comprising the nucleotide sequence of SEQ ID NO: 5195, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5195.

[0639] 138. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, 110 to 124, 127, or 133 to 135, comprising the nucleotide sequence of SEQ ID NO: 5196, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5196.

[0640] 139. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, 110 to 124, 128, or 133 to 135, comprising the nucleotide sequence of SEQ ID NO: 5182, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5182.

[0641] 140. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, 110 to 124, 129, or 133 to 135, comprising the nucleotide sequence of SEQ ID NO: 5183, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5183.

[0642] 141. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, 110 to 124, 130, or 133 to 135, comprising the nucleotide sequence of SEQ ID NO: 5184, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5184.

[0643] 142. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 108, 110 to 124, 131, or 133 to 135, comprising the nucleotide sequence of SEQ ID NO: 5185, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5185.

[0644] 143. The AAV viral genome of any one of embodiments 12 to 58, 60 to 96, 98 to 107, 109 to 122, or 133, comprising the nucleotide sequence of any one of SEQ ID NOs: 4439-4468, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 4439-4468.

[0645] 144. An AAV particle comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, an AAV viral genome encoding a regulatory polynucleotide of any one of embodiments 59 to 90, or an AAV viral genome encoding an siRNA of any one of embodiments 11 or 13 to 58, and an AAV capsid protein.

[0646] 145. The AAV particle of embodiment 48, wherein the AAV capsid protein comprises an AAV5 capsid protein, an AAV9 capsid protein, a VOY101 capsid protein, a PHPeB capsid protein, a PHP.B capsid protein, a PHP.N capsid protein, an AAV1 capsid protein, a VOY9P39 capsid protein, an AAV2 capsid protein, an AAVrh10 capsid protein, or a variant thereof (e.g., an AAV9 capsid protein or a variant thereof or an AAV5 capsid protein or a variant thereof).

[0647] 146. The AAV particle of embodiment 144 or 145, wherein the AAV capsid protein comprises an AAV9 capsid or a variant thereof.

[0648] 147. The AAV particle of embodiment 144 or 145, wherein the AAV capsid protein comprises an AAV5 capsid or a variant thereof.

[0649] 148. The AAV particle of any one of embodiments 144 to 147, wherein:

[0650] (i) the AAV capsid protein comprises an amino acid sequence provided in Table 1 or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98% or 99% identical thereto; or

[0651] (ii) the nucleotide sequence encoding the AAV capsid protein comprises any one of the nucleotide sequences in Table 1 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98% or 99% identical thereto.

[0652] 149. A vector comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, a nucleotide sequence encoding a regulatory polynucleotide of any one of embodiments 59 to 90, or a nucleotide sequence encoding an siRNA of any one of embodiments 11 or 13 to 58.

[0653] 150. A cell comprising the AAV particle of any one of embodiments 144 to 148, the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58.

[0654] 151. The cell of embodiment 150, wherein the cell is a mammalian cell or an insect cell.

[0655] 152. The cell of embodiment 150 or 151, wherein the cell is a cell of a brain region or a spinal cord region (eg, a CNS cell).

[0656] 153. The cell of any one of embodiments 150 to 152, wherein the cell is a cell of the cortex, hippocampus, thalamus, or brainstem.

[0657] 154. The cell of any one of embodiments 150 to 153, wherein the cell is a neuron, a glial cell, or an oligodendrocyte.

[0658] 155. A method for preparing AAV particles, comprising:

[0659] (i) providing a host cell comprising an AAV viral genome as described in any one of embodiments 12 to 58 or 60 to 143, an AAV viral genome encoding a regulatory polynucleotide as described in any one of embodiments 59 to 90, or a viral genome encoding an siRNA as described in any one of embodiments 11 or 13 to 58;

[0660] (ii) incubating the host cell under conditions suitable for encapsidation of the AAV viral genome in AAV capsid proteins;

[0661] The AAV particles are thereby prepared.

[0662] 156. The method of embodiment 155, further comprising, prior to step (i), introducing a first nucleic acid molecule comprising the viral genome into the host cell.

[0663] 157. The method of embodiment 155 or 156, wherein the host cell comprises a second nucleic acid encoding the AAV capsid protein.

[0664] 158. The method of embodiment 157, wherein the second nucleic acid molecule is introduced into the host cell before, simultaneously with, or after the introduction of the first nucleic acid molecule.

[0665] 159. A pharmaceutical composition comprising the AAV particle of any one of embodiments 144 to 148, an AAV particle comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, and a pharmaceutically acceptable excipient.

[0666] 160. A method for delivering siRNA for inhibiting MAPT expression (e.g., MAPT gene, mRNA or protein expression) to a cell, comprising administering an effective amount of the pharmaceutical composition of embodiment 159, the AAV particles of any one of embodiments 144 to 159, the AAV particles comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, thereby delivering the siRNA for inhibiting MAPT expression to the cell.

[0667] 161. The method of embodiment 160, wherein the cell is a cell of a brain region or a spinal cord region.

[0668] 162. The method of embodiment 160 or 161, wherein the cell is a cell of the cortex, hippocampus, thalamus, or brainstem.

[0669] 163. The method of any one of embodiments 160 to 162, wherein the cell is a neuron, an astrocyte, a glial cell, or an oligodendrocyte.

[0670] 164. The method of any one of embodiments 160 to 163, wherein delivery reduces (e.g., inhibits) MAPT mRNA levels in cells, e.g., of a brain region (e.g., the cortex, hippocampus, or brainstem), e.g., by at least 40%, 44%, 45%, 50%, 55%, 60%, 64%, 65%, 70%, 75%, 76%, 79%, 80%, 84%, 85%, 87%, or 90%, e.g., as measured by an assay (e.g., an assay as described in Example 6), e.g., compared to a reference level (e.g., mRNA levels in cells before or before delivery of the AAV particles, regulatory polynucleotides, siRNA, or pharmaceutical composition).

[0671] 165. The method of any one of embodiments 160 to 164, wherein delivery reduces (e.g., inhibits) MAPT protein levels in cells of, e.g., a brain region (e.g., the cortex, hippocampus, thalamus, or brainstem), e.g., by at least 15%, 17%, 20%, 25%, 30%, 35%, 37%, 40%, 44%, 45%, 46%, 50%, 53%, 55%, 60%, 63%, 64%, 65%, 70%, 72%, 74%, or 75%, e.g., as measured by an assay (e.g., an assay as described in Example 6), e.g., compared to a reference level (e.g., the protein level in cells before or before delivery of the AAV particles, regulatory polynucleotides, siRNA, or pharmaceutical composition).

[0672] 166. The method of any one of embodiments 160 to 165, wherein the cell is in a subject.

[0673] 167. The method of embodiment 166, wherein the subject has or has been diagnosed as having a genetic disorder (e.g., a monogenic disorder or a polygenic disorder).

[0674] 168. The method of embodiment 166 or 167, wherein the subject suffers from or has been diagnosed as suffering from a neurological disorder (e.g., a neurodegenerative disorder).

[0675] 169. The method of any one of embodiments 166 to 168, wherein the subject is suffering from or has been diagnosed as having a disorder associated with tau expression (e.g., abnormal tau expression).

[0676] 170. The method of any one of embodiments 166 to 169, wherein the subject has or has been diagnosed with tauopathy.

[0677] 171. A method of treating a subject having or diagnosed as having a genetic disorder (e.g., a monogenic disorder or a polygenic disorder), the method comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 159, the AAV particles of any one of embodiments 144 to 159, the AAV particles comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, thereby treating the subject having or diagnosed as having the genetic disorder (e.g., the monogenic disorder or the polygenic disorder).

[0678] 172. A method of treating a subject having or diagnosed as having a neurological disorder (e.g., a neurodegenerative disorder), the method comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 159, the AAV particles of any one of embodiments 144 to 159, the AAV particles comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, thereby treating the subject having or diagnosed as having the neurological disorder (e.g., the neurodegenerative disorder).

[0679] 173. A method of treating a subject having or diagnosed as having a disorder associated with tau expression (e.g., abnormal tau expression), the method comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 159, the AAV particles of any one of embodiments 144 to 159, the AAV particles comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, thereby treating the subject having or diagnosed as having the disorder associated with tau expression (e.g., abnormal tau expression).

[0680] 174. A method of treating a subject having or diagnosed with a tauopathy, the method comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 159, the AAV particles of any one of embodiments 144 to 159, the AAV particles comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, thereby treating the subject having or diagnosed with the tauopathy.

[0681] 175. The method of any one of embodiments 167 to 174, wherein the genetic disorder, neurological disorder (e.g., neurodegenerative disorder), disorder associated with tau expression (e.g., abnormal tau expression), and / or tauopathy is Alzheimer's disease (AD), frontotemporal dementia (FTD), frontotemporal dementia and Parkinsonism associated with chromosome 17 (FTDP-17), frontotemporal lobar degeneration (FTLD), Dravet syndrome (DS), a neurodegenerative disease, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), progressive supranuclear palsy (PSP), Down syndrome, Pick's disease, corticobasal degeneration (CBD), corticobasal syndrome, amyotrophic lateral sclerosis (ALS), a prion disease, CJD, multiple system atrophy, mild cognitive impairment, dementia with only neurofibrillary tangles, or progressive subcortical gliosis.

[0682] 176. The method of any one of embodiments 171 to 175, wherein treating comprises preventing progression of the genetic disorder, neurological disorder (e.g., neurodegenerative disorder), disorder associated with tau expression (e.g., abnormal tau expression), and / or tauopathy in the subject.

[0683] 177. The method of any one of embodiments 171 to 176, further comprising performing a blood test, an imaging test (e.g., a PET scan or a PET scan combined with a biomarker, such as serum biomarker staining), a CNS biopsy sample, or an aqueous cerebrospinal fluid biopsy, optionally wherein the blood test, imaging test, biopsy sample, or aqueous cerebrospinal fluid biopsy is performed before, during, or after treatment with the AAV particle, regulatory polynucleotide, siRNA, or pharmaceutical composition.

[0684] 178. The method of any one of embodiments 160 to 177, wherein administration reduces, eg, decreases or inhibits, expression of the MAPT gene, mRNA and / or protein.

[0685] 179. The method of embodiment 178, wherein the MAPT gene, mRNA and / or protein is a wild-type MAPT gene, mRNA or protein.

[0686] 180. The method of embodiment 178 or 179, wherein the MAPT gene, mRNA and / or protein is a mutated MAPT gene, mRNA or protein (eg, comprising at least one mutation).

[0687] 181. The method of any one of embodiments 171 to 180, wherein administration of the AAV particle, regulatory polynucleotide, siRNA, or pharmaceutical composition results in reduction and / or prevention of tau pathology, e.g., reduction of biomarkers of tau pathology (e.g., tau pathology), e.g., as measured by PET scan or PET scan combined with Braak neuropathology staging and / or serum biomarker staining, e.g., compared to a reference (e.g., a subject that did not receive the AAV particle, regulatory polynucleotide, siRNA, or pharmaceutical composition). 18 F-flortaucipir, plasma ptau 181 or 18F-PM-PBB3).

[0688] 182. The method of any one of embodiments 171 to 181, wherein the administration reduces MAPT mRNA levels in the subject, e.g., by at least 40%, 44%, 45%, 50%, 55%, 60%, 64%, 65%, 70%, 75%, 76%, 79%, 80%, 84%, 85%, 87%, or 90%, e.g., compared to a reference level (e.g., mRNA levels in a subject not yet or before receiving the AAV particles, regulatory polynucleotides, siRNA, or pharmaceutical composition), e.g., when measured by an assay (e.g., an assay as described in Example 6).

[0689] 183. The method of any one of embodiments 171 to 182, wherein the administration reduces MAPT protein levels in the subject, e.g., reduces protein levels in cells of a brain region (e.g., cortex, hippocampus, thalamus, or brainstem) by at least 15%, 17%, 20%, 25%, 30%, 35%, 37%, 40%, 44%, 45%, 46%, 50%, 53%, 55%, 60%, 63%, 64%, 65%, 70%, 72%, 74%, or 75%, e.g., compared to a reference level (e.g., protein levels in a subject not yet or before receiving the AAV particles, regulatory polynucleotides, siRNA, or pharmaceutical composition).

[0690] 184. The method of any one of embodiments 166 to 183, wherein the subject is human.

[0691] 185. The method of any one of embodiments 166 to 184, wherein the pharmaceutical composition, AAV particles, regulatory polynucleotide, or siRNA is administered to the subject intravenously, intramuscularly, via intraparenchymal administration, intracerebroventricularly, via intracisterna magna (ICM) injection, intrathecally, via focused ultrasound (FUS), e.g., intravenous administration combined with microbubbles (FUS-MB), or MRI-guided FUS combined with intravenous administration.

[0692] 186. The method of any one of embodiments 166 to 185, wherein the pharmaceutical composition, AAV particle, regulatory polynucleotide, or siRNA is administered intravenously to the subject.

[0693] 187. The method of any one of embodiments 166 to 186, wherein the pharmaceutical composition, AAV particle, regulatory polynucleotide, or siRNA is administered to the subject via intracisterna magna (ICM) injection.

[0694] 188. The method of any one of embodiments 166 to 187, wherein the pharmaceutical composition, AAV particle, regulatory polynucleotide, or siRNA is administered intrathecally to the subject.

[0695] 189. The pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144 to 159, the AAV particle comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, for use in a method of delivering an siRNA for inhibiting MAPT expression to a cell.

[0696] 190. The pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144 to 159, the AAV particle comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58, for use in the manufacture of a medicament.

[0697] 191. The pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144 to 159, the AAV particle comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58 for use in treating a genetic disorder, a neurological disorder (e.g., a neurodegenerative disorder), a disorder associated with tau expression (e.g., abnormal tau expression), and / or a tauopathy.

[0698] 192. Use of the pharmaceutical composition of embodiment 159, the AAV particles of any one of embodiments 144 to 159, the AAV particles comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58 in the manufacture of a medicament for delivering siRNA for inhibiting MAPT expression to a cell.

[0699] 193. Use of the pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144 to 159, the AAV particle comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58 in the manufacture of a medicament.

[0700] 194. Use of the pharmaceutical composition of embodiment 159, the AAV particle of any one of embodiments 144 to 159, the AAV particle comprising the AAV viral genome of any one of embodiments 12 to 58 or 60 to 143, the regulatory polynucleotide of any one of embodiments 59 to 90, or the siRNA of any one of embodiments 11 or 13 to 58 in the manufacture of a medicament for treating a genetic disorder, a neurological disorder (e.g., a neurodegenerative disorder), a disorder associated with tau expression (e.g., abnormal tau expression), and / or a tauopathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0701] Figure 1Graph depicting relative R / F activity expressed as % relative to non-target control (NTC) on the Y-axis following transfection with regulatory polynucleotide constructs targeting MAPT as indicated on the X-axis (from left to right: VOYTaumiR-102-530 (SEQ ID NO: 4380), VOYTaumiR-102-556 (SEQ ID NO: 4381), VOYTaumiR-102-579 (SEQ ID NO: 4383), VOYTaumiR-102-586 (SEQ ID NO: 4384), VOYTaumiR-104-530 (SEQ ID NO: 4385), VOYTaumiR-104-556 (SEQ ID NO: 4386), VOYTaumiR-104-579 (SEQ ID NO: 4388), VOYTaumiR-104-586 (SEQ ID NO: 4389). NO:4389), VOYTaumiR-109-530 (SEQ ID NO:4390), VOYTaumiR-109-556 (SEQ ID NO:4391), VOYTaumiR-109-579 (SEQ ID NO:4393), VOYTaumiR-109-586 (SEQ ID NO:4394), VOYTaumiR-114-530 (SEQ ID NO:4395), VOYTaumiR-114-556 (SEQ ID NO:4396), VOYTaumiR-114-579 (SEQ ID NO:4398), VOYTaumiR-114-586 (SEQ ID NO:4399), VOYTaumiR-116-530 (SEQ ID NO:4400), VOYTaumiR-116-556 (SEQ ID NO:4401), VOYTaumiR-116-579 (SEQ ID NO:4403), VOYTaumiR-116-586 (SEQ ID NO:4404), VOYTaumiR-127-530 (SEQ ID NO:4405), VOYTaumiR-127-556 (SEQ ID NO:4406), VOYTaumiR-127-579 (SEQ ID NO:4408) and VOYTaumiR-127-586 (SEQ ID NO:4409)).

[0702] Figure 2Figure 3 is a graph showing the fold change in residual MAPT mRNA relative to the non-target control (fold change relative to NTC) for each vectored regulatory polynucleotide on the Y-axis after transfection with the regulatory polynucleotide constructs targeting MAPT shown on the X-axis (from left to right: mock, non-target control (NTC), VOYTaumiR-127-530 (SEQ ID NO: 4405), VOYTaumiR-127-556 (SEQ ID NO: 4406), VOYTaumiR-127-579 (SEQ ID NO: 4408), VOYTaumiR-127-586 (SEQ ID NO: 4409), VOYTaumiR-116-530 (SEQ ID NO: 4400), VOYTaumiR-116-556 (SEQ ID NO: 4401), VOYTaumiR-116-579 (SEQ ID NO: 4402). NO:4403), VOYTaumiR-116-586 (SEQ ID NO:4404), VOYTaumiR-114-530 (SEQ ID NO:4395), VOYTaumiR-114-556 (SEQ ID NO:4396), VOYTaumiR-114-579 (SEQ ID NO:4398), VOYTaumiR-114-586 (SEQ ID NO:4399), VOYTaumiR-109-530 (SEQ ID NO:4390), VOYTaumiR-109-556 (SEQ ID NO:4391), VOYTaumiR-109-579 (SEQ ID NO:4393), VOYTaumiR-109-586 (SEQ ID NO:4394), VOYTaumiR-104-530 (SEQ ID NO:4385), VOYTaumiR-104-556 (SEQ ID NO:4386), VOYTaumiR-104-579 (SEQ ID NO:4388), VOYTaumiR-104-586 (SEQ ID NO:4389), VOYTaumiR-102-530 (SEQ ID NO:4380), VOYTaumiR-102-556 (SEQ ID NO:4381), VOYTaumiR-102-579 (SEQ ID NO:4383) and VOYTaumiR-102-586 (SEQ ID NO:4384)).

[0703] Figure 3Figure 3 is a graph showing the fold change in residual MAPT mRNA relative to the non-target control (fold change relative to NTC) for each vectored regulatory polynucleotide on the Y-axis following transfection with increasing concentrations of regulatory polynucleotide on the X-axis (0.05 μg, 0.16 μg, 0.50 μg, or 1.50 μg / well) (from left to right: mock, non-target control (NTC), VOYTaumiR-127-530 (SEQ ID NO: 4405), VOYTaumiR-127-556 (SEQ ID NO: 4406), VOYTaumiR-127-579 (SEQ ID NO: 4408), VOYTaumiR-127-586 (SEQ ID NO: 4409), VOYTaumiR-109-530 (SEQ ID NO: 4390), VOYTaumiR-109-556 (SEQ ID NO: 4391). NO:4391), VOYTaumiR-109-579 (SEQ ID NO:4393), VOYTaumiR-109-586 (SEQ ID NO:4394), VOYTaumiR-116-579 (SEQ ID NO:4403), VOYTaumiR-104-556 (SEQ ID NO:4386) and VOYTaumiR-104-586 (SEQ ID NO:4389)).

[0704] Figure 4Figure 3 is a graph plotting the fold change in residual MAPT mRNA (fold change relative to NTC) for each vectored regulatory polynucleotide on the Y-axis relative to a non-target control after transfection with the indicated concentration (0.5 μg or 1.0 μg) of regulatory polynucleotide on the X-axis (from left to right: mock, GFP, NTC, MAPT antisense oligonucleotide (ASO) positive control, VOYTaumiR-127-530 (SEQ ID NO: 4405), VOYTaumiR-109-530 (SEQ ID NO: 4390), VOYTaumiR-102-582 (SEQ ID NO: 5027), VOYTaumiR-104-582 (SEQ ID NO: 5031), VOYTaumiR-109-582 (SEQ ID NO: 5035), VOYTaumiR-114-582 (SEQ ID NO: 5037). NO:5039), VOYTaumiR-127-582 (SEQ ID NO:5047), VOYTaumiR-102-587 (SEQ ID NO:5028), VOYTaumiR-109-587 (SEQ ID NO:5036), VOYTaumiR-114-587 (SEQ ID NO:5040), VOYTaumiR-104-552 (SEQ ID NO:5033), VOYTaumiR-104-549 (SEQ ID NO:5034) and VOYTaumiR-116-549 (SEQ ID NO:5046)).

[0705] Figures 5A to 5E Figure 3: Cortical changes in mice after intravenous injection of vehicle control or AAV particles containing VOY9P39 capsids encoding VOYTaumiR-127-530 regulatory polynucleotides (VOY9P39_127-530) at doses of 3e12 vg / kg, 1e13 vg / kg, or 3e13 vg / kg. Figure 5A ), hippocampus( Figure 5B ), brainstem( Figure 5C ),thalamus( Figure 5D ) or liver ( Figure 5E ) per diploid cell. Statistical significance was assessed using one-way ANOVA with Tukey's multiple comparison post hoc test; *, **, ***, and **** indicate p < 0.05, 0.005, 0.0005, and 0.0001, respectively. Data are presented as group mean ± SEM. Numbers above the bars indicate group means in vg / dg (biodistribution).

[0706] 6A to 6DTo depict the changes in the cortex of mice ( Figure 6A ), hippocampus( Figure 6B ),thalamus( Figure 6C ) or brainstem ( Figure 6D ) is a series of graphs showing the fold change in the residual MAPT mRNA level relative to vehicle in each treatment group after treatment on the Y-axis, which are, from left to right: vehicle control, 3e13 vg / kg of VOY9P39 capsid and mCherry reporter control, 3e13 vg / kg of VOY9P39 capsid and non-target control (NTC), 3e12 vg / kg of VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide (127-530), 1e13 vg / kg of VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide (127-530), 3e13 vg / kg of VOY9P39 capsid and VOYTaumiR-127-530 regulatory polynucleotide (127-530), and 3e13 vg / kg of VOY101 capsid and mCherry reporter control, and 3e13 vg / kg of VOY101 capsid and VOYTaumiR-127-530 regulatory polynucleotide (127-530). Statistical significance was assessed using one-way ANOVA with Tukey's multiple comparisons, with p values indicated above the figures.

[0707] 7A to 7D Figure 3: Cortical changes in mice after intravenous injection of vehicle control (Vehicle); or AAV particles containing VOY9P39 capsid encoding VOYTaumiR-127-530 regulatory polynucleotide (127-530) at doses of 3e12 vg / kg, 1e13 vg / kg, or 3e13 vg / kg. Figure 7A ), hippocampus( Figure 7B ),thalamus( Figure 7C ) or brainstem ( Figure 7D Figure 3 (A series of graphs showing the residual MAPT protein levels in each treatment group relative to vehicle after treatment in Figure 3). The percentage above the bars represents the percentage of tau protein knockdown after treatment. Statistical significance was assessed using one-way ANOVA with Tukey's multiple comparisons.

[0708] Figures 8A to 8DFigure 3 shows the cortical changes of mice after intravenous injection of vehicle control (Vehicle); 1e13 vg / kg dose of AAV particles containing VOY9P39 capsid encoding non-target control (NTC) (C9P39-NTC_1E13); 1e12 vg / kg (C9P39-127.530_1E12) or 1e13 vg / kg (C9P39-127.530_1E13) dose of AAV particles containing VOY9P39 capsid encoding VOYTaumiR-127-530 regulatory polynucleotide; or 1e13 vg / kg (C9P39-127.579_1E13) dose of AAV particles containing VOY9P39 capsid encoding VOYTaumiR-127-579 regulatory polynucleotide. Figure 8A ), hippocampus( Figure 8B ),thalamus( Figure 8C ) or brainstem ( Figure 8D ) A series of graphs showing the residual MAPT mRNA levels in each treatment group relative to vehicle after treatment in ). Statistical significance was assessed using one-way ANOVA with Tukey's multiple comparisons, with p values indicated above the figures. DETAILED DESCRIPTION

[0709] This article especially describes a composition comprising isolated, for example, recombinant viral particles, such as AAV particles, for delivering (e.g., vectorized delivery) an RNA agent for targeting MAPT (e.g., an siRNA duplex for targeting MAPT) and its preparation and use methods. In some embodiments, the RNA agent for targeting MAPT is an siRNA duplex for regulating, for example, suppressing MAPT expression, such as an siRNA duplex for targeting MAPT as described herein. Generally speaking, recombinant AAV particles will include a viral genome and an AAV capsid protein, for example, an AAV capsid variant described herein, the viral genome including a nucleotide sequence encoding a transgenic RNA agent for targeting MAPT (e.g., an siRNA duplex for targeting MAPT).

[0710] Identified that the mutation in the MAPT gene causes the autosomal dominant tauopathy called the frontotemporal dementia and Parkinson's disease (FTDP-17) related to chromosome 17, proving that the mutation of the MAPT gene and / or tau protein may cause brain neurodegeneration to change. Mutant tau is considered to be more likely to produce amyloid protein than wild-type tau, which means that it is more likely to be highly phosphorylated and aggregated into NFT (Hutton, M. et al., 1998, Nature 393 (6686): 702-5), and these NFT can be made up of the pathological form of tau, including but not limited to the tau species of hyperphosphorylation, misfolding and aggregation, each of which has produced a group of targets eagerly pursued. The hyperphosphorylation of tau suppresses its combination with microtubules and microtubule assembly / stability activity. In addition, the hyperphosphorylation of tau makes it easy to misfold and aggregate. Without wishing to be bound by theory, it is believed that in some embodiments, administration of siRNA targeting MAPT (e.g., a mutated MAPT gene or a wild-type MAPT gene), such as siRNA for targeting MAPT described herein and vectorized forms thereof, can reduce tau, such as pathological tau, protein expression, aggregation, hyperphosphorylation and / or misfolding, thereby modulating, such as reducing or slowing pathology associated with abnormal tau expression and / or tauopathies (e.g., Alzheimer's disease (AD), frontotemporal dementia (FTD) and / or Dravet syndrome (DS)).

[0711] Without wishing to be bound by theory, it is believed that in some embodiments, the use of one or more AAV particles for vectored delivery of an RNA agent targeting MAPT described herein (e.g., an siRNA duplex targeting MAPT) may result in increased exposure in the central nervous system (CNS) and robust expression of the RNA agent targeting MAPT in a subject (e.g., a subject having or diagnosed with a disease associated with expression of tau or a neurological disorder described herein (e.g., a tauopathy)).

[0712] I. Composition

[0713] According to the present disclosure, there is provided a composition for delivering a functional RNA agent for targeting MAPT by adeno-associated virus particles (AAV), for example, AAV particles comprising AAV capsid polypeptides. In some embodiments, a kind of AAV particles (for example, AAV particles comprising AAV capsid polypeptides as described herein) or a variety of particles can be provided (for example, delivered) in vivo, ex vivo or in vitro to a cell, tissue, organ or organism via any one of several routes of administration (for example, via intravenous administration).

[0714] Adeno-associated virus (AAV) and AAV particles

[0715] Described herein, inter alia, are compositions comprising isolated, eg, recombinant, viral particles, eg, AAV particles, for delivery, eg, vectored delivery, of polynucleotides, eg, siRNA targeting MAPT, and methods of making and using the same.

[0716] In some embodiments, adeno-associated viruses (AAVs) comprise smaller, non-enveloped, icosahedral capsid viruses of the Parvoviridae family and are characterized by a single-stranded DNA viral genome. Parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication", Chapter 69 (3rd ed. 1996) in FIELDSVIROLOGY, the contents of which are incorporated by reference in their entirety. In some embodiments, AAVs are capable of replicating in vertebrate hosts, including but not limited to humans, primates, cattle, dogs, horses, and sheep species.

[0717] In some embodiments, AAV particles are used as biological tools because of their relatively simple structure and their ability to infect a wide range of cells (including resting and dividing cells) without integrating into the host genome and without replicating, as well as their relatively benign immunogenicity characteristics. The viral genome can be manipulated to contain the minimum components for assembling functional recombinant viruses or viral particles that are loaded with the desired payload or engineered to target specific tissues and express or deliver the desired payload, such as a polynucleotide encoding a siRNA for targeting MAPT.

[0718] In some embodiments, AAV particles are naturally occurring (e.g., wild-type) AAV or recombinant AAV. In some embodiments, the wild-type AAV viral genome is a linear single-stranded DNA (ssDNA) molecule of approximately 5,000 nucleotides (nt) in length. In some embodiments, inverted terminal repeats (ITRs) cap the viral genome at the 5' end and 3' end, thereby providing a replication origin for the viral genome. In some embodiments, the AAV viral genome typically comprises two ITR sequences. These ITRs have a characteristic T-shaped hairpin structure, defined by the self-complementary regions (145nt in wild-type AAV) at the 5' end and 3' end of ssDNA, forming an energy-stable double-stranded region. The double-stranded hairpin structure comprises multiple functions, including but not limited to serving as a starting point for DNA replication by serving as a primer for the endogenous DNA polymerase complex of the host virus replication cell.

[0719] In some embodiments, an AAV particle (e.g., an AAV particle described herein (e.g., ssAAV)) comprises a self-complementary viral genome. In some embodiments, ssAAV comprises nucleic acid molecules, e.g., DNA strands, that are ligated together to form double-stranded DNA. In some embodiments, scAAV allows for rapid expression in transduced cells because it bypasses second strand synthesis.

[0720] In some embodiments, the wild-type AAV viral genome further comprises the nucleotide sequence of two open reading frames, one for four nonstructural Rep proteins (Rep78, Rep68, Rep52, Rep40, encoded by the Rep gene), and one for three capsid or structural proteins (VP1, VP2, VP3, encoded by the capsid gene or Cap gene). Rep proteins are used for replication and packaging, while capsid proteins are assembled to produce the protein shell of AAV or AAV capsid polypeptides (e.g., AAV capsid variants). Selective splicing and alternate start codons and promoters result in the production of four different Rep proteins by a single open reading frame, and the production of three capsid proteins by a single open reading frame. Although it varies depending on the AAV serotype, as a non-limiting example, for AAV9 (SEQ ID NO: 138), VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. In other words, VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. As a result, the changes in the sequence in the VP3 region are also changes in VP1 and VP2. However, the percentage difference of VP3 is the largest compared to the parent sequence because it is the shortest sequence of the three sequences. Although described herein with respect to amino acid sequences, the nucleic acid sequences encoding these proteins can be described similarly. In summary, the three capsid proteins are assembled together to produce "AAV capsids." Although not wishing to be bound by theory, AAV capsid proteins typically comprise VP1:VP2:VP3 in a molar ratio of 1:1:10. In some embodiments, the viral genome of wild-type (e.g., naturally occurring) AAV can be modified so that the rep / cap sequence is replaced with a nucleic acid comprising a transgene encoding a payload (e.g., an antibody molecule), wherein the genetic assembly comprises at least one ITR region. In some embodiments, the viral genome of the recombinant AAV comprises two ITR regions, e.g., 5' ITR or 3' ITR. In some embodiments, the rep / cap sequence can be provided in trans during production to produce AAV particles. In some embodiments, the viral genome of AAV is contained in an AAV vector, wherein the viral genome further encodes a capsid protein, such as a structural protein, wherein the capsid protein comprises a VP1 polypeptide, a VP2 polypeptide and / or a VP3 polypeptide; and / or a Rep protein, such as a non-structural protein, wherein the Rep protein comprises a Rep78 protein, a Rep68, a Rep52 protein and / or a Rep40 protein.

[0721] In some embodiments, the AAV particles of the present disclosure are recombinant AAV particles that are replication-defective and lack nucleotide sequences encoding functional Rep and Cap proteins. In some embodiments, these defective AAV particles may lack most or all of the parental coding sequences and carry only one or two AAV ITR sequences and a nucleic acid of interest for delivery to a cell, tissue, organ, or organism.

[0722] Methods for producing and / or modifying AAV particles, such as pseudotyped AAV particles, are disclosed in the art (PCT Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO2005005610; and WO2005072364, the contents of each of which are herein incorporated by reference in their entirety).

[0723] As described herein, the AAV particles of the present disclosure comprising AAV capsid polypeptides and viral genomes can provide (e.g., deliver) transgenes to cells (e.g., mammalian cells and / or subjects). In some embodiments, the recombinant AAV particles of the present disclosure can vectorize delivery of siRNA (e.g., siRNA for targeting MAPT).

[0724] AAV capsid and its variants

[0725] In some embodiments, an AAV particle (eg, an AAV particle used for vectored delivery of an siRNA described herein (eg, an siRNA for targeting MAPT)) can comprise an AAV capsid polypeptide, such as an AAV capsid variant.

[0726] In some embodiments, after intravenous administration, AAV capsid polypeptides (such as AAV capsid variants) allow penetration of the blood-brain barrier. In some embodiments, after focused ultrasound (FUS), such as FUS combined with microbubble intravenous administration (FUS-MB), or MRI-guided FUS combined with intravenous administration, AAV capsids (such as AAV capsid variants) allow penetration of the blood-brain barrier. In some embodiments, AAV capsids (such as AAV capsid variants) allow increased distribution to brain regions. In some embodiments, brain regions include frontal cortex, sensory cortex, motor cortex, caudate nucleus, dentate nucleus, cerebellar cortex, cerebral cortex, brainstem, hippocampus, thalamus, putamen, or a combination thereof. In some embodiments, AAV capsids (such as AAV capsid variants) allow preferential transduction in brain regions relative to transduction in dorsal root ganglia (DRG).

[0727] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) allows for increased distribution to the spinal cord region. In some embodiments, the spinal cord region comprises the cervical spinal cord region, the thoracic spinal cord region, and / or the lumbar spinal cord region.

[0728] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises a VOY101 capsid polypeptide, a PHPeB capsid polypeptide, an AAVPHP.B (PHP.B) capsid polypeptide, an AAVPHP.N (PHP.N) capsid polypeptide, an AAV1 capsid polypeptide, an AAV2 capsid polypeptide, an AAV5 capsid polypeptide, an AAV9 capsid polypeptide, an AAV9 K449R capsid polypeptide, an AAVrh10 capsid polypeptide, or a functional variant thereof. In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises the amino acid sequence of any one of the AAV capsid polypeptides in Table 1, or an amino acid sequence having substantial identity thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the nucleotide sequence encoding the AAV capsid polypeptide comprises any one of the nucleotide sequences in Table 1, or a nucleotide sequence having substantial identity thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity).

[0729] Table 1: Exemplary full-length capsid sequences

[0730]

[0731]

[0732]

[0733]

[0734]

[0735]

[0736]

[0737]

[0738]

[0739]

[0740]

[0741]

[0742]

[0743]

[0744] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises the amino acid sequence of any one of SEQ ID NOs: 1, 3, 11, 138, 12, 13, 14, 16, 18, 20, 5147, 3636, or an amino acid sequence having substantial identity thereto (e.g., at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions relative to the amino acid sequence of any one of SEQ ID NOs: 1, 3, 11, 138, 12, 13, 14, 16, 18, 20, or 3636. In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence encoded by the nucleotide sequence of any one of SEQ ID NOs: 137, 15, 17, 19, 21, 3623, or a nucleotide sequence having substantial identity thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity).

[0745] In some embodiments, the nucleotide sequence encoding an AAV capsid polypeptide (e.g., an AAV capsid variant) comprises the nucleotide sequence of any one of SEQ ID NOs: 137, 15, 17, 19, 21, 5148, or 3623, or a nucleotide sequence having substantial identity thereto (e.g., at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the nucleotide sequence encoding an AAV capsid polypeptide (e.g., an AAV capsid variant) comprises a nucleotide sequence comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the nucleotide sequence of any one of SEQ ID NOs: 137, 15, 17, 19, 21, or 3623.

[0746] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises the amino acid sequence of SEQ ID NO: 138, or an amino acid sequence having substantial identity thereto (e.g., at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137, or a nucleotide sequence having substantial identity thereto (e.g., at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the nucleotide sequence encoding the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises the nucleotide sequence of SEQ ID NO: 137, or a nucleotide sequence having substantial identity thereto (e.g., at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises a substitution at position K449, e.g., a K449R substitution, numbered according to SEQ ID NO: 138.

[0747] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises the amino acid sequence of SEQ ID NO: 11, or an amino acid sequence having substantial identity thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 11, optionally wherein position 449 is not R.

[0748] In some embodiments, the capsid polypeptide comprises the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having substantial identity thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 1.

[0749] In some embodiments, the capsid polypeptide comprises the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence having substantial identity thereto (e.g., at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 3.

[0750] In some embodiments, the capsid polypeptide comprises the amino acid sequence of SEQ ID NO: 5147, or an amino acid sequence having substantial identity thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but not more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 5147.

[0751] In some embodiments, the AAV capsid variants disclosed herein comprise modifications in loop VIII of AAV9, e.g., at positions between 580-599, e.g., positions 587, 588, 589, and / or 590, numbered relative to SEQ ID NOs: 5, 8, 138, or 3636-3647. In some embodiments, loops (e.g., loop VIII) are used interchangeably herein with the terms variable region (e.g., variable region VIII) or VR (e.g., VR-VIII). In some embodiments, loop VIII comprises positions 580-599 numbered according to SEQ ID NO: 138 (e.g., amino acids VATNHQSAQAQAQTGWVQNQ (SEQ ID NO: 1195)). In some embodiments, loop VIII comprises positions 582-593 numbered according to SEQ ID NO: 138 (e.g., amino acids TNHQSAQAQAQT (SEQ ID NO: 1196)). In some embodiments, loop VIII comprises positions 587-593 numbered according to SEQ ID NO: 138 (e.g., amino acids AQAQAQT (SEQ ID NO: 1197)). In some embodiments, loop VIII comprises positions 587-590 numbered according to SEQ ID NO: 138 (e.g., amino acids AQAQ (SEQ ID NO: 5026)). In some embodiments, loop VIII or variable region VIII (VR-VIII) is as described in DiMattia et al., "Structural Insights into the Unique Properties of the Adeno-Associated Virus Serotype 9", Journal of Virology, 12(86): 6947-6958, the contents of which are hereby incorporated by reference in their entirety, e.g., comprises positions 581-593 numbered according to SEQ ID NO: 138 (e.g., ATNHQSAQAQAQT (SEQ ID NO: 1198)).

[0752] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262). In some embodiments, the peptide is present immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the capsid polypeptide comprises the amino acid substitutions A587D and Q588G, numbered according to SEQ ID NO: 138.

[0753] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid substitution of K449R, numbered according to SEQ ID NO: 138; and a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), wherein the peptide is present immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138.

[0754] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid substitution of K449R, numbered according to SEQ ID NO: 138; a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), wherein the insert is present immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138; and amino acid substitutions of A587D and Q588G, numbered according to SEQ ID NO: 138.

[0755] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), wherein the insertion is present immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138; and amino acid substitutions A587D and Q588G numbered according to SEQ ID NO: 138.

[0756] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises at least 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids from the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648). In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648); an amino acid sequence comprising at least one, two, or three, but not more than four modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions relative to the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648); or an amino acid sequence comprising at least one, two, or three, but not more than four different amino acids relative to the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), optionally wherein position 7 is H. In some embodiments, the amino acid sequence is present in loop VIII. In some embodiments, the amino acid sequence is present immediately after position 586 relative to the reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the amino acid sequence replacement position replaces positions 587 and 588 (e.g., A587 and Q588), numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence occurs immediately after position 586 and replaces positions 587 and 588 (e.g., A587 and Q588), numbered according to SEQ ID NO: 138.

[0757] In some embodiments, 3 consecutive amino acids comprise PLN. In some embodiments, 4 consecutive amino acids comprise PLNG (SEQ ID NO: 3678). In some embodiments, 5 consecutive amino acids comprise PLNGA (SEQ ID NO: 3679). In some embodiments, 6 consecutive amino acids comprise PLNGAV (SEQ ID NO: 3680). In some embodiments, 7 consecutive amino acids comprise PLNGAVH (SEQ ID NO: 3681). In some embodiments, 8 consecutive amino acids comprise PLNGAVHL (SEQ ID NO: 3682). In some embodiments, 9 consecutive amino acids comprise PLNGAVHLY (SEQ ID NO: 3648).

[0758] In some embodiments, four consecutive amino acids comprise NGAV (SEQ ID NO: 3683). In some embodiments, four consecutive amino acids comprise GAVH (SEQ ID NO: 3684). In some embodiments, five consecutive amino acids comprise NGAVH (SEQ ID NO: 3685). In some embodiments, five consecutive amino acids comprise GAVHL (SEQ ID NO: 3686). In some embodiments, five consecutive amino acids comprise AVHLY (SEQ ID NO: 3687). In some embodiments, six consecutive amino acids comprise NGAVHL (SEQ ID NO: 3688). In some embodiments, six consecutive amino acids comprise NGAVHLY (SEQ ID NO: 3689).

[0759] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) (e.g., an AAV capsid variant described herein) comprises an amino acid sequence encoded by a nucleotide sequence of CCGCTTAATGGTGCCGTCCA TCTTTAT (SEQ ID NO: 3660), or a nucleotide sequence having substantial identity thereto (e.g., at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid (e.g., an AAV capsid variant described herein) comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than ten modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the nucleotide sequence of CCGCTTAATGGTGCCGTCCATCTTTAT (SEQ ID NO: 3660). In some embodiments, an AAV capsid polypeptide (e.g., an AAV capsid variant) (e.g., an AAV capsid variant described herein) comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of CCGCTTAATGGTGCCGTCCATCTTTAT (SEQ ID NO: 3660).

[0760] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises amino acid P at position 587, amino acid L at position 588, and the amino acid sequence NGAVHLY (SEQ ID NO: 3689) (which occurs immediately after position 588), corresponding to SEQ ID NO: 3636, or numbered according to it.

[0761] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) (e.g., an AAV capsid variant described herein) comprises the amino acid sequence of SEQ ID NO: 3636, or an amino acid sequence having at least 80% (e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto. In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) (e.g., an AAV capsid variant described herein) comprises the amino acid sequence of SEQ ID NO: 3636, or an amino acid sequence having at least 95% identity thereto. In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) (e.g., an AAV capsid variant described herein) comprises the amino acid sequence of SEQ ID NO: 3636, or an amino acid sequence having at least 99% identity thereto.

[0762] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) (e.g., an AAV capsid variant described herein) comprises an amino acid sequence comprising at least one, two, or three modifications, substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20, or 10 modifications, substitutions (e.g., conservative substitutions), insertions, or deletions relative to the amino acid sequence of SEQ ID NO: 3636. In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) (e.g., an AAV capsid variant described herein) comprises an amino acid sequence comprising at least one, two, or three, but not more than 30, 20, or 10 different amino acids relative to the amino acid sequence of SEQ ID NO: 3636.

[0763] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence corresponding to positions 138-743 of SEQ ID NO: 3636, e.g., VP2, or a sequence having at least 80% (e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto. In some embodiments, the AAV capsid variant comprises an amino acid sequence corresponding to positions 203-743 of SEQ ID NO: 3636, e.g., VP3, or a sequence having at least 80% (e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto. In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence corresponding to positions 138-736 of SEQ ID NO: 138, e.g., VP2, or a sequence having at least 80% (e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto. In some embodiments, the AAV capsid variant comprises an amino acid sequence corresponding to positions 203-736 of SEQ ID NO: 138, e.g., VP3, or a sequence having at least 80% (e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto. In some embodiments, the amino acid sequence is present immediately after position 586, numbered according to either SEQ ID NO: 138 or 3636, optionally wherein the amino acids replace positions 587 and 588 (e.g., A587 and Q588), numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO:3636.

[0764] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises one or two, but no more than three different amino acids (e.g., substitutions, e.g., conservative substitutions) relative to the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), wherein the AAV capsid variant comprises (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or 3636; (b) a VP2 protein comprising the amino acid sequence of positions 138-736 of SEQ ID NO: 138 or positions 138-743 of SEQ ID NO: 5, 8, or 3636; (c) a VP3 protein comprising the amino acid sequence of positions 203-736 of SEQ ID NO: 138 or positions 203-743 of SEQ ID NO: 5, 8, or 3636; or (d) an amino acid sequence having at least 90% (e.g., at least about 95%, 96%, 97%, 98%, or 99%) sequence identity to any one of the amino acid sequences in (a)-(c). In some embodiments, the amino acid sequence occurs immediately after position 586, as numbered by either SEQ ID NO: 138 or 3636, optionally wherein the amino acids replace positions 587 and 588 (e.g., A587 and Q588), as numbered by SEQ ID NO: 138. In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO: 3636.

[0765] In some embodiments, the AAV capsid polypeptide (e.g., AAV capsid variant) comprises one or two, but no more than three different amino acids (e.g., substitutions, e.g., conservative substitutions) relative to the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), wherein the AAV capsid variant comprises the amino acid sequence of any one of SEQ ID NOs: 5, 8, 138, or 3636, or an amino acid sequence having at least 90% (e.g., at least about 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 3636. In some embodiments, the amino acid sequence occurs immediately after position 586, as numbered by any one of SEQ ID NOs: 138 or 3636, optionally wherein amino acids replace positions 587 and 588 (e.g., A587 and Q588), as numbered by SEQ ID NO: 138. In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO: 3636.

[0766] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence comprising at least 5, 6, 7, 8, or 9 consecutive amino acids from the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), wherein: (i) 5 consecutive amino acids comprise PLNGA (SEQ ID NO: 3679); (ii) 6 consecutive amino acids comprise PLNGAV (SEQ ID NO: 3680); (iii) 7 consecutive amino acids comprise PLNGAVH (SEQ ID NO: 3681); (iv) 8 consecutive amino acids comprise PLNGAVHL (SEQ ID NO: 3682); or (v) 9 consecutive amino acids comprise PLNGAVHLY (SEQ ID NO: 3648), wherein the AAV capsid variant comprises: (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or SEQ ID NO: 3636; (b) a VP1 protein comprising positions 138-736 of SEQ ID NO: 138 or SEQ ID NO: 3637. (c) a VP2 protein comprising the amino acid sequence of positions 138-743 of SEQ ID NO: 3636; (c) a VP3 sequence comprising the amino acid sequence of positions 203-736 of SEQ ID NO: 138 or positions 203-743 of SEQ ID NO: 3636; or (d) an amino acid sequence having at least 90% (e.g., at least about 95%, 96%, 97%, 98%, or 99%) sequence identity to any of the amino acid sequences in (a)-(c). In some embodiments, the amino acid sequence occurs immediately after position 586, as numbered by either SEQ ID NO: 138 or 3636, optionally wherein the amino acids replace positions 587 and 588 (e.g., A587 and Q588), as numbered by SEQ ID NO: 138. In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO: 3636.

[0767] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant) comprises an amino acid sequence comprising at least 5, 6, 7, 8, or 9 consecutive amino acids from the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), wherein: (i) 5 consecutive amino acids comprise PLNGA (SEQ ID NO: 3679); (ii) 6 consecutive amino acids comprise PLNGAV (SEQ ID NO: 3680); (iii) 7 consecutive amino acids comprise PLNGAVH (SEQ ID NO: 3681); (iv) 8 consecutive amino acids comprise PLNGAVHL (SEQ ID NO: 3682); or (v) 9 consecutive amino acids comprise PLNGAVHLY (SEQ ID NO: 3648), wherein the AAV capsid variant comprises the amino acid sequence of any one of SEQ ID NOs: 5, 8, or 3636, or a sequence identical to SEQ ID NO: 3637. In some embodiments, the amino acid sequence comprises an amino acid sequence having at least 90% (e.g., at least about 95%, 96%, 97%, 98%, or 99%) sequence identity to any of SEQ ID NOs: 138 or 3636. In some embodiments, the amino acid sequence occurs immediately after position 586, as numbered according to any of SEQ ID NOs: 138 or 3636, optionally wherein the amino acids replace positions 587 and 588 (e.g., A587 and Q588), as numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence corresponds to positions 587-595 of SEQ ID NO: 3636.

[0768] In some embodiments, the nucleotide sequence encoding an AAV capsid polypeptide (e.g., an AAV capsid variant described herein) comprises the nucleotide sequence of SEQ ID NO: 3623, or a nucleotide sequence having at least 80% (e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto. In some embodiments, the nucleotide sequence encoding an AAV capsid variant comprises a nucleotide sequence comprising at least one, two, or three modifications, e.g., substitutions, insertions, or deletions, but not more than 30, 20, or 10 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 3623. In some embodiments, the nucleotide sequence encoding an AAV capsid variant comprises a nucleotide sequence comprising at least one, two, or three, but not more than 30, 20, or 10 different nucleotides relative to the nucleotide sequence of SEQ ID NO: 3623. In some embodiments, the nucleic acid sequence encoding an AAV capsid polypeptide (e.g., an AAV capsid variant described herein) is codon-optimized.

[0769] In some embodiments, the AAV capsid polypeptide (e.g., an AAV capsid variant described herein) has increased tropism for CNS cells or tissues (e.g., brain cells, brain tissue, spinal cord cells, or spinal cord tissue) relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 138.

[0770] In some embodiments, the AAV capsid polypeptides (e.g., AAV capsid variants) of the present disclosure have reduced tropism for the liver. In some embodiments, the AAV capsid variants comprise modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, which result in reduced tropism (e.g., detargeting) and / or reduced activity in the liver. In some embodiments, the reduced tropism in the liver is compared to an otherwise similar capsid (e.g., a wild-type capsid polypeptide) that does not comprise the modification. In some embodiments, the described AAV capsid variants comprise modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, that result in one or more of the following properties: (1) reduced tropism in the liver; (2) detargeting of expression in the liver; (3) reduced activity in the liver; and / or (4) reduced binding to galactose. In some embodiments, the reduction in any one or all of properties (1)-(3) is compared to an otherwise similar AAV capsid variant that does not comprise the modification. Exemplary modifications are provided in WO2018 / 119330; Pulicherla et al. (2011) Mol. Ther. 19(6): 1070-1078; Adachi et al. (2014) Nature Communications 5(3075), DOI: 10.1038 / ncomms4075; and Bell et al. (2012) J. Virol. 86(13): 7326-33; the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the AAV capsid variant comprises a modification, e.g., a substitution (e.g., a conservative substitution), an insertion, or a deletion, at position N470 (e.g., N470A), D271 (e.g., D271A), N272 (e.g., N272A), Y446 (e.g., Y446A), N498 (e.g., N498Y or N498I), W503 (e.g., W503R or W503A), L620 (e.g., L620F), or a combination thereof, relative to the reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises one, two, three, four, five, or all of the following, relative to the reference sequence numbered according to SEQ ID NO: 138: an amino acid other than N at position 470 (e.g., A), an amino acid other than D at position 271 (e.g., A), an amino acid other than N at position 272 (e.g., A), an amino acid other than Y at position 446 (e.g., A), and an amino acid other than N at position 498 (e.g., Y or I), an amino acid other than W at position 503 (e.g., R or A), and an amino acid other than L at position 620 (e.g., F).In some embodiments, the AAV capsid variant comprises modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, at positions N470 (e.g., N470A), D271 (e.g., D271A), N272 (e.g., N272A), Y446 (e.g., Y446A), and W503 (e.g., W503R or W03A), relative to the reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, at positions N498 (e.g., N498Y) and L620 (e.g., L620F).

[0771] In some embodiments, the AAV capsid variants encompassed herein comprise modifications as described in Adachi et al. (2014) Nature Communications 5(3075), DOI: 10.1038 / ncomms4075, the contents of which are hereby incorporated by reference in their entirety. Exemplary modifications that do or do not alter tissue transduction in at least the brain, liver, heart, lung, and / or kidney can be found in Supplementary Data 2, which shows AAV Barcode-Seq data obtained using the AAV 9-AA-VB CLib of Adachi et al. (supra), the contents of which are hereby incorporated by reference in their entirety.

[0772] In some embodiments, the AAV capsid polypeptides (e.g., AAV capsid variants) of the present disclosure are isolated, e.g., recombinant. In some embodiments, the polynucleotides encoding the AAV capsid polypeptides (e.g., AAV capsid variants) of the present disclosure are isolated, e.g., recombinant.

[0773] The present disclosure relates to structural capsid proteins (including VP1, VP2 and VP3) encoded by capsid (Cap) genes. These capsid proteins form the outer protein structural shell (i.e., capsid) of viral vectors (such as AAV). The VP capsid proteins synthesized by Cap polynucleotides generally contain methionine as the first amino acid (Met1) in the peptide sequence, which is associated with the start codon (AUG or ATG) in the corresponding Cap nucleotide sequence. However, after or during polypeptide synthesis, the first methionine (Met1) residue or generally any first amino acid (AA1) will be cut off by protein processing enzymes (such as Met-aminopeptidases). This "Met / AA cleavage" process is generally associated with the corresponding acetylation of the second amino acid (e.g., alanine, valine, serine, threonine, etc.) in the polypeptide sequence. Met cleavage typically occurs on VP1 and VP3 capsid proteins, but may also occur on VP2 capsid protein.

[0774] In the case of incomplete Met / AA cleavage, a mixture of one or more (one, two or three) VP capsid proteins comprising the viral capsid may be produced, some of which may contain Met1 / AA1 amino acids (Met+ / AA+) and others of which may lack Met1 / AA1 amino acids due to Met / AA cleavage (Met- / AA-). For further discussion of Met / AA cleavage in capsid proteins, see Jin, et al. Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins. Hum Gene Ther Methods. October 2017. 28(5): 255-267; Hwang, et al. N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. February 19, 2010. 327(5968): 973–977; the contents of each of these documents are incorporated herein by reference in their entirety.

[0775] According to the present disclosure, reference to a capsid protein is not limited to cleaved (Met- / AA-) or uncleaved (Met+ / AA+), and in the context, may refer to an independent capsid protein, a viral capsid composed of a mixture of capsid proteins, and / or a polynucleotide sequence (or a fragment thereof) that encodes, describes, produces, or results in the capsid protein of the present disclosure. Direct reference to a "capsid protein" or "capsid polypeptide" (such as VP1, VP2, or VP2) may also encompass a VP capsid protein comprising Met1 / AA1 amino acids (Met+ / AA+) as well as a corresponding VP capsid protein that lacks Met1 / AA1 amino acids due to Met / AA cleavage (Met- / AA-).

[0776] Further in accordance with the present disclosure, reference to a particular SEQ ID NO: (whether protein or nucleic acid) comprising or encoding one or more capsid proteins comprising Met1 / AA1 amino acids (Met+ / AA+) should be understood to teach VP capsid proteins lacking Met1 / AA1 amino acids, since upon inspection of the sequences, it is readily apparent that any sequence lacks only the first listed amino acid (whether Met1 / AA1 or not).

[0777] As a non-limiting example, a reference to a VP1 polypeptide sequence that is 736 amino acids in length and includes the "Met1" amino acid (Met+) encoded by the AUG / ATG start codon can also be understood to teach a VP1 polypeptide sequence that is 735 amino acids in length and does not include the "Met1" amino acid (Met-) of the 736 amino acid Met+ sequence. As a second non-limiting example, a reference to a VP1 polypeptide sequence that is 736 amino acids in length and includes the "AA1" amino acid (AA1+) encoded by any NNN start codon can also be understood to teach a VP1 polypeptide sequence that is 735 amino acids in length and does not include the "AA1" amino acid (AA1-) of the 736 amino acid AA1+ sequence.

[0778] Reference to a viral capsid formed by a VP capsid protein (such as reference to a specific AAV capsid serotype) may include a VP capsid protein comprising Met1 / AA1 amino acids (Met+ / AA1+), the corresponding VP capsid protein lacking Met1 / AA1 amino acids due to Met / AA1 cleavage (Met- / AA1-), and combinations thereof (Met+ / AA1+ and Met- / AA1-).

[0779] As non-limiting examples, an AAV capsid serotype may include VP1 (Met+ / AA1+), VP1 (Met- / AA1-), or a combination of VP1 (Met+ / AA1+) and VP1 (Met- / AA1-). An AAV capsid serotype may also include VP3 (Met+ / AA1+), VP3 (Met- / AA1-), or a combination of VP3 (Met+ / AA1+) and VP3 (Met- / AA1-); and may also include similar, optionally present, combinations of VP2 (Met+ / AA1) and VP2 (Met- / AA1-).

[0780] Also provided herein are polynucleotide sequences encoding any of the AAV capsid variants described above, and AAV particles, vectors, and cells comprising the sequences.

[0781] viral genome

[0782] In some aspects, an AAV particle of the present disclosure, e.g., an AAV particle comprising an AAV capsid polypeptide (e.g., an AAV capsid variant described herein), comprises a viral genome encoding an agent for targeting MAPT (e.g., an siRNA duplex for targeting MAPT or a regulatory polynucleotide encoding an siRNA duplex for targeting MAPT).

[0783] In some embodiments, AAV particles comprising AAV capsid polypeptides described herein (e.g., AAV capsid variants described herein) can be used to deliver viral genomes to tissues (e.g., CNS, DRG, and / or muscle). In some embodiments, AAV particles comprising AAV capsid polypeptides described herein (e.g., AAV capsid variants) can be used to deliver viral genomes to tissues or cells, such as CNS, DRG, or muscle cells or tissues. In some embodiments, the AAV particles of the present disclosure are recombinant AAV particles. In some embodiments, the AAV particles of the present disclosure are isolated AAV particles.

[0784] In some embodiments, the AAV particles described herein are used to deliver an agent that targets MAPT (eg, a MAPT-targeting siRNA duplex or a regulatory polynucleotide encoding a siRNA duplex) to cells of the CNS following intravenous delivery.

[0785] In some embodiments, the viral genome of the AAV particles comprising an AAV capsid polypeptide (e.g., an AAV capsid variant as described herein) comprises a nucleic acid comprising a transgene encoding an agent targeting MAPT (e.g., a MAPT targeting siRNA duplex or a regulatory polynucleotide encoding an siRNA duplex (e.g., an siRNA duplex for targeting MAPT)). In some embodiments, the viral genome comprises an inverted terminal repeat (ITR) sequence. In some embodiments, the viral genome comprises two ITR sequences, e.g., one at the 5' end of the viral genome (e.g., 5' relative to the coded payload) and the other at the 3' end of the viral genome (e.g., 3' relative to the coded payload). In some embodiments, the viral genome of the AAV particles described herein (e.g., comprising the AAV capsid variants described herein) may include a regulatory element (e.g., a promoter), an untranslated region (UTR), a miR binding site, a polyadenylation sequence (polyA), a filler (filler / stuffer) sequence, an intron, and / or a linker sequence, e.g., for enhancing transgene expression.

[0786] In some embodiments, viral genomic components are selected and / or engineered to express an agent (e.g., a MAPT-targeting siRNA duplex or a regulatory polynucleotide encoding a siRNA duplex (e.g., a siRNA duplex for targeting MAPT)) for targeting MAPT in a target tissue (e.g., a CNS tissue, such as brain tissue or spinal cord tissue) or a target cell (e.g., a CNS cell, such as a brain cell or a spinal cord cell).

[0787] Viral genome components: Inverted terminal repeats (ITRs)

[0788] In some embodiments, the viral genome comprises an ITR and a transgene encoding a payload. In some embodiments, the viral genome comprises two ITRs. In some embodiments, the two ITRs flank the nucleotide sequence encoding the payload at the 5' and 3' ends. In some embodiments, the ITRs serve as origins of replication comprising recognition sites for replication. In some embodiments, the ITRs comprise regions of sequences that are complementary and symmetrically arranged. In some embodiments, the ITRs incorporated into the viral genome as described herein may comprise naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.

[0789] In some embodiments, the ITR may have the same serotype as a capsid polypeptide (e.g., a capsid variant) or a variant thereof selected from any one of the known serotypes. In some embodiments, the serotype of the ITR may be different from that of the capsid. In one embodiment, the viral genome comprises two ITR sequence regions, wherein the ITRs have the same serotype as each other. In another embodiment, the viral genome comprises two ITR sequence regions, wherein the ITRs have different serotypes. Non-limiting examples include zero, one, or two ITRs having the same serotype as the capsid. In one embodiment, both ITRs of the viral genome of the AAV particle are AAV2 ITRs.

[0790] In some embodiments, the ITR comprises the nucleotide sequence of SEQ ID NO: 5197, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the ITR comprises the nucleotide sequence of SEQ ID NO: 5200, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the AAV viral genome comprises an ITR comprising the nucleotide sequence of SEQ ID NO: 5197, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto, and an ITR comprising the nucleotide sequence of SEQ ID NO: 5200, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0791] In some embodiments, the ITR comprises the nucleotide sequence of SEQ ID NO: 4469, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the ITR comprises the nucleotide sequence of SEQ ID NO: 4470, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto. In some embodiments, the AAV viral genome comprises an ITR comprising the nucleotide sequence of SEQ ID NO: 4469, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto, and an ITR comprising the nucleotide sequence of SEQ ID NO: 4470, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0792] Viral genome components: promoters

[0793] In some embodiments, the viral genome comprises at least one component that enhances payload target specificity and expression (see, e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are incorporated herein by reference in their entirety). Non-limiting examples of components that enhance payload target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers, and introns.

[0794] In some embodiments, an AAV particle comprising an AAV capsid variant described herein comprises a viral genome comprising a nucleic acid comprising a transgene encoding a payload, wherein the transgene is operably linked to a promoter. In some embodiments, the promoter is a species-specific promoter, an inducible promoter, a tissue-specific promoter, or a cell cycle-specific promoter (e.g., as described in Parr et al., Nat. Med. 3:1145-9 (1997); the contents of which are incorporated herein by reference in their entirety).

[0795] In some embodiments, the promoter may be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include those derived from viruses, plants, mammals, or humans. In some embodiments, the promoter may be those derived from human cells or systems. In some embodiments, the promoter may be truncated or mutated, such as a promoter variant.

[0796] In some embodiments, the promoter is a ubiquitin promoter, for example, capable of being expressed in a variety of tissues. In some embodiments, the promoter is a human elongation factor 1α-subunit (EF1α) promoter, cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken β-actin (CBA) promoter and its derivative CAG, β-glucuronidase (GUSB) promoter or ubiquitin C (UBC) promoter. In some embodiments, the promoter is a cell or tissue-specific promoter, for example, capable of being expressed in a tissue or cell of the central nervous system or peripheral nervous system, (e.g., frontal cortex) within a targeted area and / or a subset of cells therein (e.g., excitatory neurons). In some embodiments, the promoter is a cell type specific promoter capable of expressing the payload in excitatory neurons (e.g., glutamatergic), inhibitory neurons (e.g., GABAergic), neurons of the sympathetic or parasympathetic nervous system, sensory neurons, neurons of the dorsal root ganglion, motor neurons, or supporting cells of the nervous system such as microglia, glial cells, astrocytes, oligodendrocytes, and / or Schwann cells.

[0797] In some embodiments, the promoter is a liver-specific promoter (e.g., hAAT, TBG), a skeletal muscle-specific promoter (e.g., desmin, MCK, C512), a B cell promoter, a monocyte promoter, a leukocyte promoter, a macrophage promoter, a pancreatic acinar cell promoter, an endothelial cell promoter, a lung tissue promoter, and / or a cardiac or cardiovascular promoter (e.g., αMHC, cTnT, and CMV-MLC2k).

[0798] In some embodiments, the promoter is a tissue-specific promoter for expressing a payload in tissues or cells of the central nervous system. In some embodiments, the promoter is a synaptobrevin (Syn) promoter, a vesicular glutamate transporter (VGLUT) promoter, a vesicular GABA transporter (VGAT) promoter, a parvalbumin (PV) promoter, a sodium channel Na v 1.8 promoter, tyrosine hydroxylase (TH) promoter, acetylcholine converting enzyme (ChaT) promoter, methyl-CpG binding protein 2 (MeCP2) promoter, Ca 2+ / Calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light chain (NFL) or neurofilament heavy chain (NFH) promoter, neuron-specific enolase (NSE) promoter, β-globin minigene nβ2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter and excitatory amino acid transporter 2 (EAAT2) promoter or fragments thereof. In some embodiments, the promoter is a cell type-specific promoter capable of being expressed in astrocytes, such as the glial fibrillary acidic protein (GFAP) promoter and the EAAT2 promoter or fragments thereof. In some embodiments, the promoter is a cell type-specific promoter capable of being expressed in oligodendrocytes, such as the myelin basic protein (MBP) promoter or fragments thereof.

[0799] In some embodiments, the promoter is the GFAP promoter. In some embodiments, the promoter is the synapsin (syn or syn1) promoter or a fragment thereof.

[0800] In some embodiments, the promoter comprises a CBA promoter or a variant thereof, such as a functional variant thereof. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 5199, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto.

[0801] In some embodiments, the AAV viral genome comprises an enhancer. In some embodiments, the enhancer comprises a CMVie enhancer or a variant thereof. In some embodiments, the enhancer comprises a nucleotide sequence of SEQ ID NO: 4471, or a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% homogeneity therewith. In some embodiments, the enhancer comprises a nucleotide sequence of SEQ ID NO: 4472, or a nucleotide sequence with at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% homogeneity therewith.

[0802] In some embodiments, the AAV viral genome comprises an enhancer and a promoter. In some embodiments, the enhancer comprises a CMVie enhancer and the promoter comprises a CBA promoter. In some embodiments, the enhancer and the promoter comprise the nucleotide sequence of SEQ ID NO:4474, or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto.

[0803] In some embodiments, the promoter comprises the insulin promoter or a fragment thereof.

[0804] In some embodiments, the viral genome comprises a ubiquitin promoter. Non-limiting examples of ubiquitin promoters include CMV, CBA (including derivatives CAG, CB6, CBh, etc.), EF-1α, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3). In some embodiments, the viral genome comprises an EF-1α promoter or EF-1α promoter variant, such as provided in Table 2. In some embodiments, the EF-1α promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 1874-1889, or any one of the sequences provided in Table 40; a nucleotide sequence comprising at least one, two, or three, but not more than four modifications (e.g., substitutions) relative to the nucleotide sequence of SEQ ID NOs: 1874-1889, or any one of the sequences provided in Table 40; or a nucleotide sequence having at least 80% (e.g., 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity to any one of SEQ ID NOs: 1874-1889, or any one of the sequences provided in Table 2.

[0805] Table 2. Exemplary promoter variants

[0806]

[0807]

[0808]

[0809] Viral genome components: introns

[0810] In some embodiments, the viral genome comprises components that enhance payload target specificity and expression (see, e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, Discov. Med, 2015, 19(102): 49-57; the contents of which are incorporated herein by reference in their entirety), such as introns. Non-limiting examples of introns include MVM (67-97 bp), F.IX truncated intron 1 (300 bp), β-globulin SD / immunoglobulin heavy chain splice acceptor (250 bp), adenovirus splice donor / immunoglobulin splice acceptor (500 bp), SV40 late splice donor / splice acceptor (19S / 16S) (180 bp), and hybrid adenovirus splice donor / IgG splice acceptor (230 bp). In some embodiments, the intron comprises a human β-globulin intron or a variant thereof.

[0811] In some embodiments, the intron comprises the nucleotide sequence of SEQ ID NO: 4475, or a nucleotide sequence at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto.

[0812] Viral genome components: untranslated regions (UTRs)

[0813] In some embodiments, the wild-type untranslated region (UTR) of a gene is transcribed but not translated. Generally, the 5'UTR begins at the transcription start site and ends at the start codon, and the 3'UTR begins immediately after the stop codon and continues until the termination signal of transcription.

[0814] Features typically found in abundantly expressed genes in specific target organs can be engineered into the UTR to enhance stability and protein production. As a non-limiting example, the 5'UTR from an mRNA normally expressed in the liver (e.g., albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or Factor VIII) can be used in the viral genome of the AAV particles of the present disclosure to enhance expression in hepatocyte cell lines or the liver.

[0815] In some embodiments, the viral genome encoding the transgene described herein (e.g., a transgene encoding a GBA protein) comprises a Kozak sequence. Although not wishing to be bound by theory, the wild-type 5' untranslated region (UTR) includes features that play a role in translation initiation. Kozak sequences, which are generally known to be involved in the process of causing ribosomes to initiate translation of many genes, are often contained in the 5'UTR. The Kozak sequence has a consensus of CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), followed by another 'G'.

[0816] In some embodiments, the 5'UTR in the viral genome comprises a Kozak sequence.

[0817] In some embodiments, the 5'UTR in the viral genome does not contain a Kozak sequence.

[0818] Although not wishing to be bound by theory, it is known that wild-type 3'UTRs have segments of adenosine and uridine embedded within them. These AU-rich features are particularly prevalent in genes with high turnover rates. Based on their sequence characteristics and functional properties, AU-rich elements (AREs) can be divided into three classes (Chen et al., 1995, the contents of which are incorporated herein by reference in their entirety): Class I AREs, such as but not limited to c-Myc and MyoD, contain several dispersed copies of the AUUUA motif within a U-rich region. Class II AREs, such as but not limited to GM-CSF and TNF-α, have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Class III AREs, such as but not limited to c-Jun and myogenin, are less well defined. These U-rich regions do not contain the AUUUA motif. Most proteins known to bind to AREs destabilize the messenger, but members of the ELAV family, particularly HuR, have been shown to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3'UTR of a nucleic acid molecule will result in HuR binding, thereby achieving stabilization of the message in vivo.

[0819] The introduction, removal, or modification of 3'UTR AU-rich elements (AREs) can be used to modulate the stability of polynucleotides. When engineering specific polynucleotides, such as the payload region of a viral genome, one or more copies of AREs can be introduced to render the polynucleotide less stable, thereby reducing translation and reducing production of the resulting protein. Similarly, AREs can be identified and removed or mutated to increase intracellular stability, thereby increasing translation and production of the resulting protein.

[0820] In some embodiments, the 3'UTR of the viral genome may contain an oligo(dT) sequence for template addition of a poly-A tail.

[0821] Any UTR from any gene known in the art can be incorporated into the viral genome of the AAV particle. These UTRs or portions thereof can be placed in the same orientation as in the gene from which the UTR or portion thereof is selected, or the orientation or position of the UTR or portion thereof can be changed. In some embodiments, the UTR used in the viral genome of the AAV particle can be inverted, shortened, lengthened or made with one or more other 5'UTRs or 3'UTRs known in the art. As used herein, the term "alteration", when it relates to UTR, means that the UTR has been changed in some way relative to the reference sequence. For example, a 3'UTR or 5'UTR can be changed by a change in orientation or position as taught above relative to a wild-type or native UTR, or can be changed by comprising additional nucleotides, deleted nucleotides, exchanged or transposed nucleotides.

[0822] In some embodiments, the viral genome of the AAV particle comprises at least one artificial UTR that is not a variant of a wild-type UTR.

[0823] In some embodiments, the viral genome of the AAV particle comprises a UTR selected from a family of transcripts whose proteins share a common function, structure, characteristic, or property.

[0824] Viral genome components: miR binding sites

[0825] The tissue or cell-specific expression of the AAV viral particles of the present invention can be enhanced by introducing tissue or cell-specific regulatory sequences (e.g., promoters, enhancers, microRNA binding sites, such as de-targeting sites). Without wishing to be bound by theory, it is believed that the encoded miR binding site can regulate (e.g., prevent, curb or otherwise inhibit) the expression of the gene of interest on the viral genome of the present invention based on the expression of the corresponding endogenous microRNA (miRNA) or the corresponding controlled exogenous miRNA in the tissue or cell (e.g., non-targeted cell or tissue). In some embodiments, the miR binding site regulates (e.g., reduces) the expression of the payload encoded by the viral genome of the AAV particles described herein in cells or tissues expressing the corresponding mRNA. In some embodiments, the miR binding site regulates, for example, reduces the expression of the encoded GBA protein in cells or tissues of DRG, liver, hematopoietic lineage, or a combination thereof.

[0826] In some embodiments, the viral genome of the AAV particles described herein comprises a nucleotide sequence encoding a microRNA binding site (e.g., a de-targeting site). In some embodiments, the viral genome of the AAV particles described herein comprises a nucleotide sequence encoding a miR binding site, a microRNA binding site series (miR BS), or a reverse complement thereof.

[0827] In some embodiments, the nucleotide sequence encoding the miR binding site array or miR binding site is located in the 3'-UTR region of the viral genome (e.g., 3' relative to the nucleic acid sequence encoding the payload), e.g., before the polyA sequence, in the 5'-UTR region of the viral genome (e.g., 5' relative to the nucleic acid sequence encoding the payload), or both.

[0828] In some embodiments, the encoded miR binding site series comprises at least 1-5 copies of a miR binding site (miR BS), for example, at least 1-3, 2-4, 3-5, 1, 2, 3, 4, 5 or more copies. In some embodiments, the encoded miR binding site series comprises 4 copies of a miR binding site. In some embodiments, all copies are identical, for example, comprising the same miR binding site. In some embodiments, the miR binding sites within the encoded miR binding site series are continuous and not separated by spacers. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by spacers (e.g., non-coding sequences). In some embodiments, the length of the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, for example, about 7-8 nucleotides. In some embodiments, the length of the spacer is about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of the following: (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of GATAGTTA.

[0829] In some embodiments, the encoded miR binding site series comprises at least 1-5 copies of a miR binding site (miR BS), for example, at least 1-3, 2-4, 3-5, 1, 2, 3, 4, 5 or more copies. In some embodiments, at least 1, 2, 3, 4, 5 or all copies are different, for example, comprising different miR binding sites. In some embodiments, the miR binding sites within the encoded miR binding site series are continuous and not separated by spacers. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by spacers (e.g., non-coding sequences). In some embodiments, the length of the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, for example, about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of the following: (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of GATAGTTA.

[0830] In some embodiments, the encoded miR binding site has substantial identity (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity) to a miR in a host cell. In some embodiments, the encoded miR binding site comprises at least 1, 2, 3, 4 or 5 mismatches or no more than 6, 7, 8, 9 or 10 mismatches to a miR in a host cell. In some embodiments, the mismatched nucleotides are continuous. In some embodiments, the mismatched nucleotides are non-continuous. In some embodiments, the mismatched nucleotides occur outside the seed region binding sequence of the miR binding site, such as at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site has 100% identity to a miR in a host cell.

[0831] In some embodiments, the nucleotide sequence encoding the miR binding site is substantially complementary to a miR in the host cell (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% complementary). In some embodiments, the sequence complementary to the nucleotide sequence encoding the miR binding site comprises at least 1, 2, 3, 4 or 5 mismatches or no more than 6, 7, 8, 9 or 10 mismatches relative to the corresponding miR in the host cell. In some embodiments, the mismatched nucleotides are continuous. In some embodiments, the mismatched nucleotides are non-contiguous. In some embodiments, the mismatched nucleotides occur outside the seed region binding sequence of the miR binding site, such as at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site is 100% complementary to the miR in the host cell.

[0832] In some embodiments, the encoded miR binding site or the encoded set of miR binding sites is about 10 to about 125 nucleotides in length, e.g., about 10 to 50 nucleotides, 10 to 100 nucleotides, 50 to 100 nucleotides, 50 to 125 nucleotides, or 100 to 125 nucleotides in length. In some embodiments, the encoded miR binding site or the encoded set of miR binding sites is about 7 to about 28 nucleotides in length, e.g., about 8-28 nucleotides, 7-28 nucleotides, 8-18 nucleotides, 12-28 nucleotides, 20-26 nucleotides, 22 nucleotides, 24 nucleotides, or 26 nucleotides in length, and optionally comprises at least one continuous region (e.g., 7 or 8 nucleotides) that is complementary (e.g., fully or partially complementary) to a seed sequence of a miRNA (e.g., miR122, miR142, miR-1, miR183).

[0833] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in the liver or hepatocytes, such as miR122. In some embodiments, the encoded miR binding site or the encoded miR binding site series comprises a miR122 binding site sequence. In some embodiments, the encoded miR122 binding site comprises a nucleotide sequence of ACAAACACCATTGTCACACTCCA (SEQ ID NO: 1865), or relative to SEQ ID NO: 1865, there is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99% or 100% sequence identity, or a nucleotide sequence having at least one, two, three, four, five, six or seven modifications, but no more than ten modifications, for example, wherein the modification can result in a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, 4 or 5 copies of the encoded miR122 binding site (e.g., the encoded miR122 binding site series), optionally wherein the encoded miR122 binding site series comprises the nucleotide sequence: ACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCA (SEQ ID NO: 1866), or relative to SEQ ID NO: 1866, there is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99% or 100% sequence identity, or a nucleotide sequence having at least one, two, three, four, five, six or seven modifications, but not more than ten modifications, for example, wherein the modification can result in a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, at least two of the encoded miR122 binding sites are directly connected, for example, without a spacer. In other embodiments, at least two of the miR122 binding sites of the coding are separated by a spacer having a length of, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides, and the spacer is located between two or more consecutive miR122 binding site sequences of the coding. In embodiments, the length of the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, for example, about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of the following: (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repetition of one or more of (i)-(iii).In some embodiments, the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of GATAGTTA.

[0834] In some embodiments, the encoded miR binding site is complementary (e.g., fully or partially complementary) to a miR expressed in the heart. In embodiments, the encoded miR binding site or the encoded miR binding site set comprises a miR-1 binding site. In some embodiments, the encoded miR-1 binding site comprises a nucleotide sequence of ATACATACTTCTTTACATTCCA (SEQ ID NO: 5025); a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99% or 100% sequence identity relative to SEQ ID NO: 5025, or having at least one, two, three, four, five, six or seven modifications, but not more than ten modifications, for example, wherein the modifications result in a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 2, 3, 4 or 5 copies of the encoded miR-1 binding site, for example, the encoded miR-1 binding site series. In some embodiments, at least 2, 3, 4 or 5 copies (e.g., 2 or 3 copies) of the encoded miR-1 binding site are continuous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the length of the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, for example, about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of the following: (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii). In some embodiments, the spacer comprises a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two or three modifications of GATAGTTA, but not more than four modifications.

[0835] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in a hematopoietic lineage, including immune cells (e.g., antigen presenting cells or APCs, including dendritic cells (DCs), macrophages, and B-lymphocytes). In some embodiments, the encoded miR binding site that is complementary (e.g., fully complementary or partially complementary) to a miR expressed in a hematopoietic lineage comprises a nucleotide sequence disclosed, for example, in US 2018 / 0066279, the contents of which are incorporated herein by reference in their entirety.

[0836] In some embodiments, the encoded miR binding site or the encoded miR binding site set comprises a miR-142-3p binding site sequence. In some embodiments, the encoded miR-142-3p binding site comprises a nucleotide sequence of TCCATAAAGTAGGAAACACTACA (SEQ ID NO: 1869); a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identi...

Claims

1. A short interfering ribonucleic acid (siRNA) for inhibiting the expression of microtubule-associated protein tau (MAPT), the short interfering ribonucleic acid (siRNA) comprising a sense strand sequence and an antisense strand sequence, wherein: (i) the antisense strand sequence comprises at least 20 or 21 consecutive nucleotides of any one of SEQ ID NO: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104 or 5128; and (ii) the sense strand sequence comprises SEQ ID NO: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, at least 20 or 21 consecutive nucleotides of any one of 5014, 4910, 4930, 4950, 4970, 4990, 5010, 5077, 5084, 5088, 5092, 5096, 5098, 5101, 5108, 5112, 5116, 5120, 5122, 5125, 5132, 5136, 5140, 5144, or 5146; wherein the sense strand sequence and the antisense strand sequence comprise complementary regions of at least 15, 16, 17, 18, 19 or 20 nucleotides.

2. An adeno-associated virus (AAV) viral genome comprising a nucleotide sequence located between two inverted terminal repeats (ITRs), wherein the nucleotide sequence encodes an siRNA for inhibiting MAPT, wherein the siRNA comprises a sense strand sequence and an antisense strand sequence, wherein: (i) the antisense strand sequence comprises at least 19, 20 or 21 consecutive nucleotides of any one of SEQ ID NO: 4908, 4920, 4924, 5057, 4916, 4912, 5080, 5104 or 5128; and (ii) the sense strand sequence comprises SEQ ID NO: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 5054, 5060, 5064, 5066, 5070, 5074, 4914, 4934, 4954, 4974, 4994, 50 at least 19, 20, or 21 consecutive nucleotides of any one of 5140, 5144, or 5146; wherein the sense strand sequence and the antisense strand sequence comprise complementary regions of at least 15, 16, 17, 18, 19 or 20 nucleotides.

3. The siRNA according to claim 1, or the AAV viral genome according to claim 2, wherein: (i) the antisense strand comprises at least 20 consecutive nucleotides of any one of SEQ ID NOs: 4908, 4920, 4924, or 4912; and / or the sense strand comprises at least 20 consecutive nucleotides of any one of SEQ ID NOs: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010; (ii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4906, 4926, 4946, 4966, 4986, or 5006; (iii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4918, 4938, 4958, 4978, or 4998; (iv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4922, 4942, 4962, 4982, 5002, or 5022; (v) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4910, 4930, 4950, 4970, 4990, or 5010; (vi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 4914, 4934, 4954, 4974, 4994, or 5014; (vii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5101, 5108, 5112, 5116, 5120, or 5122; (viii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5125, 5132, 5136, 5140, 5144, or 5146; (ix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5077, 5084, 5088, 5092, 5096 or 5098; or (x) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of any one of SEQ ID NO: 5054, 5060, 5064, 5066, 5070 or 5074.

4. The siRNA of claim 1 or 3, or the AAV viral genome of claim 2 or 3, wherein: (i) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4906; (ii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4918; (iii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4922; (iv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4966; (v) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4970; (vi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4978; (vii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4982; (viii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4910; (ix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4914; (x) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5054; (xi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4926; (xii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4930; (xiii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4934; (xiv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4938; (xv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4942; (xvi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5060; (xvii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4946; (xviii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4950; (xix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4954; (xx) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4958; (xxi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4962; (xxii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5064; (xxiii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4974; (xxiv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5066; (xxv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4986; (xxvi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4990; (xxvii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4994; (xxviii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4998; (xxix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5002; (xxx) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5070; (xxxi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5006; (xxxii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5010; (xxxiii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5014; (xxxiv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4958; (xxxv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5022; (xxxvi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5074; (xxxvii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5077; (xxxviii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5084; (xxxix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5088; (xl) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5092; (xli) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5096; (xlii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5098; (xliii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5101; (xliv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5108; (xlv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5112; (xlvi) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5116; (xlvii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5120; (xlviii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5122; (xlix) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5125; (1) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5132; (li) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5136; (lii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5140; (liii) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5144; or (liv) the antisense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises at least 20 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 5146.

5. The siRNA of any one of claims 1, 3 or 4, or the AAV viral genome of any one of claims 2 to 4, wherein: (i) the antisense strand comprises the nucleotide sequence of any one of SEQ ID NO: 4908, 4920, 4924, or 4912; and / or the sense strand comprises the nucleotide sequence of any one of SEQ ID NO: 4906, 4926, 4946, 4966, 4986, 5006, 4918, 4938, 4958, 4978, 4998, 4922, 4942, 4962, 4982, 5002, 5022, 4910, 4930, 4950, 4970, 4990, or 5010; (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4906, 4926, 4946, 4966, 4986, or 5006; (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4918, 4938, 4958, 4978, or 4998; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4922, 4942, 4962, 4982, 5002, or 5022; (v) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4910, 4930, 4950, 4970, 4990, or 5010; (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916, and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 4914, 4934, 4954, 4974, 4994, or 5014; (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 5101, 5108, 5112, 5116, 5120, or 5122; (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 5125, 5132, 5136, 5140, 5144, or 5146; (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 5077, 5084, 5088, 5092, 5096 or 5098; or (x) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of any one of SEQ ID NO: 5054, 5060, 5064, 5066, 5070 or 5074.

6. The siRNA of any one of claims 1 or 3 to 5, or the AAV viral genome of any one of claims 2 to 5, wherein: (i) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4906; (ii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4918; (iii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4922; (iv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4966; (v) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4970; (vi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4978; (vii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924, and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4982; (viii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4910; (ix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4914; (x) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5054; (xi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4926; (xii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4930; (xiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4934; (xiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4938; (xv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4942; (xvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5060; (xvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4946; (xviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4950; (xix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4954; (xx) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4958; (xxi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4962; (xxii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5064; (xxiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4974; (xxiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5066; (xxv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4986; (xxvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4990; (xxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4994; (xxviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4998; (xxix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5002; (xxx) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5070; (xxxi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4908; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5006; (xxxii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4912; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5010; (xxxiii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4916; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5014; (xxxiv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4920; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4958; (xxxv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4924; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5022; (xxxvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5057; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5074; (xxxvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5077; (xxxviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5084; (xxxix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5088; (x1) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5092; (xli) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5096; (xlii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5080; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5098; (xliii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5101; (xliv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5108; (xlv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5112; (xlvi) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5116; (xlvii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5120; (xlviii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5104; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5122; (xlix) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5125; (1) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5132; (li) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5136; (lii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5140; (liii) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5144; or (liv) the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5128; and the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 5146.

7. The siRNA of any one of claims 1 or 3 to 6, or the AAV viral genome of any one of claims 2 to 6, wherein: (i) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4905; (ii) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4917; (iii) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4921; (iv) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4907, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4965; (v) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4911, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4969; (vi) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4919, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4977; or (vii) the nucleotide sequence encoding the antisense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4923, and the nucleotide sequence encoding the sense strand sequence comprises the nucleotide sequence of SEQ ID NO: 4981.

8. The siRNA of any one of claims 1 or 3 to 7, or the AAV viral genome of any one of claims 2 to 7, wherein: (i) the sense strand sequence, the antisense strand sequence, or both the sense strand sequence and the antisense strand sequence comprise at least 15-30, 19-21, or 25-30 nucleotides in length, such as 17, 18, 20, 21, 22, 25, or 30 nucleotides in length; (ii) the sense strand sequence, the antisense strand sequence, or both the sense strand sequence and the antisense strand sequence comprise an overhang of 1 or 2 nucleotides, such as an overhang at the 5' end of the sense strand sequence and / or the 3' end of the antisense strand sequence; (iii) the sense strand and the antisense strand each contain a mismatch; and / or (iv) the antisense strand and the target sequence both contain a mismatch.

9. A regulatory polynucleotide comprising the siRNA according to any one of claims 1 or 3 to 8.

10. The AAV viral genome of any one of claims 2 to 8, wherein the viral genome further encodes a regulatory polynucleotide comprising the sense strand and the antisense strand of the siRNA.

11. The regulatory polynucleotide of claim 9 or the AAV viral genome of claim 10, wherein the regulatory polynucleotide further comprises one, two, three or all of the following: (i) 5' flanking region; (ii) the ring area; and (iii) 3' flanking region.

12. The regulatory polynucleotide of claim 11 or the AAV viral genome of claim 11, wherein: (A)(i) the 5' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4878-4886; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4878-4886; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4878-4886; (ii) the loop region comprises the nucleotide sequence of any one of SEQ ID NOs: 4887-4896; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; a nucleotide sequence that comprises one, two, three or four, but not more than five, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4887-4896; or a nucleotide sequence that comprises one, two, three or four, but not more than five modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4887-4896; and / or (iii) the 3' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4897-4904; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4897-4904; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4897-4904; and / or (B)(i) the nucleotide sequence encoding the 5' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4353-4361; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4353-4361; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4353-4361; (ii) the nucleotide sequence encoding the loop region comprises the nucleotide sequence of any one of SEQ ID NOs: 4362-4371; a nucleotide sequence having at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto; a nucleotide sequence comprising one, two, three or four, but not more than five, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4362-4371; or a nucleotide sequence comprising one, two, three or four, but not more than five modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4362-4371; and / or (iii) the nucleotide sequence encoding the 3' flanking region comprises the nucleotide sequence of any one of SEQ ID NOs: 4372-4379; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of any one of SEQ ID NOs: 4372-4379; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of any one of SEQ ID NOs: 4372-4379.

13. The regulatory polynucleotide of any one of claims 9, 11 or 12 or the AAV viral genome of any one of claims 10 to 12, wherein the regulatory polynucleotide comprises: (A)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:4879; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4887; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4887; a nucleotide sequence that comprises one, two, three or four, but not more than five, different nucleotides from the nucleotide sequence of SEQ ID NO: 4887; or a nucleotide sequence that comprises one, two, three or four, but not more than five, different nucleotides from the nucleotide sequence of SEQ ID NO: 4887; and (iii) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898; (B)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888; and (iii) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898; (C)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4879; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:4879; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO:4879; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO:4879; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4887; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4887; a nucleotide sequence that comprises one, two, three or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4887; or a nucleotide sequence that comprises one, two, three or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4887; and (iii) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4899; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4899; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4899; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4899; or (D)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4880; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4880; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4880; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4880; (ii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4891; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4891; a nucleotide sequence that comprises one, two, three or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4891; or a nucleotide sequence that comprises one, two, three or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4891; and (iii) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4900; a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4900; a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4900; or a nucleotide sequence that comprises one, two, three, four, five, six or seven, but not more than ten modifications relative to SEQ ID NO: 4900.

14. The regulatory polynucleotide of any one of claims 9 or 11 to 13 or the AAV viral genome of any one of claims 10 to 13, wherein the regulatory polynucleotide comprises, in 5' to 3' order: (i) the 5' flanking region, the sense strand sequence, the loop region, the antisense strand sequence and the 3' flanking region; or (ii) the 5' flanking region, the antisense strand sequence, the loop region, the sense strand sequence and the 3' flanking region.

15. The regulatory polynucleotide of any one of claims 9 or 11 to 14 or the AAV viral genome of any one of claims 10 to 14, wherein the regulatory polynucleotide comprises, in 5' to 3' order: (A)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4880; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4880; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4880; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4880; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4906; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4891; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4891; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4891; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4891; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4908; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4900; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4900; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4900; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO: 4900; (B) (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4880; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4880; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4880; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4880; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4918; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4891; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4891; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4891; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4891; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4920; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4900; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4900; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4900; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO: 4900; (C) (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4880; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4880; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4880; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4880; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4922; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4891; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4891; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4891; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4891; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4924; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4900; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4900; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4900; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO: 4900; (D)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4879; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4966; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4908; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4898; (E)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4970; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4912; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4898; (F)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4879; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4978; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4920; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4898; or (G)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4879; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4879; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4879; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4879; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4982; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4888; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4888; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4888; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4888; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4924; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4898; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4898.

16. The regulatory polynucleotide of any one of claims 9 or 11 to 15 or the AAV viral genome of any one of claims 10 to 15, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises, in 5' to 3' order: (A)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4355; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4355; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4355; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO:4355; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4905; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4366; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4366; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4366; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4366; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4907; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4375; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4375; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4375; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO: 4375; (B) (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4355; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4355; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4355; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4355; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4917; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4366; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4366; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4366; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4366; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4919; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4375; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4375; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4375; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO: 4375; (C) (i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO: 4355; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4355; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4355; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4355; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4921; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4366; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4366; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4366; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4366; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4923; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4375; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4375; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4375; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to SEQ ID NO: 4375; (D)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4354; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO:4354; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4965; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4363; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4363; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4363; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4363; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4907; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4373; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4373; (E)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4354; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO:4354; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4969; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4363; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4363; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4363; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4363; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4911; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4373; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4373; (F)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4354; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO:4354; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4977; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4363; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4363; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4363; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4363; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4919; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO: 4373; or (G)(i) a 5' flanking region comprising the nucleotide sequence of SEQ ID NO:4354; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4354; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides from the nucleotide sequence of SEQ ID NO:4354; or a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications to the nucleotide sequence of SEQ ID NO:4354; (ii) a sense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4981; (iii) a loop region comprising the nucleotide sequence of SEQ ID NO: 4363; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4363; a nucleotide sequence that comprises one, two, three, or four, but not more than five, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4363; or a nucleotide sequence that comprises one, two, three, or four, but not more than five modifications relative to the nucleotide sequence of SEQ ID NO: 4363; (iv) an antisense strand sequence comprising the nucleotide sequence of SEQ ID NO: 4923; and (v) a 3' flanking region comprising the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 4373; a nucleotide sequence that comprises one, two, three, four, five, six, or seven, but not more than ten modifications relative to the nucleotide sequence of SEQ ID NO: 4373.

17. The regulatory polynucleotide of any one of claims 9 or 11 to 16 or the AAV viral genome of any one of claims 10 to 16, wherein the nucleotide sequence encoding the regulatory polynucleotide comprises the nucleotide sequence of any one of SEQ ID NO: 4405, 4408, 4409, 4390, 4391, 4393, 4394, 4380-4389, 4392, 4395-4404, 4406 or 4407, or a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto.

18. An AAV viral genome comprising a promoter operably linked to a nucleic acid encoding the regulatory polynucleotide of any one of claims 9 or 11 to 17 or the siRNA of any one of claims 1 or 3 to 8.

19. The AAV viral genome of any one of claims 3 to 8 or 10 to 17, wherein the AAV viral genome further comprises a promoter operably linked to the nucleotide sequence encoding the sense strand sequence and the antisense strand sequence or the nucleotide sequence encoding the regulatory polynucleotide.

20. The AAV viral genome of claim 18 or 19, wherein the promoter: (i) is a ubiquitin promoter; (ii) is a cell- or tissue-specific promoter; (iii) selected from human elongation factor 1α-subunit (EF1α), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken β-actin (CBA) and its derivative CAG, β-glucuronidase (GUSB) or ubiquitin C (UBC), neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF-β), intercellular adhesion molecule 2 (ICAM-2), synaptophysin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaM KII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or neurofilament heavy chain (NFH), β-globin minigene nβ2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), cardiovascular promoters (e.g., αMHC, cTnT and CMV-MLC2k), liver promoters (e.g., hAAT, TBG), skeletal muscle promoters (e.g., desmin, MCK, C512) or functional fragments, e.g., truncations, or functional variants thereof; (iii) is a CBA promoter or a variant thereof; (iv) a nucleotide sequence comprising any one of the nucleotide sequences provided in Table 2; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to any one of the nucleotide sequences provided in Table 2; or a nucleotide sequence having at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity with any one of the nucleotide sequences provided in Table 2; or (v) a nucleotide sequence comprising SEQ ID NO:5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO:5199; or a nucleotide sequence having at least 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:5199.

21. The AAV viral genome of any one of claims 2 to 8 or 10 to 20, wherein the AAV viral genome further comprises: (i) at least one or two inverted terminal repeat (ITR) sequences, optionally wherein the AAV viral genome comprises an ITR sequence located 5' to the nucleic acid encoding the regulatory polynucleotide or siRNA and / or an ITR sequence located 3' to the nucleic acid encoding the regulatory polynucleotide or siRNA; (ii) polyadenylation (polyA) signal sequence; (iii) enhancers, Kozak sequences, intronic regions and / or exonic regions; and / or (iv) a nucleotide sequence that encodes a microRNA (miR) binding site, e.g., a miR binding site that modulates, e.g., reduces expression of a payload encoded by the viral genome in cells or tissues expressing the corresponding miRNA; optionally wherein the encoded miR binding site modulates, e.g., reduces expression of the encoded payload in cells or tissues of the DRG, liver, heart, hematopoietic lineage, or a combination thereof.

22. The AAV viral genome of claim 21, wherein: (i) the ITR located 5' to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises the nucleotide sequence of SEQ ID NO: 5197 or 4469; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197 or 4469; or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 5197 or 4469; (ii) the ITR located 3' to the nucleic acid encoding the regulatory polynucleotide or siRNA comprises the nucleotide sequence of SEQ ID NO: 5200 or 4470; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200 or 4470; or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 5200 or 4470; (iii) the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence having at least 80% (e.g., 85%, 90%, 95%, 96%, 97%, 98% or 99%) sequence identity to SEQ ID NO: 4476; (iv) the enhancer comprises a CMV enhancer or a variant thereof; (v) the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471 or 4472; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO: 4471 or 4472; or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 4471 or 4472; and / or (vi) the intron comprises the nucleotide sequence of SEQ ID NO:4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, such as substitutions, insertions or deletions, relative to SEQ ID NO:4475; or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO:4475.

23. The AAV viral genome of any one of claims 2 to 8 or 10 to 22, wherein the AAV viral genome is self-complementary or single-stranded.

24. The AAV viral genome of any one of claims 2 to 8 or 10 to 23, wherein the AAV viral genome further comprises a nucleotide sequence encoding a Rep protein, e.g., a non-structural protein, wherein the Rep protein comprises a Rep78 protein, a Rep68, a Rep52 protein, and / or a Rep40 protein (e.g., a Rep78 and Rep52 protein).

25. The AAV viral genome of any one of claims 2 to 8 or 10 to 24, comprising, in 5' to 3' order: (A)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200; or (B)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 4469; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4469; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4469; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4472; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4472; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4472; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises any one of SEQ ID NOs: 4380-4409 or 5027-5050, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 4470; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4470; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4470.

26. The AAV viral genome of any one of claims 2 to 8 or 10 to 25, comprising, in 5' to 3' order: (A)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4405, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200; (B)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4408, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200; (C) (i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4409, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200; (D)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4390, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200; (E)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4391, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200; (F)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4393, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200; or (G)(i) an ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5197; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5197; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5197; (ii) an enhancer, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 4471; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4471; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4471; (iii) a promoter, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 5199; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5199; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5199; (iv) an intron, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 4475; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4475; or a nucleotide sequence that is at least 80%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4475; (v) a nucleotide sequence encoding a regulatory polynucleotide, wherein the nucleotide sequence comprises SEQ ID NO: 4394, or a nucleotide sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical thereto; (vi) a polyA signal sequence, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 4476; a nucleotide sequence comprising at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 4476; or a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 4476; as well as (vii) ITR, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 5200; a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 5200; or a nucleotide sequence that comprises at least one, two, three, four, five, six or seven, but not more than ten modifications, e.g., substitutions, insertions or deletions, relative to SEQ ID NO: 5200.

27. The AAV viral genome of any one of claims 2 to 8 or 10 to 26, comprising the nucleotide sequence of any one of SEQ ID NOs: 5173, 5195, 5196, 5182, 5183, 5184, 5185, 5149-5172, 5174-5181, 5186-5194, or 4439-4468, or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to any one of SEQ ID NOs: 5173, 5195, 5196, 5182, 5183, 5184, 5185, 5149-5172, 5174-5181, 5186-5194, or 4439-4468.

28. An AAV particle comprising the AAV viral genome of any one of claims 2 to 8 or 10 to 27, an AAV viral genome encoding the regulatory polynucleotide of any one of claims 9 or 11 to 17, or a viral genome encoding the siRNA of any one of claims 1 or 3 to 8, and an AAV capsid protein.

29. The AAV particle of claim 28, wherein the AAV capsid protein comprises: (i) AAV5 capsid protein or variants thereof, AAV9 capsid protein or variants thereof, VOY101 capsid protein or variants thereof, PHPeB capsid protein or variants thereof, PHP.B capsid protein or variants thereof, PHP.N capsid protein or variants thereof, AAV1 capsid protein or variants thereof, AAV2 capsid protein or variants thereof, AAVrh10 capsid protein or variants thereof, or VOY9P39 capsid protein or variants thereof; (ii) AAV9 capsid protein or a variant thereof; (iii) AAV5 capsid protein or variants thereof; (iv) an amino acid sequence provided in Table 1, or an amino acid sequence at least 85%, 90%, 92%, 95%, 97%, 98% or 99% identical thereto; or (v) The nucleotide sequence encoding the AAV capsid protein comprises any one of the nucleotide sequences in Table 1 or a nucleotide sequence that is at least 85%, 90%, 92%, 95%, 97%, 98% or 99% identical thereto.

30. A vector comprising the AAV viral genome of any one of claims 2 to 8 or 10 to 27, a nucleotide sequence encoding the regulatory polynucleotide of any one of claims 9 or 11 to 17, or a nucleotide sequence encoding the siRNA of any one of claims 1 or 3 to 8.

31. A cell comprising the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8, optionally wherein the cell is: (a) mammalian cells or insect cells; (b) cells in the brain or spinal cord (e.g., CNS cells); (c) cells of the cortex, hippocampus, thalamus, or brainstem; or (d) Neurons, glial cells, or oligodendrocytes.

32. A method for preparing AAV particles, comprising: (i) providing a host cell comprising the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the AAV viral genome encoding the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the viral genome encoding the siRNA of any one of claims 1 or 3 to 8; (ii) incubating the host cell under conditions suitable for encapsidation of the viral genome in AAV capsid proteins; The AAV particles are thereby prepared.

33. A pharmaceutical composition comprising the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8, and a pharmaceutically acceptable excipient.

34. A method for delivering siRNA for inhibiting MAPT expression to cells, comprising administering to the cells an effective amount of the pharmaceutical composition of claim 33, the AAV particles of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8, thereby delivering the siRNA for inhibiting MAPT expression to the cells.

35. The method of claim 34, wherein the cell is: (a) mammalian cells or insect cells; (b) cells in the brain or spinal cord (e.g., CNS cells); (c) cells of the cortex, hippocampus, thalamus, or brainstem; (d) neurons, glial cells or oligodendrocytes; and / or (e) In a subject.

36. The method of claim 35, wherein the subject has or has been diagnosed as having a genetic disorder (e.g., a monogenic disorder or a polygenic disorder); a neurological disorder (e.g., a neurodegenerative disorder); a disorder associated with tau expression, e.g., abnormal tau expression; and / or a tauopathy.

37. A method of treating a subject having or diagnosed as having a genetic disorder (e.g., a monogenic disorder or a polygenic disorder); a neurological disorder (e.g., a neurodegenerative disorder); a disorder associated with tau expression, such as aberrant tau expression; and / or a tauopathy, comprising administering to the subject an effective amount of the pharmaceutical composition of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8.

38. The method of claim 36 or 37, wherein the genetic disorder, neurological disorder (e.g., neurodegenerative disorder), disorder associated with tau expression (e.g., abnormal tau expression), and / or tauopathy is Alzheimer's disease (AD), frontotemporal dementia (FTD), frontotemporal dementia and Parkinsonism associated with chromosome 17 (FTDP-17), frontotemporal lobar degeneration (FTLD), Dravet syndrome (DS), a neurodegenerative disease, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), progressive supranuclear palsy (PSP), Down syndrome, Pick's disease, corticobasal degeneration (CBD), corticobasal syndrome, amyotrophic lateral sclerosis (ALS), a prion disease, CJD, multiple system atrophy, mild cognitive impairment, dementia with only neurofibrillary tangles, or progressive subcortical gliosis.

39. The method of claim 37 or 38, wherein treating comprises preventing progression of the genetic disorder, neurological disorder (e.g., neurodegenerative disorder), disorder associated with tau expression (e.g., abnormal tau expression), and / or tauopathy in the subject.

40. The method of any one of claims 37 to 39, further comprising performing a blood test, an imaging test (e.g., a PET scan or a PET scan combined with a biomarker, such as a serum biomarker stain), a CNS biopsy sample, or an aqueous cerebrospinal fluid biopsy, optionally wherein the blood test, imaging test, biopsy sample, or aqueous cerebrospinal fluid biopsy is performed before, during, or after treatment with the AAV particle, regulatory polynucleotide, siRNA, or pharmaceutical composition.

41. The method of any one of claims 37 to 4, wherein the pharmaceutical composition, AAV particles, regulatory polynucleotide, and siRNA are administered to the subject by the following routes of administration: (i) intravenously, via intracisternal injection (ICM), intracerebrally, intrathecally, intracerebroventricularly, via intraparenchymal administration, or intramuscularly; (ii) via focused ultrasound (FUS), e.g., combined with intravenous administration of microbubbles (FUS-MB) or MRI-guided FUS combined with intravenous administration; (iii) Intravenous.

42. A pharmaceutical composition as described in claim 33, an AAV particle as described in claim 28 or 29, an AAV viral genome as described in any one of claims 2 to 8 or 10 to 27, a regulatory polynucleotide as described in any one of claims 9 or 11 to 17, or an siRNA as described in any one of claims 1 or 3 to 8, for use in a method of delivering siRNA for inhibiting MAPT expression to a cell.

43. A pharmaceutical composition according to claim 33, an AAV particle according to claim 28 or 29, an AAV viral genome according to any one of claims 2 to 8 or 10 to 27, a regulatory polynucleotide according to any one of claims 9 or 11 to 17, or an siRNA according to any one of claims 1 or 3 to 8, for use in the manufacture of a medicament.

44. A pharmaceutical composition according to claim 33, an AAV particle according to claim 28 or 29, an AAV viral genome according to any one of claims 2 to 8 or 10 to 27, a regulatory polynucleotide according to any one of claims 9 or 11 to 17, or an siRNA according to any one of claims 1 or 3 to 8 for use in treating a genetic disorder, a neurological disorder (e.g., a neurodegenerative disorder), a disorder associated with tau expression (e.g., abnormal tau expression), and / or a tauopathy.

45. Use of a pharmaceutical composition as described in claim 33, an AAV particle as described in claim 28 or 29, an AAV viral genome as described in any one of claims 2 to 8 or 10 to 27, a regulatory polynucleotide as described in any one of claims 9 or 11 to 17, or an siRNA as described in any one of claims 1 or 3 to 8 in the manufacture of a medicament for delivering siRNA for inhibiting MAPT expression to cells.

46. Use of the pharmaceutical composition of claim 33, the AAV particle of claim 28 or 29, the AAV viral genome of any one of claims 2 to 8 or 10 to 27, the regulatory polynucleotide of any one of claims 9 or 11 to 17, or the siRNA of any one of claims 1 or 3 to 8 in the manufacture of a medicament.

47. Use of a pharmaceutical composition as claimed in claim 33, an AAV particle as claimed in claim 28 or 29, an AAV viral genome as claimed in any one of claims 2 to 8 or 10 to 27, a regulatory polynucleotide as claimed in any one of claims 9 or 11 to 17, or an siRNA as claimed in any one of claims 1 or 3 to 8 in the manufacture of a medicament for treating a genetic disorder, a neurological disorder (e.g., a neurodegenerative disorder), a disorder associated with tau expression (e.g., abnormal tau expression), and / or a tauopathy.

Images