Toxoplasma antibody and its detection kit

Abstract

The application provides two monoclonal antibodies XJ16 and XJ23 against a recombinant antigen protein membrane surface antigen SAG1 protein of Toxoplasma gondii, the antibodies can specifically recognize Toxoplasma gondii at various stages, have the characteristics of high sensitivity and wide recognition range, can detect Toxoplasma gondii infection at various stages, can be used for detecting the existence and content of Toxoplasma gondii in samples, lays a foundation for exploring Toxoplasma gondii, and provides a new exploration idea for exploring the mechanism of rapid and slow Toxoplasma gondii transformation and then developing new prevention and treatment strategies.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to a Toxoplasma gondii antibody and its detection kit. Background Technology

[0002] Toxoplasma gondii is an obligate intracellular parasite that can infect nucleated cells in almost all types of warm-blooded vertebrates and humans, causing a zoonotic disease. This disease is widespread throughout the world; it is estimated that about one-third of the world's population is infected with toxoplasmosis. In immunocompetent individuals, infection with Toxoplasma gondii usually presents as a latent infection. However, certain immunocompromised individuals (such as those with HIV / AIDS, organ transplant recipients, or cancer patients) may develop toxoplasmic encephalopathy, retinal choroiditis, and other diseases, which can be life-threatening in severe cases. First-time infection in pregnant women can cause congenital damage to the embryo, such as birth defects, stillbirth, or miscarriage. Felines are the only definitive host for the transmission of toxoplasmosis; human infection mainly occurs through the consumption of food contaminated with oocysts excreted by infected felines and tissue cysts from other intermediate hosts.

[0003] Currently, there is no effective treatment for latent Toxoplasma gondii infection, and measures to prevent vertical transmission are inadequate, seriously impacting reproductive health. Furthermore, with the increasing number of pet-owning households, Toxoplasma gondii testing has become the first and most crucial line of defense. Recombinant Toxoplasma gondii antigens mainly include surface antigen (SAG), rod-shaped protein (ROP), dense granule protein (GRA), micronematosome protein (MIC), matrix antigen (MAG1), and bradygenes antigen (BAG). Existing Toxoplasma gondii antibody detection methods include ELISA and Western blot, both of which have high specificity. Although many antibodies against Toxoplasma gondii exist, their accuracy is often low, the procedures are cumbersome, and false positive or false negative results are possible. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art.

[0005] First, the present invention provides two monoclonal antibodies, XJ16 and XJ23, targeting the SAG1 protein, a recombinant antigen protein membrane surface antigen of Toxoplasma gondii. The two monoclonal antibodies are obtained by secretion from hybridoma cell lines XJ16 and XJ23, respectively. The antibodies can specifically recognize Toxoplasma gondii at various stages and have the characteristics of high sensitivity and wide recognition range.

[0006] The monoclonal antibody comprises a heavy chain variable region and a light chain variable region; wherein, the amino acid sequence of the heavy chain variable region of the monoclonal antibody XJ16 is shown in SEQ ID NO.3, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.4, wherein...

[0007] The heavy chain variable region comprises CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.5-7, respectively;

[0008] The light chain variable region includes CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.8-10, respectively;

[0009] The amino acid sequence of the heavy chain variable region of monoclonal antibody XJ23 is shown in SEQ ID NO.11, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.12.

[0010] The heavy chain variable region comprises CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.13-15, respectively;

[0011] The light chain variable region includes CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.16-18, respectively;

[0012] Furthermore, the present invention provides a nucleotide sequence encoding the above-mentioned monoclonal antibody, a vector containing the above-mentioned sequence, a cell, a composition, and a conjugate.

[0013] Furthermore, the present invention provides any one of the above-mentioned monoclonal antibodies, nucleotide sequences, vectors, cells, compositions, and conjugates for use in the preparation of products for treating or detecting Toxoplasma gondii; or for the detection of Toxoplasma gondii in non-disease diagnosis and treatment, with samples including but not limited to pet excrement, water samples, and environmental samples.

[0014] Furthermore, the present invention provides a double-antibody sandwich ELISA kit for detecting Toxoplasma gondii, characterized in that the kit comprises the following components:

[0015] Capture antibody, HRP-labeled detection antibody, coating solution, sample dilution and washing solution, blocking solution, substrate solution, stop solution, standard positive serum (positive control), and standard negative serum (negative control);

[0016] The capture antibody is a monoclonal antibody, XJ16.

[0017] The detection antibody was the HRP-labeled monoclonal antibody XJ23;

[0018] The coating solution was a 0.05 M carbonate buffer solution with a pH of 9.6;

[0019] The sample diluent (PBS) and wash buffer (PBST) are phosphate buffers containing 0.5% Tween-20;

[0020] The blocking solution is 1% BSA;

[0021] The substrate chromogenic solution is a TMB substrate solution;

[0022] The stop solution is a 2 mol / L H2SO4 solution.

[0023] Furthermore, this application provides a method for detecting Toxoplasma gondii infection in samples using the above-mentioned double-antibody sandwich ELISA detection kit, comprising the following steps:

[0024] (1) Dilute the purified capture antibody XJ16 and coat it with an enzyme-labeled plate at a concentration of 250 ng / well, and incubate at 37°C for 2 h.

[0025] (2) Spin dry the liquid in the plate, wash 3 times with washing solution, 3 min / time, add blocking solution, block the ELISA plate, the blocking solution is 5% skim milk powder, incubate at 37℃ for 2 h;

[0026] (3) Spin dry the liquid in the plate, wash 3 times with washing solution, 3 min / time, add the test sample diluted with PBS at 1:80, 100 uL / well, 3 replicates for each sample, incubate at 37℃ for 2 h.

[0027] (4) Spin dry the liquid in the plate, wash 3 times with washing solution, 3 min / time; dilute the horseradish peroxidase-labeled detection antibody XJ23 and add it to the ELISA plate, incubate at 37℃ for 1 h; the dilution factor is 1:400 volume ratio.

[0028] (5) Spin dry the liquid in the plate, wash 4-5 times with washing solution, 3 min / time; add TMB substrate, 100 uL / well, develop color at room temperature in the dark for 10 min.

[0029] (6) Add stop solution, 100 uL / well; mix well and then measure the OD450nm value with a microplate reader.

[0030] (7) Result determination: A measurement well / negative well ratio ≥ 2.1 is considered positive, and the remaining wells are considered negative.

[0031] Thirty negative serum samples of Toxoplasma gondii were selected, and their values ​​at OD450nm were read using the detection method established in this study. The mean (X) of these 30 serum samples was calculated to be 0.214, and the standard deviation (SD) was 0.039. Therefore, the critical value of the above indirect ELISA method is X + 3SD = 0.214 + 3 × 0.039 = 0.331.

[0032] Beneficial effects

[0033] This invention provides two monoclonal antibodies, XJ16 and XJ23, targeting the SAG1 protein, a recombinant antigen protein of Toxoplasma gondii. These antibodies can specifically recognize Toxoplasma gondii at various stages, exhibiting high sensitivity and a wide recognition range. They can be used to specifically detect Toxoplasma gondii infection at multiple stages and can be used to detect the presence and content of Toxoplasma gondii in samples. This lays the foundation for research on Toxoplasma gondii and provides new insights into the mechanism of rapid and slow germ transformation of Toxoplasma gondii, thereby developing new prevention and treatment strategies. Attached Figure Description

[0034] Figure 1 A schematic diagram of double digestion of PCR fragment inserted into pET-30a(+) plasmid, where M is the marker, 1 is the PCR fragment (573bp), and 2 is the vector fragment (~5200bp).

[0035] Figure 2 A schematic diagram of pET-30a(+)-GRA1 protein expression induced by IPTG, where M is the marker, 1 is the protein expression profile before purification, and 2 is the purified rGRA1 protein.

[0036] Figure 3 The purified protein was identified by Western blot, and a specific band was observed at 27 kDa. Detailed Implementation

[0037] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0038] Example 1: Screening and identification of monoclonal antibodies against SAG1 protein

[0039] Primers were designed based on the GRA1 gene sequence in GenBank (accession number: XM_002365660.2), with an expected amplification fragment length of 573 bp. Enzyme restriction sites were introduced at the front ends of both upstream and downstream primers, as shown in Table 1. The PCR fragment was inserted into the pET-30a(+) plasmid. After double digestion, two bands were observed, and their size was correct. Figure 1 The correctly ligated plasmid was sequenced and named pET-30a(+)-GRA1. It was then cultured using BL21, and protein expression was induced by IPTG followed by purification. Figure 2 ),

[0040] GRA1-F CTATCTGATGATGCGTGTGACC(SEQ ID NO.1) GRA1-R CTCAAGATTTACTAATCCTCTCCGG(SEQ ID NO.2)

[0041] The purified protein was then identified by Western blot. It was confirmed that the protein could be recognized by positive serum from dogs infected with Toxoplasma gondii, exhibiting a specific band at 27 kDa. Figure 3 This indicates that the recombinant protein GRA1 has good reactivity.

[0042] Monoclonal antibodies were prepared and screened using conventional methods. The steps are briefly described as follows: Purified recombinant protein GRA1 was used as an immunogen to immunize mice. Blood was collected from the mouse orbital rim to determine antibody titers. When the titer was higher than 1:10000, a booster immunization was performed. Three days later, spleen cells were fused with SP / 20 cells. Positive clones were screened using indirect ELISA, and subcloning was performed. The positive clone cell lines were expanded and cultured, and ascites was prepared by intraperitoneal injection into BALB / c female mice. The ascites titer was detected using indirect ELISA, and the ascites was purified. High-titer monoclonal cell lines were selected and expanded. Their culture medium was used as the primary antibody, and HRP-labeled goat anti-mouse IgG as the secondary antibody. Western blot identification was performed, and two monoclonal cell lines were screened, named XJ16 and XJ23, respectively. These were expanded, cultured, and cryopreserved. The ascites titer was determined using indirect ELISA. The ascites titers of both monoclonal cell lines reached above 1:256000 and were stored at -80℃ for later use.

[0043] The ascites fluid from XJ16 and XJ23 was centrifuged to remove precipitates and clots. The samples were then purified using a Protein G immunoaffinity chromatography column and sent to a gene company for sequencing.

[0044] The amino acid sequence of the heavy chain variable region of the monoclonal antibody XJ16 is shown in SEQ ID NO.3, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.4.

[0045] The heavy chain variable region comprises CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.5-7, respectively;

[0046] The light chain variable region includes CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.8-10, respectively;

[0047] The amino acid sequence of the heavy chain variable region of monoclonal antibody XJ23 is shown in SEQ ID NO.11, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.12.

[0048] The heavy chain variable region comprises CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.13-15, respectively;

[0049] The light chain variable region includes CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.16-18, respectively.

[0050]

[0051]

[0052] The test samples were diluted with 0.05M pH 9.6 carbonate buffer. The test samples included positive sera from infections such as bovine mycoplasma, ovine mycoplasma pneumoniae, neosporidia, swine trichinella, chicken anthrax, swine ascarid, canine diplophora, or chicken Eimeria tenella. ELISA was performed using these samples as the detection antigens. The results showed that the OD values ​​of the above samples were all below 0.1, indicating a negative reaction. This demonstrates that the prepared XJ16 and XJ23 monoclonal antibodies have very good specificity.

[0053] Example 2: Construction and optimization of the double sandwich reagent kit

[0054] A detection kit was constructed after labeling antibodies using conventional methods in the field. A checkerboard matrix approach was used to optimize various parameters. Taking the determination of capture antibody and detection antibody concentrations and the optimization of the blocking buffer as examples, XJ16 was used as the capture antibody to coat ELISA plates at concentrations of 2000 ng / well, 1000 ng / well, 500 ng / well, 250 ng / well, and 100 ng / well. XJ23 was used as the detection antibody in serial dilutions. A double-antibody sandwich ELISA detection method was established according to the aforementioned procedure. The judgment criteria were: measuring the OD450nm value, a well-to-negative well ratio ≥2.1 was considered positive, and the remaining wells were considered negative. The results are shown in Table 1, indicating that the P / N ratio and P value were both maximized when the capture antibody coating concentration was 250 ng / well and the detection antibody dilution concentration was 1:400.

[0055] Table 1. Determination of the concentrations of capture antibodies and detection antibodies.

[0056]

[0057]

[0058] Four blocking solutions—5% skim milk powder, 5% BSA, 2.5% BSA, and 1.25% BSA—were selected for double-antibody sandwich ELISA to determine the optimal blocking solution. 250 μL of blocking solution was added to each well, and the mixture was incubated at 37°C. The experimental results are shown in Table 2 below. Ultimately, 5% skim milk powder was determined to be the optimal blocking solution, and the optimal blocking time was determined to be 1 hour.

[0059] Table 2 Optimization of Sealing Fluid

[0060] 5% skim milk powder 5% BSA 2.5% BSA 1.25% BSA p-value 1.298 1.067 1.037 0.842 N value 0.21 0.26 0.21 0.18 P / N 6.18 4.1 4.93 4.67

[0061] Based on this, parameters such as antigen reaction time, antibody dilution factor and reaction time, TMB substrate reaction time, and critical value are further determined, ultimately identifying the optimal double-antibody sandwich ELISA method, characterized by the following steps:

[0062] (1) Dilute the purified capture antibody XJ16 and coat it with an enzyme-labeled plate at a concentration of 250 ng / well;

[0063] (2) Wash the ELISA plate, add blocking solution, and block the ELISA plate. The blocking solution is 5% skim milk powder.

[0064] (3) Wash the ELISA plate, add the sample to be tested, and carry out the reaction;

[0065] (4) Dilute the horseradish peroxidase-labeled detection antibody XJ23 and add it to the ELISA plate for reaction; the dilution factor is 1:400 volume ratio;

[0066] (5) Wash the microplate, add TMB substrate, and develop color at room temperature in the dark for 10 min;

[0067] (6) Add the stop solution, mix well, and then measure the OD450nm value using an ELISA reader.

[0068] (7) Result determination: A measurement well / negative well ratio ≥ 2.1 is considered positive, and the remaining wells are considered negative.

[0069] Thirty negative serum samples of Toxoplasma gondii were selected, and their values ​​at OD450nm were read using the detection method established in this study. The mean (X) of these 30 serum samples was calculated to be 0.214, and the standard deviation (SD) was 0.039. Therefore, the critical value of the above indirect ELISA method is X + 3SD = 0.214 + 3 × 0.039 = 0.331.

[0070] Under otherwise unchanged conditions, the Toxoplasma gondii-positive serum was serially diluted using the established double-antibody sandwich ELISA method. The sensitivity of the method was then determined. The sensitivity of this method was 1:1280 (see Table 3).

[0071] Table 3 Sensitivity test results

[0072] Dilution factor 1:40 1:80 1:160 1:320 1:640 1:1280 1:2560 PBS OD450nm 2.84 2.11 1.57 1.06 0.47 0.28 0.13 0.10 P / N 25.8 2.18 1.1 0.9 1 1.1 1 / Yin / Yang (+ / -) + + + + + + - -

[0073] Eleven serum samples were used to perform batch-to-batch and batch-to-batch repeatability tests using the established double-antibody sandwich ELISA method. The maximum coefficient of variation for the batch-to-batch repeatability test was 4.17%, and the maximum coefficient of variation for the batch-to-batch test was 7.40%, indicating that the method has good repeatability.

[0074] Example 3: Clinical Sample Testing

[0075] 135 clinical nasal swab samples were obtained from serum or tissue samples preserved in the laboratory. After thawing or grinding, these samples were subjected to double-antibody sandwich ELISA or PCR testing. The PCR method and primers were as described in Example 1. The concordance and agreement between the PCR method and the sandwich ELISA method were calculated.

[0076] Table 4 Comparison of results from double-antibody sandwich ELISA and PCR detection

[0077]

[0078] The results (Table 4) showed that the overall concordance rate between sandwich ELISA and PCR results was 96.2% (130 / 135), and the Kappa value of consistency was 0.815 (95% CI: 0.669–0.946), indicating that the two methods had a high degree of consistency.

[0079] The above description of the embodiments is intended to enable those skilled in the art to understand and use the present invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. A monoclonal antibody, XJ23, targeting the SAG1 protein, a recombinant antigen protein of Toxoplasma gondii, characterized in that: The amino acid sequence of the heavy chain variable region of the monoclonal antibody XJ23 is shown in SEQ ID NO.11, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

12. The heavy chain variable region comprises CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.13-15, respectively; The light chain variable region includes CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.16-18, respectively.

2. A composition comprising the monoclonal antibody XJ23 as described in claim 1.

3. The use of the monoclonal antibody XJ23 according to claim 1 and the composition according to claim 2 in the preparation of products for detecting Toxoplasma gondii.

4. A double-antibody sandwich ELISA kit for detecting Toxoplasma gondii, characterized in that... The kit contains the following components: Capture antibody, HRP-labeled detection antibody, coating solution, sample diluent and washing solution, blocking solution, substrate solution, stop solution, standard positive serum, and standard negative serum; The capture antibody is a monoclonal antibody, XJ16. The detection antibody was the HRP-labeled monoclonal antibody XJ23; The coating solution was a 0.05 M carbonate buffer solution with a pH of 9.6; The sample diluent PBS and the washing buffer PBST are phosphate buffers containing 0.5% Tween-20. The blocking solution is 1% BSA; The substrate chromogenic solution is a TMB substrate solution; The stop solution is a 2 mol / L H₂SO₄ solution. The amino acid sequence of the heavy chain variable region of the monoclonal antibody XJ16 is shown in SEQ ID NO.3, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

4. The heavy chain variable region comprises CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.5-7, respectively; The light chain variable region includes CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.8-10, respectively; The amino acid sequence of the heavy chain variable region of monoclonal antibody XJ23 is shown in SEQ ID NO.11, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

12. The heavy chain variable region comprises CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.13-15, respectively; The light chain variable region includes CDR1, CDR2 and CDR3, whose amino acid sequences are shown in SEQ ID NO.16-18, respectively.

Images