Detection reagent and detection method for staphylococcus aureus and active state of staphylococcus aureus and application of detection reagent and detection method

Abstract

The invention provides staphylococcus aureus, a detection reagent and a detection method for the active state of the staphylococcus aureus and application of the detection reagent and the detection method, and belongs to the technical field of biology. The reagent comprises a primer pair and a fluorescent probe, the primer pair comprises a forward primer and a reverse primer, the sequences of the forward primer and the reverse primer are shown as SEQ ID NO: 5 and SEQ ID NO: 6, and the sequence of the fluorescent probe is shown as SEQ ID NO: 7-functional molecule group-SEQ ID NO: 8. The detection reagent is combined with an SD-PMA-fluorescent RPA detection technology, so that the viable bacteria and dead bacteria states of the staphylococcus aureus can be accurately distinguished, and the detection efficiency and accuracy of the staphylococcus aureus are higher.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a detection reagent and a detection method for Staphylococcus aureus and its activity state, and applications thereof. Background Art

[0002] Staphylococcus aureus is a major foodborne pathogen that causes zoonotic diseases. This strain is resistant to high temperatures and salt, and can be a source of contamination in raw milk, cheese, butter, ice cream, and other products. This strain can produce heat-resistant enterotoxins that can cause skin infections, pneumonia, sepsis, food poisoning, and suppurative inflammation of tissues and organs. Exploring the survival and abundance of pathogens in dairy products is crucial for companies to assess the safety of their products. As a key pathogen, Staphylococcus aureus has attracted considerable attention. In recent years, it has become difficult to distinguish between live and dead Staphylococcus aureus in dairy products.

[0003] Currently, traditional plate culture identification methods rely primarily on bacterial culture, plate counts, and biochemical reactions. These methods are complex, subject to significant error, and are time-consuming, requiring 5-7 days to obtain results. Furthermore, bacteria in a viable but non-culturable state (VBNC) cannot be identified using conventional culture methods, which can easily lead to false-negative results and pose a food safety risk. Numerous methods exist for detecting the viability of Staphylococcus aureus in food, including PMA-PCR amplification, mRNA detection, fluorescent dyes, ELISA, and LAMP. While these methods offer advantages over traditional methods, they still present significant challenges, such as the need for expensive instrumentation, cumbersome procedures, and low sensitivity. Furthermore, molecular biology relies on nucleic acids, making it difficult to distinguish between live and dead bacteria, leading to the potential for false-positive results. These unstable and inaccurate results can lead to economic losses for businesses and fail to meet their needs for low-cost, time-sensitive, and highly specific solutions. Therefore, rapid and accurate identification of Staphylococcus aureus and its viable and dead state is crucial for the development of dairy products and food safety. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide a detection reagent, a detection method and applications thereof for Staphylococcus aureus and its activity state. The detection reagent and the detection method can accurately distinguish the activity state of Staphylococcus aureus and prevent false positive results in the identification of Staphylococcus aureus, with high detection accuracy.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The present invention provides a detection reagent for Staphylococcus aureus and its activity state. The reagent comprises a primer pair and a fluorescent probe. The primer pair comprises a forward primer and a reverse primer, and the sequences are shown in SEQ ID NO: 5 and SEQ ID NO: 6. The sequence of the fluorescent probe is shown in SEQ ID NO: 7-functional molecular group-SEQ ID NO: 8.

[0007] Preferably, the functional molecular group includes one or both of i6FAM and iBHQ.

[0008] The invention provides a detection kit for Staphylococcus aureus and its activity state, and the detection kit contains the detection reagent.

[0009] Preferably, the detection kit further comprises sodium deoxycholate (SD) solution and propidium azide bromide (PMA) solution.

[0010] The present invention provides a method for detecting Staphylococcus aureus and its activity state for non-disease diagnosis purposes, comprising the following steps: treating a sample with an SD solution and a PMA solution in sequence to obtain a treated sample solution; extracting DNA from the treated sample solution, and performing fluorescent RPA isothermal nucleic acid amplification using the detection reagent; when the sample contains live Staphylococcus aureus, a fluorescence curve is generated, and when the sample contains only dead Staphylococcus aureus or no Staphylococcus aureus, no fluorescence curve is generated.

[0011] Preferably, the final concentration of the SD solution is ≤0.04 w / v%.

[0012] Preferably, the final concentration of the PMA solution is 20-50 μM.

[0013] Preferably, the step of treating the sample with SD solution and PMA solution in sequence comprises: adding SD solution to the sample for treatment, adding PMA solution for incubation in the dark, and then irradiating with halogen light.

[0014] Preferably, the preparation of the reaction system for fluorescent RPA isothermal nucleic acid amplification includes: adding 25 μL of buffer, 2.1 μL of 10 μM forward primer, 2.1 μL of 10 μM reverse primer, 0.6 μL of 10 μM fluorescent probe and 2-5 μL of template DNA, filling up to 47 μL with ddH2O, transferring the above 47 μL reaction mixture to the reaction freeze-dried powder, mixing, adding the starter, mixing and centrifuging.

[0015] Preferably, the reaction conditions of the fluorescent RPA isothermal nucleic acid amplification include: reaction at 37-41° C. for 15-35 min.

[0016] The present invention provides application of the detection reagent or the detection kit in preparing a product for identifying Staphylococcus aureus and its active state.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The detection primers and probes designed in the present invention have high specificity and can accurately identify Staphylococcus aureus with high sensitivity. Furthermore, the detection primers and probes designed in the present invention, combined with the SD-PMA-fluorescence RPA detection method, can visually identify the live and dead states of Staphylococcus aureus in a relatively short time. The identification speed is fast and does not require expensive equipment. The high sensitivity, with a minimum detectable detection rate of 10 copies / μL, solves the problems of slow detection time, high cost, low specificity, and false positives. It provides a new method for the rapid and accurate detection of latent lethal and active pathogenic microorganisms in dairy products. It has a high reference value for identifying the live and dead states of Staphylococcus aureus in dairy products and is suitable for widespread application. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The figure shows the effect of different final concentrations of SD solution on the live bacterial solution.

[0020] Figure 2 The fluorescence signal changes of different target primers during the reaction.

[0021] Figure 3 Results of SD-PMA-fluorescence RPA detection of live and dead Staphylococcus aureus.

[0022] Figure 4 This is the sensitivity test result. DETAILED DESCRIPTION

[0023] The present invention provides a detection reagent for Staphylococcus aureus and its activity state, the detection reagent comprising a primer pair and a fluorescent probe, the primer pair comprising a forward primer and a reverse primer, the sequences of which are shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the sequence of the fluorescent probe is shown in SEQ ID NO: 7-functional molecular group-SEQ ID NO: 8. The specific sequence of the primer pair of the present invention is: forward primer TA CGCTAAGCCACGTCCATATTTATCAGTTC (SEQ ID NO: 5), and reverse primer GAA ATATGGTCCTGAAGCAAGTGCATTTAC (SEQ ID NO: 6). The specific sequence of the fluorescent probe of the present invention is CCACGTCCATATTTATCAGTTCTTTGACC / i6FAMdT / / idSp / / iBHQdT / GTCAAACTCGACTTC-C3Spacer (SEQ ID NO: 7-fluorescent group-SEQ ID NO: 8-C3Spacer).

[0024] The present invention also provides a detection kit for Staphylococcus aureus and its activity status, comprising the detection reagent. The detection kit also includes an SD solution and a PMA solution. The kit also includes a buffer solution, a lyophilized reaction powder, and an initiator.

[0025] The present invention also provides a method for detecting Staphylococcus aureus and its activity state, comprising the following steps: treating a sample with an SD solution and a PMA solution in sequence to obtain a treated sample solution; extracting DNA from the treated sample solution, and performing fluorescent RPA isothermal nucleic acid amplification using the detection reagent; when the sample contains live Staphylococcus aureus, a fluorescence curve is generated, and when the sample contains only dead Staphylococcus aureus or no Staphylococcus aureus, no fluorescence curve is generated.

[0026] In the present invention, the preparation of the SD solution includes the following steps: dissolving SD in 0.05-0.25 w / v% peptone water to obtain a 5-15 w / v% SD solution, which is used as a reserve solution. The concentration of the peptone water is preferably 0.08-0.2 w / v%, more preferably 0.1 w / v%. The concentration of the SD solution prepared in the present invention is preferably 8-12 w / v%, more preferably 10 w / v%. In the specific detection method of the present invention, the final concentration of the SD solution is preferably ≤ 0.04 w / v%, more preferably 0.04 w / v%. The SD described in the present invention can dissolve proteins, treat damaged bacterial biofilms, promote the entry of PMA into dead bacterial cells, and increase the binding rate with DNA.

[0027] In the present invention, the preparation of the PMA solution comprises the following steps: dissolving PMA with a 15-25 v / v% dimethyl sulfoxide solution to prepare a 0.1-0.9 mM PMA solution as a stock solution. The concentration of the dimethyl sulfoxide solution of the present invention is preferably 18-22 v / v%, more preferably 20 v / v%. The concentration of the PMA solution configured in the present invention is preferably 0.3-0.7 mM, more preferably 0.5 mM. In the specific detection method of the present invention, the final concentration of the PMA is preferably 20-50 μM, more preferably 30 μM. The PMA of the present invention enters dead bacterial cells and binds to DNA, inhibiting the amplification of dead bacterial DNA.

[0028] In the present invention, the step of treating the sample with SD solution and PMA solution in sequence includes: adding SD solution to the sample for treatment, adding PMA solution for incubation in the dark, and then irradiating with a halogen lamp. In the present application, the treatment time of adding SD solution is preferably 10-30 minutes, and more preferably 20 minutes. In the present invention, the incubation time of adding PMA solution in the dark is preferably 5-15 minutes, and more preferably 10 minutes. In the present invention, the exposure time is 10-20 minutes using a 550-660W halogen lamp, and more preferably 15 minutes using a 650W halogen lamp.

[0029] In the present invention, the preparation of the reaction system of the fluorescent RPA isothermal nucleic acid amplification includes: adding 25 μL of buffer, 2.1 μL of 10 μM forward primer, 2.1 μL of 10 μM reverse primer, 0.6 μL of 10 μM fluorescent probe and 2-5 μL of template DNA, filling it to 47 μL with ddH2O, and then transferring 47 μL of reaction solution to the reaction freeze-dried powder, dissolving and mixing, adding 3 μL of starter, adding steel balls, mixing and centrifuging. The buffer, reaction freeze-dried powder and starter described in the present invention are all from the DNA constant temperature nucleic acid amplification kit (fluorescent version) purchased by Le Shang Biotechnology (Wuxi) Co., Ltd., and the kit number is DNA-LS02.

[0030] In the present invention, the reaction conditions of the fluorescent RPA isothermal nucleic acid amplification include: reaction at 37-41° C. for 15-35 minutes. The reaction temperature of the present invention is preferably 39° C., and the reaction time is preferably 30 minutes.

[0031] The present invention also provides use of the detection reagent or the detection kit in preparing a product for identifying Staphylococcus aureus and its active state.

[0032] In the present invention, unless otherwise specified, all components or reagents are commercially available products well known to those skilled in the art.

[0033] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0034] Example 1 Determination of the dosage of SD solution and PMA solution

[0035] 1. Preparation of live / dead Staphylococcus aureus solution

[0036] To prepare a live Staphylococcus aureus culture: 18g of NutrientBroth nutrient broth (purchased from Shanghai Bowei Microbiology Technology Co., Ltd.) was added to 1000mL of distilled water, pH 7.0-7.4, and heated until dissolved. Aliquot 10mL into PA bottles and sterilize at 121°C for 20 minutes before use. Dissolve the glycerol stock at room temperature and inoculate the activated culture at a 1:100 volume ratio, i.e., 100μL was inoculated into 10mL of culture medium. Incubate the culture in a shaker at 37°C and 220rpm for 4-6 hours. At this point, the culture is in its logarithmic growth phase, resulting in a live Staphylococcus aureus culture.

[0037] Preparation of killed Staphylococcus aureus bacterial solution: 500 μL of live Staphylococcus aureus bacterial solution was placed in a centrifuge tube, 75% ethanol was added at a volume ratio of 1:1, and the mixture was reacted for 30 minutes. The mixture was centrifuged and resuspended to obtain the killed bacterial solution.

[0038] 2. Preparation of SD solution

[0039] (1) Preparation of 0.1 w / v% peptone water: Dissolve 0.1 g of peptone powder in 100 mL of purified water, sterilize by autoclaving, and store at 4°C.

[0040] (2) Dissolve 0.1 g of sodium deoxycholate powder in 1 mL of 0.1 w / v% peptone water to prepare a 10 w / v% SD solution as a stock solution;

[0041] (3) Add 10 w / v% SD solution to 500 μL of live bacterial suspension in the logarithmic growth phase to make the final concentration of SD solution 0%, 0.02%, 0.04%, 0.08%, 0.10% and 0.50%. Incubate on a shaker at room temperature for 20 minutes to ensure that the SD solution and bacterial suspension are fully fused and in contact. Measure OD every two hours. 600 , verify the effect of different gradients of SD reagent on live bacterial solution, and at the same time, the bacterial solution treated after incubation was diluted 8 times continuously and spread on the plate, and the counts were observed after 12-24 hours to explore the effect of SD solution on live Staphylococcus aureus. Figure 1As the concentration of SD solution increased, the inhibitory effect of SD solution on bacterial growth gradually increased, especially at concentrations of 0.08% and 0.10%, where the inhibitory effect was most significant. SD solution concentrations ≤ 0.04% had no effect on live bacteria. The final concentration of 0.04% SD solution was selected for subsequent experiments.

[0042] 3. Preparation of PMA solution

[0043] (1) Preparation of 20 v / v% dimethyl sulfoxide (DMSO) solution: Dissolve 100 μL of dimethyl sulfoxide solution in 400 μL of ddH2O to prepare 500 μL of 20 v / v% DMSO solution.

[0044] (2) Preparation of PMA solution: 10 μL of 20 mM propidium azide bromide solution (PMA) was dissolved in 390 μL of 20% DMSO solution to prepare a 0.5 mM PMA solution as a stock solution for subsequent experiments.

[0045] (3) Add 0.5mM PMA solution to 500μL dead bacteria solution, so that the final concentration of PMA solution is 0μM, 5μM, 10μM, 20μM, 30μM, and 50μM. Explore the optimal concentration of PMA for dead bacteria solution of Staphylococcus aureus. After adding PMA solution, place the dead bacteria solution sample on a 220rpm shaker at room temperature and incubate in the dark for 10 minutes to allow the dye to fully fuse with the dead bacteria solution DNA. Then expose it to 650W halogen lamp for 15 minutes. Shake the solution every 1 minute to ensure that the solution sample is fully exposed to the light. After the illumination is completed, centrifuge at 10000rpm for 1-3 minutes and resuspend. Extract DNA as a template for the reaction for fluorescent RPA nucleic acid amplification. The experimental results show that after concentration experimental testing, PMA concentrations of 30μM-50μM can completely inhibit the amplification of dead bacteria solution DNA. 30μM PMA solution was selected as the final concentration for subsequent experiments.

[0046] Example 2 Primer design and screening

[0047] Based on the genome sequence of Staphylococcus aureus nuc, primers and probes were designed as shown in Table 1.

[0048] Table 1 Primers and probes

[0049]

[0050] Reactions were performed with F1R1, F2R2, and F3R3 at different nucleic acid concentrations (0.5 ng / μL and 1 ng / μL). Primer screening and validation were performed using the following steps.

[0051] 1. The preparation of live Staphylococcus aureus bacterial solution was the same as in Example 1.

[0052] 2. The preparation of SD solution is the same as in Example 1.

[0053] 3. The preparation of PMA solution was the same as in Example 1.

[0054] 4. Bacterial sample processing and template DNA extraction

[0055] Add 10 w / v% SD solution to the bacterial sample to a final concentration of 0.04 w / v%. Incubate at room temperature on a shaker for 20 minutes. Then, add 0.5 mM PMA solution to a final concentration of 30 μM. Incubate at room temperature on a shaker at 220 rpm in the dark for 10 minutes to allow the dye to fully fuse with the DNA of the dead bacteria. Then, expose the sample to light using a 650W halogen lamp for 15 minutes, shaking the solution every 1 minute to ensure adequate exposure. After illumination, resuspend the sample by centrifugation at 10,000 rpm for 1-3 minutes.

[0056] The DNA extraction procedure includes the following steps: centrifuge the treated sample at 10,000 rpm for 1 minute, discard the culture medium, add 180 μL Lysozyme (Vazyme #DE103), and incubate at 37°C in a water bath for 2 hours. Sequentially add 20 μL Proteinase K and 200 μL Buffer BCL, and incubate at 56°C in a water bath for 10 minutes. Add 150 μL anhydrous ethanol and briefly centrifuge to collect the liquid. Place the adsorption column in a collection tube, transfer the liquid to the adsorption column, and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate, add 500 μL Buffer WA (DC112-01-AD), and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate, add 600 μL Buffer WB (DC112-01-AE), and centrifuge at 12,000 rpm for 1 minute. Repeat this step twice, discard the filtrate, centrifuge the empty column at 12,000 rpm for 1 minute, and let it stand at room temperature for 2-5 minutes to allow the ethanol to evaporate. Transfer the adsorption column to a new 1.5 mL EP tube, add 50-200 μL of Elution Buffer (Cat. No.: DC112-01-AF) to the center of the adsorption column, place at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, discard the adsorption column, and collect the DNA solution.

[0057] 5. Fluorescent RPA Isothermal Nucleic Acid Amplification

[0058] Prepare the following reaction system in a 200μL EP tube: 25μL buffer, 2.1μL forward primer (10μM), 2.1μL reverse primer (10μM), 0.6μL fluorescent probe, and 2μL template DNA. Fill the tube to 47μL with ddH2O. Transfer the 47μL reaction solution to the lyophilized reaction powder and mix thoroughly to dissolve. Add 3μL of initiator and a 2mm diameter steel ball. Mix thoroughly by flicking. Allow the solution to adhere to the wall or lid after mixing. Briefly centrifuge to concentrate the solution. Incubate the tube at 39°C for 30 min.

[0059] The amplification results of the three pairs of primers are as follows Figure 2 As shown in the figure, the experiment proved that F1R1 (tube1 and tube2), F2R2 (tube3 and tube4), and F3R3 (tube5 and tube6) were amplified at different gradients of low DNA concentration. The F3R3 result showed the earliest obvious fluorescence increase and reached the maximum value (5000mV) in the shortest time, with good sensitivity and specificity. Therefore, the F3R3 combination was selected as the primer for subsequent experiments.

[0060] Example 3 SD-PMA-fluorescence RPA detection of live / dead Staphylococcus aureus

[0061] 1. The preparation of live / dead Staphylococcus aureus liquid was the same as in Example 1.

[0062] 2. The preparation of SD solution is the same as in Example 1.

[0063] 3. The preparation of PMA solution was the same as in Example 1.

[0064] 4. The steps of bacterial liquid sample processing and template DNA extraction are the same as those in Example 2.

[0065] 5. Fluorescent RPA Isothermal Nucleic Acid Amplification

[0066] Prepare the following reaction system in a 200μL EP tube: 25μL buffer, 2.1μL forward primer Nuc-F3 (10μM), 2.1μL reverse primer Nuc-R3 (10μM), 0.6μL fluorescent probe (10μM), and 2μL template DNA. Make up to 47μL with ddH2O. Transfer the 47μL reaction solution to the lyophilized reaction powder and mix thoroughly. Add 3μL of the initiator solution and a 2mm diameter steel ball. Mix thoroughly by flicking. Allow the solution to adhere to the wall or lid after mixing. Briefly centrifuge to concentrate the solution. Incubate the tube at 39°C for 30 min.

[0067] 6. Result determination

[0068] The fluorescence curve reaction results were obtained by fluorescence RPA reaction equipment (AxxinT8-1SO). Figure 3 As shown, the live Staphylococcus aureus suspension exhibited an amplification curve, while the dead Staphylococcus aureus suspension did not. The criteria for determining the results are as follows: PMA in the live Staphylococcus aureus suspension reaction does not penetrate the living bacteria, so their DNA will be amplified in the fluorescent RPA nucleic acid amplification experiment, producing a fluorescence curve. However, PMA in the dead Staphylococcus aureus suspension penetrates the damaged cell membranes of the dead bacteria, binds to their DNA, and inhibits its amplification, resulting in no fluorescence curve in the subsequent fluorescent RPA experiment.

[0069] Example 4

[0070] Prepare different concentrations (0-10 5 The sensitivity of the detection method was determined by detecting the changes in the fluorescence signal of DNA with different concentrations using the steps described in Example 3. Figure 4 The minimum detection limit of SD-PMA-fluorescent RPA isothermal amplification is 10 copies / μL. The existing SD-PMA-conventional PCR has a detection limit of 100 copies / μL, which is relatively low in sensitivity and unsuitable for trace samples. The SD-PMA-fluorescent RPA experiment can obtain results within 15-30 minutes. The SD-PMA-PCR experiment takes 35-60 minutes through the denaturation-annealing-extension steps, followed by gel electrophoresis to observe the amplification results, a total of 1-1.2 hours. The SD-PMA-fluorescent RPA experiment is approximately 60% shorter than conventional PCR experiments, offering better sensitivity and high timeliness.

[0071] In summary, the SD-PMA-fluorescence RPA of the present invention can efficiently identify Staphylococcus aureus and its activity state in a short time, while avoiding false positive results, and is more suitable for real-time trace rapid detection.

[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A detection reagent for Staphylococcus aureus and its activity state, characterized in that: The detection reagent includes a primer pair and a fluorescent probe. The primer pair includes a forward primer and a reverse primer, and the sequences are shown in SEQ ID NO: 5 and SEQ ID NO:

6. The sequence of the fluorescent probe is shown in SEQ ID NO: 7-functional molecular group-SEQ ID NO:

8.

2. The detection reagent according to claim 1, wherein The functional molecular group includes one or two of i6FAM and iBHQ.

3. A detection kit for Staphylococcus aureus and its activity state, characterized in that: The detection kit contains the detection reagent according to claim 1 or 2.

4. The detection kit according to claim 3, characterized in that The detection kit further comprises SD solution and PMA solution.

5. A method for detecting Staphylococcus aureus and its activity state for non-disease diagnosis purposes, characterized in that: The following steps are involved: The sample was treated with SD solution and PMA solution in sequence to obtain a treated sample solution; Extracting DNA from the treated sample solution, and performing fluorescent RPA isothermal nucleic acid amplification using the detection reagent according to claim 1 or 2; When the sample contains live Staphylococcus aureus, a fluorescence curve is generated, and when the sample contains only dead Staphylococcus aureus or no Staphylococcus aureus, no fluorescence curve is generated.

6. The detection method according to claim 5, wherein: The final concentration of the SD solution is ≤0.04 w / v%.

7. The detection method according to claim 5, wherein The final concentration of the PMA solution is 25-50 μM.

8. The detection method according to claim 5, wherein: The step of sequentially treating the sample with the SD solution and the PMA solution comprises: adding the SD solution to the sample for treatment, adding the PMA solution to incubate in the dark, and then irradiating with a halogen lamp.

9. The detection method according to claim 5, wherein: Preparation of the fluorescent RPA isothermal nucleic acid amplification reaction system includes: adding 25 μL of buffer, 2.1 μL of 10 μM forward primer, 2.1 μL of 10 μM reverse primer, 0.6 μL of 10 μM fluorescent probe and 2-5 μL of template DNA, filling up to 47 μL with ddH2O, transferring 47 μL of reaction solution to reaction lyophilized powder, mixing, adding a starter, mixing and centrifuging; the reaction conditions of the fluorescent RPA isothermal nucleic acid amplification include: reaction at 37-41°C for 15-35 minutes.

10. Use of the detection reagent according to claim 1 or 2 or the detection kit according to claim 3 or 4 in the preparation of a product for identifying Staphylococcus aureus and its active state.

Images