Method for identifying pitaya varieties

By detecting specific nucleotide sequences in the dragon fruit genome and using PCR amplification technology, a kit for identifying 'bird's nest fruit' or 'Peruvian bird's nest fruit' has been developed, solving the problem of dragon fruit variety differentiation and achieving efficient variety identification.

CN120442834BActive Publication Date: 2026-07-07SOUTH CHINA AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2025-04-17
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Current technology makes it difficult to accurately distinguish between different varieties of dragon fruit, especially 'Bird's Nest Fruit' and 'Peruvian Bird's Nest Fruit', which are difficult to identify with the naked eye alone.

Method used

A kit for identifying 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' was developed by detecting molecular markers in the nucleotide sequence of the dragon fruit genome, as shown in SEQ ID No.:1, and using PCR amplification technology with primers shown in SEQ ID No.:2 and 3.

Benefits of technology

This method enables the identification of dragon fruit varieties solely through vegetative organs or seeds, which has significant genetic and breeding implications and can effectively distinguish between 'Bird's Nest Fruit' and 'Peruvian Bird's Nest Fruit'.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442834B_ABST
    Figure CN120442834B_ABST
Patent Text Reader

Abstract

The application discloses a method for identifying varieties of pitaya, and the method is used for identifying the varieties of pitaya according to whether a molecular marker shown in a nucleotide sequence as shown in SEQ ID No. 1 exists in a genome of the pitaya to be detected. The method can be used for identifying 'Yanwoguo' and 'Peru Yanwoguo', and can be used for effectively identifying the germplasm of the pitaya by only using vegetative organs or seeds, and has important practical significance in genetic breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of dragon fruit technology, and more specifically, to a method for identifying dragon fruit varieties. Background Technology

[0002] Common types of dragon fruit include red-skinned, red-fleshed dragon fruit, red-skinned, white-fleshed dragon fruit, and yellow-skinned, white-fleshed dragon fruit. They belong to the genus *Hylocereus* in the cactus family. Their flowers open at night and wither at sunrise. Dragon fruit is popular not only for its beautiful appearance but also for its rich nutritional value and diverse ways of preparation. The genus *Selenicereus* is also one of the four nocturnal flowering genera in the cactus family. Some species even have flowers considered among the largest cactus flowers in the world, making them popular among gardening enthusiasts as ornamental plants. Its fruit has a unique and bright appearance, with a red peel and white flesh, representing a new variety of cactus fruit.

[0003] Both *Hylocereus* and *Cereus* belong to the cactus family. Both have climbing, fleshy stems that are triangular or multi-angled, with areoles on the ridges. Their leaves are reduced to spines, and photosynthesis is completed through the fleshy stems. The seeds are numerous and small, black or dark brown, with a smooth or slightly rough surface. Without flowering and fruiting, they are difficult to distinguish accurately with the naked eye. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for identifying dragon fruit varieties.

[0005] The first objective of this invention is to provide a method for identifying dragon fruit varieties.

[0006] A second objective of this invention is to provide an application of a reagent for detecting the presence of molecular markers in the nucleotide sequence of dragon fruit genome, such as those shown in SEQ ID No.:1.

[0007] A third objective of this invention is to provide a set of primers for identifying 'bird's nest fruit' or 'Peruvian bird's nest fruit' dragon fruit.

[0008] The fourth object of this invention is to provide a kit for identifying 'bird's nest fruit' or 'Peruvian bird's nest fruit' dragon fruit.

[0009] To achieve the above objectives, the present invention is implemented through the following technical solution:

[0010] This invention claims protection for a method for identifying dragon fruit varieties, which identifies dragon fruit varieties based on the presence or absence of molecular markers in the nucleotide sequence of the dragon fruit genome as shown in SEQ ID No.:1.

[0011] Preferably, if the molecular marker is present, the dragon fruit to be tested is 'bird's nest fruit' or 'Peruvian bird's nest fruit'; if the molecular marker is absent, the dragon fruit to be tested is neither 'bird's nest fruit' nor 'Peruvian bird's nest fruit'.

[0012] Preferably, the method for detecting whether the molecular marker with the nucleotide sequence shown in SEQ ID No.:1 exists in the genome of the dragon fruit to be tested is as follows: using primers with nucleotide sequences shown in SEQ ID No.:2 and 3, the genomic DNA of the dragon fruit to be tested is amplified by PCR.

[0013] As a specific implementation method, the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0014] The present invention also claims protection for the application of a reagent for detecting the presence of molecular markers, such as those shown in SEQ ID No.:1, in the nucleotide sequence of the dragon fruit genome, said application being in the identification of dragon fruit varieties or in the preparation of kits for identifying dragon fruit varieties.

[0015] Preferably, the reagent is a primer with a nucleotide sequence as shown in SEQ ID No.:2 and 3.

[0016] The present invention also claims protection for a set of primers for identifying 'bird's nest fruit' or 'Peruvian bird's nest fruit' dragon fruit, said primers being shown in SEQ ID No.:2 and 3.

[0017] This invention also claims a kit for identifying 'bird's nest fruit' or 'Peruvian bird's nest fruit' dragon fruit, containing reagents for detecting the presence of molecular markers in the nucleotide sequence of the dragon fruit genome, such as those shown in SEQ ID No.:1.

[0018] Preferably, the reagent is a primer with a nucleotide sequence as shown in SEQ ID No.:2 and 3.

[0019] More preferably, it also contains PCR amplification reagents.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] This invention provides a method for identifying dragon fruit varieties. This method can distinguish between 'Bird's Nest Fruit' and 'Peruvian Bird's Nest Fruit'. It can effectively identify the germplasm of dragon fruit using only vegetative organs or seeds, which has important practical significance in genetic breeding. Attached Figure Description

[0022] Figure 1Transcriptome and quantitative analysis of cDOPA5GT1-2: A shows the expression of cDOPA5GT1-2 in the peel transcriptome of mature dragon fruit 'HHQL' and 'GHB'; B shows the expression analysis of cDOPA5GT1-2 in the peel of mature dragon fruit 'HHQL', 'GHB', and 'WCHL', with 'HHQL' as the standard for normalization. 'HHQL' represents green-skinned, white-fleshed dragon fruit 'Honghua Qinglong', 'GHB' represents red-skinned, white-fleshed dragon fruit 'Guanhua Bai', and 'WCHL' represents yellow-skinned, white-fleshed dragon fruit 'Wuzi Huanglong'.

[0023] Figure 2 Electrophoresis images of HucDOPA5GT1-2 proximal promoter clones from four dragon fruit varieties (lines); M is a 2000bp DNA marker, and lanes 1 to 4 are electrophoresis images of DNA template cloning results from four dragon fruit germplasm resources: 'Yanwoguo', 'Wucihuanglong', 'Guanhuabai', and 'SCAU-QPZR'.

[0024] Figure 3 The specific sequences of the proximal promoters of different dragon fruits HucDOPA5GT1-2 were compared; 'YW' represents 'Yanwoguo', 'WCHL' represents 'Wuzihuanglong', 'GHB' represents 'Guanhuabai', and 'QPZR' represents 'SCAU-QPZR'.

[0025] Figure 4 This study included HucDOPA5GT1-2 promoter-specific insertions for 19 dragon fruit germplasm resources; M represents a 2000bp DNA marker, and lanes 1 to 19 are, in order, 'Yanwoguo', 'Peruvian Yanwoguo', 'Spineless Huanglong', 'Taiwan Dahong', 'Guanhua Hong', 'Hongguan No. 1', 'Hongguan No. 2', 'Hong Shuijing', 'Guanhua Bai', 'SCAU-FJW', 'Bai Shuijing', 'SCAU-YSLRW', 'Hong Yanwoguo', 'SCAU-BHQL', 'SCAU-YS', 'SCAU-QPZR', 'Heilongguo', 'SCAU-S5', and 'SCAU-S8', representing 19 dragon fruit germplasm resources. Detailed Implementation

[0026] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0027] All dragon fruit varieties (lines) used in this invention are preserved in the Dragon Fruit Germplasm Resource Nursery of South China Agricultural University. Among them, 'SCAU-FJW', 'SCAU-YSLRW', 'SCAU-S5', 'SCAU-S8', 'SCAU-QPZR', 'SCAU-BHQL', and 'SCAU-YS' are all collected dragon fruit germplasm resources. 'Guanhua White', 'Red Flower Green Dragon', 'Bird's Nest Fruit', 'Peruvian Bird's Nest Fruit', 'Spineless Yellow Dragon', 'Taiwan Big Red', 'Guanhua Red', 'Red Crown No. 1', 'Red Crown No. 2', 'Red Crystal', 'White Crystal', 'Red Bird's Nest Fruit', and 'Black Dragon Fruit' are all common dragon fruit varieties (lines).

[0028] Example 1: Transcriptome analysis of green-skinned, white-fleshed dragon fruit and red-skinned, white-fleshed dragon fruit

[0029] I. Experimental Methods

[0030] Mature peels of green-skinned, white-fleshed dragon fruit 'Honghua Qinglong' and red-skinned, white-fleshed dragon fruit 'Guanhua Bai' were collected from the dragon fruit germplasm resource nursery of South China Agricultural University for transcriptome sequencing.

[0031] II. Experimental Results

[0032] Sequencing results showed that the expression level of the betaine synthesis-related structural gene HucDOPA5GT1-2 (HU07G00240.1, PGMD, http: / / www.pitayagenomic.com / ) differed significantly between the two dragon fruit germplasm resources, 'Honghua Qinglong' and 'Guanhua Bai'. Figure 1 A in the middle.

[0033] Example 2: The effect of HucDOPA5GT1-2 on betaine accumulation and peel color difference in dragon fruit.

[0034] I. Experimental Methods

[0035] The pericarps of mature 'Honghua Qinglong', 'Guanhua Bai', and 'Wuci Huanglong' varietals were collected, and the expression of HucDOPA5GT1-2 was detected by RT-qPCR.

[0036] The method is as follows:

[0037] RNA was extracted from dragon fruit of 'Honghua Qinglong', 'Guanhua Bai', and 'Wuzi Huanglong' varieties using a polysaccharide and polyphenol plant RNA extraction kit (Huayueyang, Beijing). PrimeScript was used to extract RNA. TM First-strand cDNA was synthesized using the RT reagent kit with gDNA Eraser (Perfect RealTime) (TaKaRa, Japan). Specific primers were designed based on the obtained full-length cDNA sequence.

[0038] F(5'-3'):TCCACCATCCAAATTGCCGA;

[0039] R(5'-3'):GAGCTTGTCGGTGTTCTCGA.

[0040] The target gene was quantitatively analyzed using ChamQ SYBR Color qPCR Master Mix (Novizan, Nanjing). After the reaction, 2... -△△CT Data processing was performed using the method described above, and all experiments were repeated three times.

[0041] II. Experimental Results

[0042] The results are shown below. Figure 1 In the study of B, it was found that HucDOPA5GT1-2 was expressed at low levels in green-skinned dragon fruit (which accumulates almost no betaine), while it was expressed at high levels in red-skinned dragon fruit (which mainly accumulates betaine) and yellow-skinned dragon fruit (which mainly accumulates betaine xanthophyll). It is believed that HucDOPA5GT1-2 is a key gene affecting betaine accumulation and peel color differences in dragon fruit.

[0043] Example 3: Cloning of the HucDOPA5GT1-2 proximal promoter

[0044] I. Experimental Methods

[0045] The HucDOPA5GT1-2 promoter sequence was obtained from the dragon fruit genome database PGMD (http: / / www.pitayagenomic.com / ), and primers were designed to clone the HucDOPA5GT1-2 proximal promoter sequences of four dragon fruit germplasm resources: 'Yanwoguo', 'Wucihuanglong', 'Guanhuabai', and 'SCAU-QPZR'.

[0046] The specific method is as follows:

[0047] 1. Extract total DNA

[0048] Tender shoots of 'Yanwoguo', 'Wuzhenhuanglong', 'Guanhuabai', and 'SCAU-QPZR' were collected from the dragon fruit germplasm resource nursery of South China Agricultural University for DNA extraction (see Table 1 for details).

[0049] DNA was extracted using a plant genomic DNA rapid extraction kit (Aidelai, Beijing). Since dragon fruit is a polysaccharide material, an additional Tris-saturated phenol / chloroform (1:1) extraction step was added during DNA extraction. ScanDrop was used. 2DNA concentration, purity, and integrity were detected using a nucleic acid detector (Analytikjena, Germany) and 1.2% agarose gel electrophoresis, and stored at -20°C for later use.

[0050] Table 1

[0051]

[0052] 2. PCR amplification and electrophoresis

[0053] The cloning primers proGT-KL are as follows:

[0054] proGT-KL-F:TTGACTTGGTCAAAACGTTAAG;

[0055] proGT-KL-R:TCTCTCTTTCTCACTTTCTCTTT.

[0056] PCR amplification was performed using a 50 μL reaction system: 25.0 μL of 2×Phanta Max Master Mix (Dye Plus) (Novazia, Nanjing), 2.0 μL of genomic DNA (concentration 80 ng / μL), 2.0 μL each of forward and reverse primers, and 19.0 μL of ddH2O.

[0057] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min. PCR amplification products were detected by 1.2% agarose gel electrophoresis and observed and photographed using a UV gel imaging system (Bio-Rad, USA).

[0058] II. Experimental Results

[0059] Electrophoresis results are shown Figure 2 The results showed that using proGT-KL as the cloning primer and 'Yanwoguo' DNA as the template, a product of approximately 1600 bp in length could be obtained; while using 'Wuzhenhuanglong', 'Guanhuabai', and 'SCAU-QPZR' DNA as templates, the amplification product was approximately 1200 bp.

[0060] Using DNAMAN software to compare the sequencing results, a 458bp insertion was found in the promoter of 'Bird's Nest Fruit' HucDOPA5GT1-2, approximately 160bp from the transcription start site. Its nucleotide sequence is shown in SEQ ID No.:1. Figure 3 ).

[0061] The specific sequence is as follows:

[0062] CGAAAACCATTCTTTGATTGGTAATAAATTGTTCGTTAATTATATTAGTTGTT

[0063] CACTATCAATTATTTGTATTAATATTTTTCATTAATTGTTTCTAACAAAAGTAC

[0064] TTGATAGAATTAATTATTTAAAAAAAAAAAAGACTAATTATCAAAACTTCAT

[0065] AGTGGGAACTTTTTTACTCTTGCTTTTTAGAACAAACAAACATGAGTATTTC

[0066] AAAAGACTAATATACAAACACGCATTGATCGAAGTGGTTTGACATTTATTTA

[0067] TTTTAAACAAGACTTCAGGTTCCAGTTATAAATAAAAAAAAATCTATAATGA

[0068] ACAAATATTATCCCTTATTAAATCAACAGTAATTTGAATTCAATAAAATGGAG

[0069] GAATCAAGACACCAAAAAAAAAAAATCCAAATTCTTTATTCTCACCCATCGACCTCTTTAATCGTACATAATACAAGTGTATAGTCCCAC.

[0070] Example 4: Detection of dragon fruit germplasm resources

[0071] I. Experimental Methods

[0072] Nineteen dragon fruit germplasm samples were randomly collected from the dragon fruit germplasm resource nursery of South China Agricultural University (see Table 2), and total DNA was extracted according to the method in Example 3.

[0073] Amplification was performed on the 458bp (SEQ ID No.:1) insert fragment in the HucDOPA5GT1-2 promoter from Example 3. Primers designed based on its sequence are as follows:

[0074] proGT-JD-F:CGAAAACCATTCTTTGATTGGTA(SEQ ID No.:2);

[0075] proGT-JD-R: GTGGGACTATACACTTGTATTATGTACG (SEQ ID No.: 3).

[0076] The total DNA from dragon fruit germplasm in Table 2 was amplified by PCR using proGT-JD primers. The PCR reaction system and amplification procedure were the same as in Example 3.

[0077] Table 2

[0078]

[0079]

[0080] II. Experimental Methods

[0081] The results are as follows Figure 4 As shown, the results indicated that PCR amplification using proGT-JD-F and proGT-JD-R primers only produced a 458bp amplification product using 'Yanwoguo' and 'Peruvian Yanwoguo' dragon fruit DNA as templates; no amplification products were produced for other dragon fruit DNAs. This marker was named YW-BJ1. Figure 4 Therefore, primers proGT-JD-F and proGT-JD-R can be used to identify 'Bird's Nest Fruit' and 'Peruvian Bird's Nest Fruit' dragon fruit.

[0082] Example 5: A method for detecting 'bird's nest fruit' and 'Peruvian bird's nest fruit'

[0083] Extract DNA from the sample to be tested and amplify the sample DNA using the methods shown in SEQ ID No.:2 and 3.

[0084] The PCR amplification program used a 50 μL reaction system. The reaction system included: 25.0 μL of 2×Phanta Max Master Mix (DyePlus) (Novazia, Nanjing), 2.0 μL of genomic DNA (concentration 80 ng / μL), 2.0 μL each of forward and reverse primers, and 19.0 μL of ddH2O.

[0085] The amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min. PCR amplification products were detected by 1.2% agarose gel electrophoresis and observed and photographed using a UV gel imaging system.

[0086] If a 458bp amplification product is present, the sample to be tested is either 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' dragon fruit; otherwise, the sample to be tested is neither 'Bird's Nest Fruit' nor 'Peruvian Bird's Nest Fruit' dragon fruit.

Claims

1. A method for identifying dragon fruit varieties, characterized in that, The genomic DNA of the dragon fruit to be tested was amplified by PCR using primers with nucleotide sequences as shown in SEQ ID No:2 and SEQ ID No:

3. The variety of dragon fruit was identified by the presence of a molecular marker with nucleotide sequences as shown in SEQ ID No:1 in the amplified product. If the molecular marker was present, the dragon fruit to be tested was either 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit'. If the molecular marker was not present, the dragon fruit to be tested was either 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit'.

2. The method according to claim 1, characterized in that, The PCR amplification program was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 60 °C annealing for 15 s, 72 °C extension for 30 s, 35 cycles; 72 °C extension for 5 min.

3. The application of a reagent for detecting the presence of molecular markers in the nucleotide sequence of dragon fruit genome as shown in SEQ ID No:1, characterized in that, The application is in the identification of dragon fruit varieties or in the preparation of kits for identifying dragon fruit varieties. The reagents are primers with nucleotide sequences as shown in SEQ ID No:2 and SEQ ID No:

3. The primers are used to perform PCR amplification of the genomic DNA of the dragon fruit to be tested. The dragon fruit variety is identified by the presence or absence of a molecular marker with a nucleotide sequence as shown in SEQ ID No:1 in the amplified product of the dragon fruit genome. If the molecular marker is present, the dragon fruit to be tested is 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' dragon fruit. If the molecular marker is absent, the dragon fruit to be tested is not 'Bird's Nest Fruit' or 'Peruvian Bird's Nest Fruit' dragon fruit.