Nano PCR (polymerase chain reaction) kit for detecting border virus, application of nano PCR kit and method for visually detecting border virus
By designing specific primers and constructing a nano-PCR kit using gold nanoparticles, and optimizing the reaction system, the problems of expensive detection equipment and low sensitivity in existing technologies have been solved. This kit achieves high sensitivity and specificity for the detection of sheep border viruses and is suitable for promotion in grassroots veterinary stations.
Patent Information
- Application Number
- CN202510550287.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-08-08
AI Technical Summary
Existing methods for detecting sheep border viruses rely on expensive equipment and complex probe design systems, making them difficult to promote in primary veterinary clinics, and they also have low sensitivity.
We designed specific primers and gold nanoparticles, constructed a nano-PCR kit, optimized reaction system parameters, and achieved visual detection.
It improves detection sensitivity by 100 times and lowers the detection limit to 1.1×10¹ copies/μL, making it suitable for widespread application in clinical primary veterinary stations. It has high sensitivity and specificity and is suitable for the detection of complex samples.
Smart Images

Figure CN120442857A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of virus detection, and in particular relates to a nano PCR kit for detecting sheep border virus, and a method for its application and visual detection of sheep border virus. Background Art
[0002] Border Disease Virus (BDV), a highly pathogenic pathogen that has emerged in recent years, can cause respiratory syndrome, gastrointestinal ulcers, and immunosuppressive diseases in ruminants such as goats and sheep, leading to a 30% to 50% mortality rate in young animals and posing a serious threat to the economic security of the livestock industry. Current virus detection relies primarily on electron microscopy, virus isolation and culture, and conventional PCR techniques. However, these traditional methods suffer from low sensitivity and long cycle times. While real-time fluorescence quantitative PCR offers high sensitivity, it relies on expensive temperature cyclers and complex probe design systems, making it difficult to promote in primary veterinary clinics. Summary of the Invention
[0003] Based on this, the present application provides a nano-PCR kit for detecting sheep border virus, and a method for application and visualization of sheep border virus detection, in order to solve the technical problems in the prior art of expensive detection instruments, complex probe design systems, and difficulty in promotion in clinical grassroots veterinary stations.
[0004] The technical solutions of this application to solve the above technical problems are as follows:
[0005] A nano-PCR kit for detecting sheep border virus, comprising: an upstream primer BDV5'UTR-F, a downstream primer BDV 5'UTR-R, sheep border virus cDNA, and gold nanoparticles;
[0006] The upstream primer BDV 5'UTR-F: 5'-CGTGGTGAGATCCCTGAGC-3';
[0007] The downstream primer BDV 5'UTR-R: 5'-CACCCTATCAGGTTGTAAC-3';
[0008] The sheep border virus cDNA is BDV 5'UTR cDNA:
[0009] 5'-CGTGGTGAGATCCCTGAGCGGTCTAAGCCCTGAGTACAGGGCAGTCGTCAGTAGTTCGACTCAATCACCGGATTGACTCGAGATGCTATGTGGACGAGGGCACGCCCAAGACACGCTTTAGCCCTGGCAGGGGTCGCCAGGGTGAAAATGCCAAATGGCATTGGGGTTACAACCTGATAGGGTG-3'.
[0010] Preferably, in the above-mentioned nano-PCR kit for detecting ovine border virus, the nano-gold particles have a particle size of 10 nm and a concentration of 0.8 nM.
[0011] Application of the above nano-PCR kit in the visual detection of sheep border virus.
[0012] Preferably, in the above application, when this kit is used to detect sheep border virus, its nano PCR reaction system includes: prepared according to a 25 μL system: 12.5 μL of One-Step RT-PCR premix, 2 μL of pMD-BDV-5'UTR recombinant plasmid, 1.4 μL of upstream BDV5'UTR-F, 1.4 μL of downstream primer BDV 5'UTR-R, and 6.9 μL of DEPC water. If the amount is less than 25 μL, DEPC water is used to make up.
[0013] Preferably, in the above application, the nano-PCR reaction conditions are: 95°C for 5 min; 94°C for 30 s, 56°C for 30 s, 72°C for 60 s, 35 cycles; 72°C for 10 min.
[0014] A method for visually detecting sheep border virus, using the above kit for detection, comprises the following steps:
[0015] After the sample to be tested is added to the nano-PCR kit and amplified by a PCR instrument, the PCR product is subjected to 1.5% agarose gel electrophoresis to observe the band size.
[0016] Compared with the prior art, this application has at least the following advantages:
[0017] This application designed specific primers based on the 5'UTR gene sequence of the conserved structural protein of BDV. By optimizing the reaction system parameters, a BDV nano-PCR (Nano-PCR) detection system was successfully constructed. Its sensitivity, specificity, and clinical applicability were compared and analyzed, and parallel validation was performed with conventional PCR methods. The results showed that the optimized Nano-PCR can stably amplify a BDV-specific target of 210 bp, with a minimum detection limit of 1.1×10 1copies / μL, and the sensitivity is higher than that of ordinary PCR (1.1×10 3 copies / μL) increased by 100 times. In the specificity test, this method had no cross-amplification for bovine viral diarrhea virus, peste des petits ruminants virus and sheep pox virus. The test of 50 suspected infected samples showed that the Nano-PCR positive detection rate was 6% (3 / 50), which was completely consistent with the traditional PCR results. In summary, the BDV Nano-PCR technology established in this study has higher sensitivity and specificity than the ordinary PCR method, and can provide technical support for the early diagnosis and epidemiological monitoring of viral infection at the border of sheep flocks. In addition, the detection method is simple, without a complex probe design system, and the equipment has strong universality (compatible with ordinary PCR instruments), which is particularly suitable for promotion and application in clinical grassroots veterinary stations. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 PCR amplification diagram of the recombinant plasmid pMD-BDV-5'UTR; M: 500bp DNA molecular mass standard; 1: nano PCR product (BDV 5'UTR gene); 2: ordinary PCR product (BDV 5'UTR gene); 3: negative control.
[0019] Figure 2 Optimization of PCR primer volume; A: conventional PCR, B: nano-PCR; M: 500bp DNA molecular mass standard; Primer volume: 1: 0.4μL; 2: 0.6μL; 3: 0.8μL; 4: 1.0μL; 5: 1.2μL; 6: 1.4μL; 7: 1.6μL; 8: 1.8μL; 9: negative control.
[0020] Figure 3 Optimization of PCR primer annealing temperature; A: conventional PCR, B: nano-PCR; M: 500bp DNA molecular mass standard; annealing temperature: 1: 55℃; 2: 56℃; 3: 57℃; 4: 58℃; 5: 59℃; 6: 60℃; 7: 61℃; 8: 62℃; 9: negative control.
[0021] Figure 4 Optimized for the size of gold nanoparticles; M: 500bp DNA molecular mass standards: 1: 10nm; 2: 40nm.
[0022] Figure 5 For the optimization of nanogold concentration; M: 500bp DNA molecular mass standard, nanogold concentration: 1: 0.1nM; 2: 0.2nM; 3: 0.3nM; 4: 0.4nM; 5: 0.5nM; 6: 0.6nM; 7: 0.7nM; 8: 0.8nM; 9: 0.9nM; 10: 1nM, 11: negative control.
[0023] Figure 6 The sensitivity test results are shown in Figure 2. A: conventional PCR, B: nano-PCR; M: 500 bp DNA molecular mass standard, plasmid dilution ratio: 1:1.1×10 10 copies / μL; 2:1.1×10 9 copies / μL; 3:1.1×10 8 copies / μL; 4:1.1×10 7 copies / μL; 5:1.1×10 6 copies / μL; 6:1.1×10 5 copies / μL; 7:1.1×10 4 copies / μL; 8:1.1×10 3 copies / μL; 9:1.1×10 2 copies / μL;10:1.1×10 1 copies / μL, 11: negative control.
[0024] Figure 7 Specificity detection results, A: conventional PCR, B: nano-PCR; M: 500bp DNA molecular mass standard; 1: BVDV; 2: PPRV; 3: CEV.
[0025] Figure 8 These are some test results of clinical samples. A: conventional PCR, B: nano-PCR; M: 500bp DNA molecular mass standard; 1 to 20: some clinical samples. DETAILED DESCRIPTION
[0026] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments of the present invention can be combined with each other. The following will further describe the technical solution of the present invention in conjunction with the drawings of the embodiments of the present invention, and the present invention is not limited to the following specific embodiments.
[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this application pertains. The terms used in the specification herein are for the purpose of describing specific embodiments only and are not intended to limit this application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0028] In one embodiment of the present application, a nano-PCR kit for detecting sheep border virus is provided, wherein the nano-PCR kit comprises: an upstream primer BDV 5'UTR-F, a downstream primer BDV 5'UTR-R, sheep border virus cDNA, and gold nanoparticles; wherein the upstream primer BDV 5'UTR-F is: 5'-CGTGGTGAGATCCCTGAGC-3';
[0029] The downstream primer BDV 5'UTR-R: 5'-CACCCTATCAGGTTGTAAC-3';
[0030] The sheep border virus cDNA is BDV 5'UTR cDNA: 5'-CGTGGTGAGATCCCTGAGCGGTCTAAGCCCTGAGTACAGGGCAGTCGTC AGTAGTTCGACTCAATCACCGGATTGACTCGAGATGCTATGTGGACGAGGG CACGCCCAAGACACGCTTTAGCCCTGGCAGGGGTCGCCAGGGTGAAAATG CCAAATGGCATTGGGGTTACAACCTGATAGGGTG-3'.
[0031] Preferably, the nanogold particles have a particle size of 10 nm and a concentration of 0.8 nM. During the Nano-PCR system optimization process, in experiments optimizing the nanogold particle size and concentration, nanogold particles with a particle size of 10 nm and 40 nm were able to amplify, but the 10 nm particle amplification effect was superior. Nanogold particles of varying concentrations were able to amplify, with the 0.8 nM nanogold particle amplification band being the brightest. Therefore, the nanogold particles in the Nano-PCR kit preferably have a particle size of 10 nm and a concentration of 0.8 nM.
[0032] Application of the above nano-PCR kit in the visual detection of sheep border virus.
[0033] In a preferred embodiment, when this kit is used to detect sheep border virus, its nano-PCR reaction system includes: a 25 μL system prepared with: 12.5 μL of One-Step RT-PCR premix, 2 μL of pMD-BDV-5'UTR recombinant plasmid, 1.4 μL of upstream BDV 5'UTR-F, 1.4 μL of downstream primer BDV 5'UTR-R, and 6.9 μL of DEPC water. If the amount is less than 25 μL, DEPC water is used to make up the difference.
[0034] Furthermore, the nano-PCR reaction conditions are: 95°C for 5 min; 94°C for 30 s, 56°C for 30 s, 72°C for 60 s, 35 cycles; 72°C for 10 min.
[0035] A method for visually detecting sheep border virus, using the above kit for detection, comprises the following steps:
[0036] After the sample to be tested is added to the nano-PCR kit and amplified by a PCR instrument, the PCR product is subjected to 1.5% agarose gel electrophoresis to observe the band size.
[0037] For example, 2 μL of a clinical sample (serum) was added to the nanoPCR kit and amplified using a PCR instrument. The PCR reaction system consisted of a pre-denaturation step at 95°C for 5 minutes, followed by 35 cycles of 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 60 seconds, and finally 72°C for 10 minutes. After PCR amplification, the PCR product was electrophoresed on a 1.5% agarose gel to analyze the band size. It's worth noting that clinical samples are not limited to serum; they can also include nasal swabs, spleen tissue samples, and more.
[0038] It is worth noting that the method for detecting sheep border virus in the present application is only a method for obtaining information as an intermediate result by detecting tissues and body fluids that have been separated from the animal body.
[0039] The present invention is further described in detail by the following examples, which are only used to understand the present invention and should not be considered as limiting the present invention.
[0040] 1. Experimental Materials and Instruments
[0041] 1.1 Virus strains and clinical samples
[0042] Sheep border virus (BDV)-positive serum and positive plasmids, as well as negative control sample nucleic acids including bovine viral diarrhea virus type 1 (BVDV-1), Peste des Petits Ruminants virus (PPRV), and Caprine enterovirus (CEV) were all preserved by the Ningxia Academy of Agriculture and Forestry Sciences.
[0043] Clinical samples (n=50) were collected from a large-scale sheep farm in Ningxia, including spleen tissue (n=2), sheep serum samples (n=38) and sheep nasal swabs (n=10). The samples were quick-frozen in liquid nitrogen and then stored at -80°C.
[0044] 1.2 Main Reagents
[0045] Viral genomic RNA extraction kit (R6874), endotoxin-free plasmid extraction kit (D6948), and gel recovery kit (R6376) were all purchased from Omega.
[0046] DL500 DNA molecular weight standard (3425A), One-Step RT-PCR premix (699503), nucleic acid dye GelRed TM (TCH017) were purchased from Bioray Biotechnology (Beijing) Co., Ltd.
[0047] Gold nanoparticles (Au010010, Au010040) were purchased from Zhongke Leiming (Beijing) Technology Co., Ltd.
[0048] 1.3 Main instruments
[0049] PCR instrument (1861096), gel electrophoresis instrument (1658033) and GelDocXR+ gel imaging system (1708195) were purchased from BIO-RAD.
[0050] 2. Experimental Methods
[0051] 2.1 Primer design
[0052] The BDV 5UTR gene sequence (accession number: KC537789.1), PPRV N gene sequence, BVDV 5'UTR gene sequence (accession number: KM091959), and CEV 5'-UTR gene (accession number: OR829317.1) were downloaded from Genebank. Specific primer pairs were designed using PrimerPremier 6.0 software. The primer sequences are shown in Table 1. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0053] Table 1 Primer information
[0054]
[0055]
[0056] 2.2 Positive plasmid construction
[0057] Referring to the instructions for the viral genomic RNA extraction kit, total RNA was extracted from BDV clinical samples. After reverse transcription to cDNA, PCR amplification was performed using the BDV 5'UTR-specific primer set described above to obtain the target fragments. Each fragment was directionally inserted into the pMD-19T vector using TA cloning technology to construct the recombinant plasmid pMD-BDV-5'UTR. After verification by sequencing, the plasmid purity and concentration were determined using a Nano Drop ultraviolet spectrophotometer, and the copy number was calculated. The verified recombinant plasmid was extracted using an endotoxin-free plasmid extraction kit and prepared as a positive plasmid standard. It was then stored at -80°C until further use.
[0058] 2.3 Optimization of PCR reaction conditions
[0059] The conventional PCR and nanoPCR reaction systems were 25 μL, respectively, containing 12.5 μL of One-Step RT-PCR premix and 2 μL of the pMD-BDV-5'UTR recombinant plasmid. The primer volume (10 μmol / L) was increased by 0.2 μL each time, starting from 0.4 μL, until it reached 1.8 μL, for a total of 8 gradients. Any remaining amount less than 25 μL was supplemented with deionized water. Using the optimal primer concentration, the reaction annealing temperature was further optimized, ranging from 55 to 62°C, for a total of 8 temperature gradients. Finally, the nanoparticle size and concentration for nanoPCR were optimized, with 0.1 nM to 1 nM gold nanoparticles of either 10 nm or 40 nm in diameter added to each reaction system, for a total of 10 gradients. All PCR products were analyzed by 1.5% agarose gel electrophoresis.
[0060] 2.4 Sensitivity test
[0061] The pMD-BDV-5'UTR standard plasmid was diluted 10 times in a row and the concentration was 1×10 1 ~1×10 10 The plasmid with a concentration of 10 copies / μL was subjected to sensitivity test using conventional PCR and nano-PCR reaction systems optimized in 1.6.
[0062] 2.5 Specificity test
[0063] The optimized conventional PCR and nano-PCR reaction systems were used to conduct specificity tests on nucleic acid samples of four pathogens, including BDV, BVDV-1, PPRV, and CEV.
[0064] 2.6 Clinical Sample Testing
[0065] 50 clinical samples were tested using conventional PCR and nano-PCR, and the test results were compared.
[0066] 3 Results
[0067] 3.1 Construction of positive plasmid
[0068] According to the primer sequences in Table 1, the BDV-5'UTR gene fragment was amplified and the target fragment was transformed and connected to the pMD-19T vector to obtain the recombinant plasmid pMD-BDV-5'UTR. The plasmid concentration was 1.1×10 10 copies / uL, and the target band of about 210bp was amplified by conventional PCR and nano-PCR respectively ( Figure 1 ).
[0069] 3.2 Reaction system and condition optimization
[0070] like Figure 2As shown in the primer volume optimization experiment, the amplification was good when the primer volume of the conventional PCR was 1.4-1.8 μL ( Figure 2 A), while the nano-PCR primer volume ranged from 0.4 to 1.8 μL and amplified well ( Figure 2 B), therefore, the primer volume was selected as 1.4 μL in subsequent experiments.
[0071] Table 2 Nano-PCR reaction system
[0072] Reagent name volume DEPC water 6.9 μL BDV5'UTR-F 1.4 μL BDV5'UTR-R 1.4 μL One-Step RT-PCR Master Mix 12.5μL 10μm gold nanoparticles 0.8μL
[0073] like Figure 3 As shown in the annealing temperature optimization experiment, the amplification effect of the common PCR annealing temperature range is good when it is 55℃-57℃, but the amplification effect is poor when it is 58℃-62℃ ( Figure 3 A), while the nano-PCR annealing temperature range was 55℃-62℃, and the amplification effect was the best at 56℃ ( Figure 3 B), so 56°C was selected for subsequent experiments.
[0074] like Figure 4 As shown in the results, in the gold nanoparticle size and concentration optimization experiment, the amplification was achieved when the particle size was 10nm and 40nm, but the amplification effect of 10nm particles was better. Therefore, the subsequent experiments used 10nm gold nanoparticles to further optimize the concentration of gold nanoparticles. Figure 5 As shown, different concentrations of gold nanoparticles can be amplified, among which the amplified band of 0.8nM gold nanoparticles is the brightest.
[0075] 3.3 Sensitivity test
[0076] The pMD-BDV-5'UTR plasmid was diluted 10 times in a row and the concentration was 1.1×10 1 ~1.1×10 10 The sensitivity test of the recombinant plasmid with 100 copies / μL was carried out using the optimized conventional PCR and nano-PCR reaction systems. Figure 6 As shown, the normal PCR amplification range is 1.1×10 1 ~1.1×10 8 copies / μL, nano-PCR amplification range 1.1×10 1 ~1.1×10 10 copies / μL and amplification is good, so the sensitivity of nano-PCR is 100 times that of ordinary PCR.
[0077] 3.4 Specificity experiments
[0078] The established BDV conventional PCR method and nano-PCR method were used to detect three other viral pathogens that are easily mixed with BDV and difficult to directly identify, including BVDV, PPRV and CEV. The results are as follows Figure 7 As shown, both nano-PCR and conventional PCR could only amplify the BDV-5'UTR specific band, indicating that the established PCR method had good specificity.
[0079] 3.5 Clinical sample testing
[0080] 50 suspicious samples (38 clinical sheep serum samples, 10 sheep nasal swabs, and 2 sheep spleen tissue samples) were collected from different regions of Ningxia and tested by conventional PCR and nano-PCR respectively. The results showed that both nano-PCR and conventional PCR detected 3 positive sheep serum samples, and the test results were consistent, but the brightness of the Nano PCR amplification band was higher than that of conventional PCR. Therefore, it is more suitable for the detection of clinical samples.
[0081] This application is the first to design specific primers based on the 5'UTR gene of the conserved structural protein of BDV. By optimizing the nanoparticle concentration and annealing temperature, a BDV nano-PCR detection system was successfully constructed. Compared with conventional PCR, the detection limit of this method was reduced to 1.1×10 1 copies / μL, the sensitivity is increased by 100 times, and it can tolerate a wider annealing temperature range, significantly enhancing the detection stability of complex samples (such as hemolyzed whole blood and tissues). In the verification of 50 clinical samples, the positive coincidence rate of nano-PCR and ordinary PCR reached 100%, and it was successfully detected in 3 samples with low viral load, proving that it is more suitable for monitoring animals with latent infection or recovery period. This method has no cross-reaction to the three pathogens BVDV, PPRV and CEV, and its specificity is 100%. The BDV nano-PCR technology established in this application has high sensitivity, strong anti-interference and equipment universality (compatible with ordinary PCR instruments), and is particularly suitable for large-scale screening in grassroots livestock units.
[0082] The above embodiments merely illustrate several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent application. It should be noted that a person of ordinary skill in the art may make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims.
Claims
1. A nano-PCR kit for detecting ovine border virus, characterized in that: The nano PCR kit includes: Upstream primer BDV 5'UTR-F, downstream primer BDV 5'UTR-R, ovine border virus cDNA, gold nanoparticles; The upstream primer BDV 5'UTR-F: 5'-CGTGGTGAGATCCCTGAGC-3'; The downstream primer BDV 5'UTR-R: 5'-CACCCTATCAGGTTGTAAC-3'; The sheep border virus cDNA is BDV 5'UTR cDNA: 5'-CGTGGTGAGATCCCTGAGCGGTCTAAGCCCTGAGTACAGGGCAGTCGTC AGTAGTTCGACTCAATCACCGGATTGACTCGAGATGCTATGTGGACGAGGG CACGCCCAAGACACGCTTTAGCCCTGGCAGGGGTCGCCAGGGTGAAAATG CCAAATGGCATTGGGGTTACAACCTGATAGGGTG-3'.
2. The nano-PCR kit for detecting sheep border virus according to claim 1, characterized in that: The nano-gold particles have a particle size of 10 nm and a concentration of 0.8 nM.
3. Use of the nano-PCR kit according to any one of claims 1 to 2 in the visual detection of sheep border virus.
4. The use according to claim 3, characterized in that When this kit is used to detect ovine border virus, its nanoPCR reaction system includes: prepared according to a 25μL system: 12.5μL of One-Step RT-PCR premix, 2μL of pMD-BDV-5'UTR recombinant plasmid, 1.4μL of upstream BDV 5'UTR-F, 1.4μL of downstream primer BDV 5'UTR-R, and 6.9μL of DEPC water. If the amount is less than 25μL, use DEPC water to make up.
5. The use according to claim 4, characterized in that The nano-PCR reaction conditions are: 95°C for 5 min; 94°C for 30 s, 56°C for 30 s, 72°C for 60 s, 35 cycles; 72°C for 10 min.
6. A method for visually detecting sheep border virus, characterized in that: The detection is performed using the kit according to any one of claims 1 to 2, comprising the following steps: After the sample to be tested is added to the nano-PCR kit and amplified by a PCR instrument, the PCR product is subjected to 1.5% agarose gel electrophoresis to observe the band size.