Construction and application of streptococcus suis serotype 2 cps2D gene knockout mutant strain

Abstract

The invention discloses construction and application of a streptococcus suis serotype 2 cps2D gene knockout mutant strain. The cps2D gene knockout mutant strain delta cps2D of the streptococcus suis serotype 2, and a coding gene between the 31st site and the 1000th site of the cps2D gene in the 05ZYH33 strain is replaced by a spectinomycin resistance gene cassette. Capsules of the mutant strain are obviously reduced, the capability of resisting phagocytosis of macrophages is reduced, and animal toxicity test results show that the toxicity of the mutant strain is obviously reduced. The mutant strain provides an important clue for screening of protective antigens of multivalent subunit vaccines, and can be applied to development of S.suis attenuated vaccines and multivalent subunit vaccines.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to the construction and application of a Streptococcus suis type 2 cps2D gene knockout mutant. Background Art

[0002] Streptococcus suis is a facultative anaerobic, Gram-positive bacterium and one of the world's most important zoonotic pathogens. It infects pigs, causing a range of diseases, including sepsis, endocarditis, meningitis, arthritis, pneumonia, and even acute mortality, resulting in significant economic losses for the swine industry. Furthermore, S. suis can cross species to infect humans, causing endocarditis, meningitis, permanent deafness, and streptococcal toxic shock syndrome (STSLS). In recent years, the emergence of new serotypes and drug-resistant strains of S. suis has increased the difficulty of disease prevention and control, posing a serious threat to the health of industry practitioners and the general public. Currently, the molecular mechanisms by which S. suis 2 infects and causes disease remain largely unknown. Therefore, further investigation into the functions of novel pathogenicity-associated genes and their role in the interaction between S. suis and its host is crucial for identifying potential vaccine candidates, uncovering the precise molecular mechanisms of its development, and improving the prevention and treatment of S. suis in my country.

[0003] Streptococcus suis can be divided into 29 serotypes based on antigenic differences in their capsular polysaccharides (CPSs). Among them, Streptococcus suis type 2 (S. suis 2) is the most virulent and has the highest clinical detection rate. Studies have shown that the CPSs of S. suis 2 play a key role in protecting the bacteria from phagocytosis by innate immune cells and masking bacterial surface proteins involved in host cell activation. Capsule-deficient mutants of homologous S. suis 2 exhibit avirulence in mouse and pig infection models. CPSs are composed of a unique arrangement of multiple sugars. S. suis CPSs are formed by the repetition of specific oligosaccharide units, including glucose, galactose, N-acetylglucosamine, rhamnose, and sialic acid. The capsular structure and composition of many S. suis serotypes, including serotypes 1, 2, 3, 7, 8, 9, 14, 18, and 1 / 2, have been determined. However, the biosynthetic mechanism of CPSs in S. suis is not fully understood. Genome sequencing of S. suis 2 revealed 25 open reading frames encoding proteins related to glycosyltransferases, CPS polymerases, sialic acid synthases, and regulatory factors, including ORF2Z, ORF2Y, ORF2X, and Cps2A–Cps2V. Among these proteins, seven enzymes may play key roles in the synthesis of CPSs. Zhang et al. constructed multiple CPS mutants, including Δcps2E, Δcps2G, Δcps2J, and Δcps2L, and found that CPS content was significantly reduced in these mutants. Another study demonstrated that an unencapsulated S. suis 2 strain isolated from porcine endocarditis restored CPS expression and virulence after in vivo passage. Furthermore, an unencapsulated strain from porcine endocarditis displayed a high frequency of mutations in two glycosyltransferases, Cps2E and Cps2F. Recent studies have shown that HP0197 regulates CPS synthesis by enhancing the activity of metabolic inhibitor protein A (CcpA). Therefore, as a key virulence factor, CPSs are subject to complex regulation, including gene mutation and transcriptional regulation of genes related to CPS synthesis. Previous research by the research team has shown that the tyrosine kinase / phosphatase signaling system of S. suis 2 plays a key role in CPS synthesis. Therefore, constructing an attenuated strain lacking the CPS capsule is of great significance for the prevention and control of S. suis 2.

[0004] Vaccines, as a safe and effective means of pathogen prevention and control, have become a research hotspot for responding to S. suis 2 infection today. Live attenuated vaccines are traditional vaccines that are based on whole bacteria, have a small vaccination dose, good immune effect, and long-lasting immunity. Recently, subunit vaccines that target bacterial surface proteins have been favored by researchers due to their high safety and low production costs. Subunit vaccines have the advantages of clear components, good safety, mature technology, and ease of industrialization. This type of vaccine is often composed of multiple different components, each component is encoded by a different gene of the pathogen, thereby avoiding vaccine failure due to mutation or loss of a single gene. Therefore, the study of multivalent vaccines has become a trend in the development of new vaccines for S. suis. The screening of more protective antigens is extremely important for the development of multivalent subunit vaccines. The mutant strain of the present invention provides important value for the development of attenuated vaccines and multivalent subunit vaccines. Summary of the Invention

[0005] The object of the present invention is to address the above-mentioned deficiencies in the prior art and to provide a cps2D gene knockout mutant of Streptococcus suisserotype 2.

[0006] Another object of the present invention is to provide applications of the mutant strain.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] A Streptococcus suis serotype 2 cps2D gene knockout mutant strain Δcps2D is characterized in that the cps2D gene encoding gene from position 15 to position 710 (SEQ ID NO. 1) in the 05ZYH33 strain is replaced by a spectinomycin resistance gene cassette (hereinafter referred to as Spc R The method for constructing the type 2 Streptococcus suis cps2D gene knockout mutant comprises the following steps:

[0009] (1) Based on the upstream DNA sequence of the cps2D coding gene in the genome of the wild strain 05ZYH33 of S. suis 2, PCR specific primers LA1 and LA2 were designed; based on the downstream DNA sequence of the cps2D coding gene in the genome of the wild strain 05ZYH33 of S. suis 2, PCR specific primers RA1 and RA2 were designed; using the pSET2 plasmid as a template, a pair of specific primers Spc1 and Spc2 were designed;

[0010] (2) Using 05ZYH33 genomic DNA as a template and LA1 / LA2 and RA1 / RA2 as primers, respectively, the target gene cps2D upstream DNA sequence LA fragment (SEQ ID NO.2) containing EcoRI / SmaI restriction sites at both ends and the target gene cps2D downstream DNA sequence RA fragment (SEQ ID NO.4) containing SalI / SphI restriction sites at both ends were amplified; using pSET2 plasmid as a template and Spc1 / Spc2 as specific primers, the spectinomycin resistance gene cassette (SEQ ID NO.3) containing SmaI / SalI restriction sites at both ends was amplified;

[0011] The PCR products amplified by three primer pairs LA1 / LA2, RA1 / RA2 and Spc1 / Spc2 were detected by 1% agarose gel electrophoresis, and the target fragment sizes were 1030 bp (LA fragment), 1030 bp (RA fragment) and 1130 bp (Spc fragment). R The PCR products were recovered and purified, and double-digested with EcoR I / Sma I, SalI / Sph I, and Sma I / Sal I, respectively. The double-digested products were recovered, purified, and frozen for later use.

[0012] (3) Construction of gene knockout vector pUC::cps2D: Insert the LA fragment-spectinomycin resistance gene cassette-RA fragment into the EcoR I / Sph I restriction enzyme sites of the pUC19 vector to obtain the gene knockout vector pUC::cps2D; specifically, the following steps are included:

[0013] (a) Cloning of LA: The LA fragment, double-digested with EcoR I / Sma I, was ligated into the pUC19 vector, which had been double-digested with the same enzymes. After incubation at 16°C overnight, the ligation product was transformed into DH5a competent E. coli cells. After selection with ampicillin, colonies on the LB plate were selected and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double-digestion with EcoR I / Sma I. The recombinant plasmid containing a DNA fragment of approximately 1030 bp was designated pUC19-LA.

[0014] (b) Spectinomycin resistance gene Spc RCloning of (c) RA: The product of double digestion with Sma I / Sal I was ligated with the recombinant plasmid pUC19-LA, which had been double digested with the same enzymes. After incubation at 16°C overnight, the ligation product was transformed into DH5a E. coli competent cells. After double selection with spectinomycin and ampicillin, colonies on the LB plate were selected and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sma I / Sal I. The recombinant plasmid containing a DNA fragment of approximately 1100 bp was designated pUC19-LS. (c) Cloning of (d) RA: The RA fragment, double digested with Sal I / Sph I, was ligated with the recombinant plasmid pUC19-LS, which had been double digested with the same enzymes. After incubation at 16°C overnight, the ligation product was transformed into DH5a E. coli competent cells. After double selection with spectinomycin and ampicillin, colonies on the LB plate were selected and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and digested with Sal I and Sph I. Positive plasmids containing a DNA fragment of approximately 1030 bp were identified. PCR was then performed using primer pairs LA1 / LA2, RA1 / RA2, Spc1 / Spc2, LA1 / Spc2, Spc1 / RA2, and LA1 / RA2, respectively. The resulting positive recombinant plasmid was named pUC::cps2D.

[0015] (4) Identification of gene knockout vector pUC::cps2D: The positive recombinant gene knockout vector pUC::cps2D was sequenced (BGI Genomics Co., Ltd.). The sequencing results showed that the Spc R The construction of the cps2D target gene with homologous sequences on both sides of the gene and the gene knockout vector pUC::cps2D is completely correct.

[0016] (5) Gene knockout vector pUC::cps2D was electroporated into 05ZYH33 competent cells

[0017] ① Preparation of competent cells of S.suis 2 wild strain 05ZYH33: Pick a single colony of 05ZYH33 and inoculate it into 3 mL THB medium, shake and culture it at 37°C overnight. The next day, transfer it to THY medium containing DL-threonine at 1:50 am and shake and culture it at 37°C until OD 600 When the pH is about 0.3-0.4, collect the bacteria by low-speed centrifugation at 4°C and wash them 4 times with pre-cooled 10% glycerol, each time with not less than 25 mL. Finally, resuspend the bacterial pellet with 0.5 mL of 0.3 M sucrose containing 15% glycerol, and dispense into 50 μL / tubes. Store at -80°C for later use.

[0018] ②Electroporation: Add 10 μL of pUC::cps2D plasmid to 50 μL of competent medium prepared as described above and place in an electroporation cuvette (operate on ice). After electroporation at 22.5 kV / cm, 200 Ω, and 25 μF, add 940 μL of 0.3 M sucrose-containing THB (preheated at 37°C) medium. Incubate at 37°C, 160 rpm, and shake for 2 h. Then, spread the plate on a THB plate containing spectinomycin resistance and incubate at 37°C for 24-48 h. Pick a single colony for identification.

[0019] (6) Preliminary screening of Δcps2D mutants: S. suis colonies were selected from spectinomycin THB plates and cultured in 2 mL of liquid THB (100 mg / mL spc r ) medium. The bacterial suspension was used as a template for preliminary PCR screening using primers CheckIn1 / CheckIn2 (located within the cps2D gene).

[0020] If the cps2D gene is knocked out, PCR amplification will yield a negative result. If a product of the expected size (650 bp) can still be amplified, it indicates that the cps2D gene has not been knocked out. Through this method, a cps2D gene knockout mutant was initially screened and named Δcps2D. (7) Identification of the Δcps2D mutant:

[0021] ① Combined PCR identification: Design a pair of primers Out1 / Out2 on both sides of LA and RA of the upstream and downstream homologous sequences of the cps2D knockout target gene.

[0022] If the knockout vector pUC::cps2D recombines with the bacterial chromosome, three situations will occur: a. Double cross-over homologous recombination event (double cross-over), that is, allele replacement, in which case spc R The gene replaces the cps2D gene; b. 3′ end single cross-over recombination event (3′ single cross-over), at this time the entire vector DNA sequence is integrated into the bacterial chromosome along with the 3′ end homologous sequence; c. 5′ end single cross-over recombination event (5′ single cross-over), at this time the vector sequence is integrated into the bacterial chromosome along with the 5′ end homologous sequence. If allelic replacement occurs, PCR with primers Out1 / Spc2 can amplify a 2292 bp fragment, PCR with primers Spc1 / Out2 can amplify a 2293 bp fragment, and PCR with primers Spc1 / Spc2 can amplify a 2293 bp fragment. Rgene, while a negative result should be obtained in 05ZYH33. Using the 05ZYH33 genome as a template, primers CheckIn1 / CheckIn2 were able to amplify a 650bp target fragment. The sizes of each PCR product were consistent with the theoretical value and verified by DNA sequencing (BGI sequencing), confirming the successful construction of the 05ZYH33Δcps2D mutant at the genetic level.

[0023] ② RT-PCR identification: To further validate the 05ZYH33Δcps2D mutant, PCR amplification of cDNA reverse-transcribed from the mutant and wild-type strains was performed using primers CheckIn1 / CheckIn2, respectively. The wild-type strain 05ZYH33 was positive, indicating normal transcription of cps2D; however, the mutant 05ZYH33Δcps2D was negative. After transcriptional analysis, a cps2D gene knockout mutant was successfully isolated and designated 05ZYH33Δcps2D.

[0024] The invention relates to an application of the Streptococcus suis serotype 2 cps2D gene knockout mutant in the preparation of a Streptococcus suis serotype 2 attenuated vaccine and a subunit vaccine.

[0025] The invention discloses an application of a Streptococcus suis serotype 2 cps2D gene knockout vector pUC::cps2D in constructing a Streptococcus suis serotype 2 cps2D gene knockout mutant strain.

[0026] The invention relates to an application of the Streptococcus suis type 2 cps2D gene knockout vector pUC::cps2D in preparing a Streptococcus suis type 2 attenuated vaccine or subunit vaccine.

[0027] Beneficial effects:

[0028] 1. The present invention utilizes the principle of homologous recombination to construct a gene knockout vector with a spectinomycin resistance gene in the middle and flanked by upstream and downstream homologous sequences of the cps2D gene. The constructed pUC::cps2D gene knockout plasmid is electroporated into competent cells of the highly pathogenic Streptococcus suis type 2 strain 05ZYH33. Through in vivo homologous recombination, screening and identification at the gene level, transcription level, and DNA sequencing were performed to successfully obtain a mutant strain, named 05ZYH33Δcps2D mutant.

[0029] 2. The present invention analyzed the relevant biological characteristics and pathogenicity of the cps2D gene knockout mutant, and clarified the relationship between the cps2D gene and the pathogenicity of S.suis 2. The Gram staining results of 05ZYH33Δcps2D (05ZYH33Δcps2D) and the wild strain showed that the chain arrangement of the mutant strain Δcps2D was more scattered than that of the wild strain, and the length of the chain was significantly shorter than that of the wild strain, indicating that the chain-forming ability of the mutant strain 05ZYH33Δcps2D (05ZYH33Δcps2D) was weakened; the capsule staining results showed that the capsule of the mutant strain 05ZYH33Δcps2D (05ZYH33Δcps2D) was significantly reduced; and in vitro experiments showed that the mutant strain 05ZYH33Δcps2D

[0030] The mutant strain (05ZYH33Δcps2D) exhibits reduced resistance to macrophage phagocytosis, and animal virulence tests indicate a significant decrease in virulence. This mutant provides important clues for screening protective antigens for multivalent subunit vaccines and could be applied to the development of attenuated and multivalent subunit vaccines against S. suis.

[0031] 3. The 05ZYH33Δcps2D (05ZYH33Δcps2D) constructed in the present invention lays the foundation for further research on the pathogenic mechanism of Streptococcus suis type 2 and provides technical support for more effective prevention and control of Streptococcus suis disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 :Diagram of the strategy for constructing cps2D gene deletion mutants of Streptococcus suis type 2.

[0033] Figure 2 :The results of cross-PCR identification of gene knockout vector pUC::cps2D.

[0034] M: standard DNA molecular marker; lanes 1, 2, 3, 4, 5, and 6 are PCR products using LA1 / LA2, Spc1 / Spc2, RA1 / RA2, LA1 / Spc2, Spc1 / RA2, and LA1 / RA2 as primer pairs, respectively; lane 7 is a 250 bp marker.

[0035] Figure 3 :Combined PCR identification results of 05ZYH33Δcps2D mutant strain.

[0036] M: standard DNA molecular marker; Lanes 1 and 2: using CheckIn1 / CheckIn2 primers, 05ZYH33 genomic DNA and Δcps2D knockout strain genomic DNA were amplified as templates for PCR amplification, the product was 650bp; Lanes 3 and 4: using Spc1 / Spc2 primers, 05ZYH33 genomic DNA and Δcps2D knockout strain genomic DNA were amplified as templates for PCR amplification, the product was 1130bp; Lanes 5 and 6: using Out1 / Spc2 primers, 05ZYH33 genomic DNA and Δcps2D knockout strain genomic DNA were amplified as templates for PCR amplification, the product was 1130bp; Lanes 6 and 7: using Out1 / Spc2 primers, 05ZYH33 genomic DNA and Δcps2D knockout strain genomic DNA were amplified as templates for PCR amplification, the product was 1130bp Lanes 7 and 8: PCR amplification was performed using the genomic DNA of 05ZYH33 and the genomic DNA of the Δcps2D knockout strain as templates, and the product was 2292 bp; lanes 7 and 8: Spc1 / Out2 primers were used to amplify the genomic DNA of 05ZYH33 and the genomic DNA of the Δcps2D knockout strain as templates, respectively, and the product was 2293 bp; lanes 9 and 10: Out1 / Out2 primers were used to amplify the genomic DNA of 05ZYH33 and the genomic DNA of the Δcps2D knockout strain as templates, respectively, and the products were 2753 bp and 3381 bp, respectively.

[0037] Figure 4 :RT-PCR identification of 05ZYH33Δcps2C mutant

[0038] M: standard DNA molecular marker; lanes 1-6: PCR amplification using Spc1 / Spc2 primers; lanes 7-12: PCR amplification using CheckIn1 / CheckIn2 primers; lanes 1-3: genomic DNA, cDNA and RNA of 05ZYH33 were used as PCR templates, respectively; lanes 4-6: genomic DNA, cDNA and RNA of the Δcps2D knockout strain were used as PCR templates, respectively; lanes 7-9: genomic DNA, cDNA and RNA of 05ZYH33 were used as PCR templates, respectively; lanes 10-12: genomic DNA, cDNA and RNA of the Δcps2D knockout strain were used as PCR templates, respectively. Specific implementation methods

[0039] Example 1: Construction of gene knockout vector

[0040] (1) The present invention constructs a cps2D gene deletion mutant based on the principle of gene homologous recombination ( Figure 1 First, PCR specific primers were designed based on the upstream and downstream DNA sequences of the cps2D coding gene in the genome of the wild strain 05ZYH33 of S. suis 2. The base sequences are as follows:

[0041] LA1:5′-CGGTA GAATTCGATCGTGCAAAAGGTTGTTGAG-3′ (the underlined portion indicates the introduced EcoR I restriction enzyme cleavage site)

[0042] LA2:5′-CATGT CCCGGG GAACGCGAATGGATATCAATCA-3′ (the underlined portion indicates the introduced Sma I restriction enzyme site)

[0043] RA1:5′-CAGAT GTCGAC AAACGAAAAATCAAGTACAGTA-3′ (the underlined part is the introduced SalI restriction site)

[0044] RA2:5′-CGAC GCATGC GGATCACGAAACTTGTAGAATGT-3′ (the underlined portion indicates the introduced Sph I restriction enzyme site)

[0045] Based on the pSET2 plasmid sequence, a pair of specific primers Spc1 / Spc2 were designed to amplify the entire spectinomycin resistance gene cassette using the pSET2 plasmid as a template. The primer sequences are:

[0046] Spc1:5'-TCC CCCGGG GTTCGTGAATACATGTTATA-3' (the underlined portion indicates the introduced Sma I restriction enzyme site)

[0047] Spc2:5'-ACGC GTCGAC GTTTTCTAAAATCTGATTAC-3' (the underlined part is the introduced SalI restriction site)

[0048] The PCR reaction system is:

[0049]

[0050] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, 30 cycles of 94°C for 50 s, 55°C for 60 s, and 72°C for 2 min, and a final extension at 72°C for 10 min. Double-distilled water was used as a negative control.

[0051] The PCR products amplified by three primer pairs LA1 / LA2, RA1 / RA2 and Spc1 / Spc2 were detected by 1% agarose gel electrophoresis, and the target fragment sizes were 1030 bp (LA), 1030 bp (RA) and 1130 bp (Spc R The PCR products were recovered and purified, and double-digested with EcoR I / Sma I, Sal I / Sph I, and Sma I / Sal I, respectively. The double-digested products were recovered, purified, and frozen for later use.

[0052] (2) Cloning of RA: The RA fragment digested with Sal I / Sph I was ligated with the pUC19 vector digested with the same enzymes. After incubation at 16°C overnight, the ligation product was transformed into DH5a E. coli competent cells. After selection with ampicillin, clones on the LB plate were selected and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sal I / Sph I. The recombinant plasmid containing a DNA fragment of approximately 1030 bp was named pUC19-RA.

[0053] (3) Spectinomycin resistance gene cassette Spc R Cloning: The product of double digestion with Sma I and Sal I was ligated with the recombinant plasmid pUC19-RA, which had been double digested with the same endonucleases. After incubation at 16°C overnight, the ligation product was transformed into DH5a competent E. coli cells. After double selection with spectinomycin and ampicillin, clones were selected from the LB plate and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sma I and Sal I. The recombinant plasmid containing a DNA fragment of approximately 1130 bp was named pUC19-SR.

[0054] (4) Cloning of LA: The LA fragment after EcoR I / Sma I double digestion was ligated with the recombinant plasmid pUC19-SR treated with the same endonuclease double digestion. After incubation at 16°C overnight, the ligation product was transformed into DH5a Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, clones on the LB plate were picked and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with EcoR I / Sma I. Positive plasmids with a DNA fragment of about 1030 bp were selected. Plasmid PCR identification was performed using six primer pairs: LA1 / LA2, RA1 / RA2, Spc1 / Spc2, LA1 / Spc2, Spc1 / RA2, and LA1 / RA2. The results are shown in the figure. Figure 2 The obtained positive recombinant plasmid was named pUC::cps2D.

[0055] (5) Identification of gene knockout vector pUC::cps2D: The positive recombinant gene knockout vector pUC::cps2D was sequenced (BGI Genomics Co., Ltd.). The sequencing results showed that in Spc R The construction of the cps2D target gene with homologous sequences on both sides of the gene and the gene knockout vector pUC::cps2D is completely correct.

[0056] Example 2: Screening and identification of variants

[0057] (1) The gene knockout vector pUC::cps2D was electroporated into the competent cells of 05ZYH33

[0058] ① Preparation of competent cells of S.suis 2 wild strain 05ZYH33: Pick a single colony of 05ZYH33 and inoculate it with 3 mL THB medium, shake and culture it at 37°C overnight, and transfer it to THY medium containing DL-threonine at 1:50 the next day and shake and culture it at 37°C until OD 600 When the pH is about 0.3-0.4, collect the bacteria by low-speed centrifugation at 4°C and wash them 4 times with pre-cooled 10% glycerol, each time with not less than 25 mL. Finally, resuspend the bacterial pellet with 0.5 mL of 0.3 M sucrose containing 15% glycerol, and dispense into 50 μL / tubes. Store at -80°C for later use.

[0059] ② Electroporation: Add 10 μL of pUC::cps2D plasmid to 50 μL of competent medium prepared as described above and place in an electroporation cuvette (operate on ice). After electroporation at 22.5 kV / cm, 200 Ω, and 25 μF, add 940 μL of 0.3 M sucrose-containing THB (preheated at 37°C) medium. Incubate at 37°C with shaking at 160 rpm for 2 h. Then, spread the plate onto a THB plate containing spectinomycin resistance and incubate at 37°C for 24-48 h. Pick a single colony for identification.

[0060] (2) Preliminary screening of 05ZYH33△cps2D mutants: Streptococcus suis colonies were selected from spectinomycin THB plates and cultured in 2 mL of liquid THB (100 mg / mL spc r ) culture medium. Take the bacterial solution as a template and perform preliminary PCR screening using primers CheckIn1 and CheckIn2 (located within the cps2D gene). The primer sequence is: CheckIn1: 5′-GATGACGGTCCCAAAACTATTG-3′

[0061] CheckIn2:5′-AAAGCCTTCGCTCTATCCTCAC-3′

[0062] If the cps2D gene is knocked out, PCR amplification will yield a negative result. If a product of the expected size (650 bp) is still amplified, it indicates that the cps2D gene has not been knocked out. Using this method, a cps2D gene knockout mutant was initially screened and named 05ZYH33Δcps2D.

[0063] (3) Identification of the 05ZYH33Δcps2D mutant:

[0064] ① Combined PCR identification: Design a pair of primers Out1 / Out2 on the outside of LA and RA of the upstream and downstream homologous sequences of the cps2D knockout target gene. The primer sequence is: Out1: 5′-CACGTATTGCAAATAGCCTTCG-3′

[0065] Out2:5′-TTCTTACGTACCTCGGCATCAA-3′

[0066] If the gene knockout vector pUC::cps2D recombines with the bacterial chromosome ( Figure 2 ), there will be three situations: a. Double cross-over homologous recombination event (double cross-over), that is, allele replacement, at this time spc R The gene replaces the cps2D gene; b. 3′ end single cross-over recombination event (3′ single cross-over), at this time the entire vector DNA sequence is integrated into the bacterial chromosome along with the 3′ end homologous sequence; c. 5′ end single cross-over recombination event (5′ single cross-over), at this time the vector sequence is integrated into the bacterial chromosome along with the 5′ end homologous sequence. If allelic replacement occurs, PCR with primers Out-F / Spc2 can amplify a 2292 bp fragment, PCR with primers Spc1 / Out2 can amplify a 2293 bp fragment, and PCR with primers Spc1 / Spc2 can amplify a 2293 bp fragment. R gene, while a negative result should be obtained in 05ZYH33. Using the 05ZYH33 genome as a template, primers CheckIn1 / CheckIn2 can amplify a 650bp target fragment. The size of each PCR product is consistent with the theoretical value ( Figure 3 ) and verified by DNA sequencing (BGI sequencing), confirming the successful construction of the 05ZYH33Δcps2D mutant strain at the genetic level.

[0067] ②RT-PCR identification: To further verify the 05ZYH33Δcps2D mutant, PCR amplification was performed on the cDNA obtained by reverse transcription of the mutant and wild-type strains using the CheckIn1 / CheckIn2 primers. The wild-type strain 05ZYH33 was positive, indicating that cps2D was transcribed normally; while the mutant strain 05ZYH33Δcps2D was negative ( Figure 4 After identification at the transcriptional level, a cps2D gene knockout mutant was successfully obtained and named 05ZYH33Δcps2D.

[0068] Example 3: In vitro experiments

[0069] (1) Gram staining

[0070] According to the instructions of the Gram staining solution produced by Beijing Solebow Technology Co., Ltd., 05ZYH33 and 05ZYH33Δcps2D were Gram stained respectively. It was found that the chain arrangement of the mutant strain 05ZYH33Δcps2D was more scattered than that of the wild strain, and the chain length was significantly shorter than that of the wild strain, indicating that the chain-forming ability of the mutant strain 05ZYH33Δcps2D was weakened.

[0071] (2) Growth characteristics

[0072] Under the same culture conditions, single colonies of 05ZYH33Δcps2D and wild-type 05ZYH33 were picked and inoculated into 3 mL of THB medium containing spectinomycin (100 mg / mL) and without spectinomycin, respectively, and cultured at 37°C overnight with shaking. The next day, the overnight cultured bacteria were removed and the absorbance at 600 nm was measured. Both were diluted to approximately 1×10 8 CFU / mL concentration. Then, 60 μL of the mutant strain and wild strain were inoculated into 3 mL of THB medium, cultured at 37°C, 200 r / min, and samples were taken every 1 hour to measure OD 600 , with culture time as the horizontal axis, OD 600 The values were used as the vertical axis to draw the growth curves of the mutant and wild-type strains, and the results showed that there was no significant difference between the two.

[0073] (3) Anti-macrophage phagocytosis experiment

[0074] 05ZYH33 and 05ZYH33Δcps2D (10 7 05ZYH33Δcps2D was added to Raw264.7 macrophages (10:1 ratio) and centrifuged at 800g for 10 minutes. The cells were then incubated with gentle shaking in the dark for 2 hours, washed three times with mild PBS, and then incubated with fresh culture medium containing 100μg / ml gentamicin and 5μg / ml penicillin for 1 hour. Finally, an equal volume of paraformaldehyde (4%) was added for fixation, and intracellular CFSE fluorescence intensity was measured by flow cytometry. Flow cytometry showed that 05ZYH33Δcps2D had reduced anti-macrophage phagocytic and killing ability compared to 05ZYH33.

[0075] (4) Adhesion test

[0076] 05ZYH33 and 05ZYH33Δcps2D (10 7The cells were incubated with a 10:1 ratio of 05ZYH33 (05ZYH33Δcps2D) and human laryngeal epithelial cell line HEP-2 for 2 hours. The cells were then washed three times with mild PBS and fixed with an equal volume of 4% paraformaldehyde. Flow cytometry was used to measure intracellular CFSE fluorescence intensity. Flow cytometry revealed that 05ZYH33Δcps2D adhered more readily to HEP-2 cells than 05ZYH33.

[0077] Example 4: Animal pathogenicity experiment

[0078] To detect the pathogenicity of the mutant strain 05ZYH33Δcps2D, single colonies of 05ZYH33 and mutant strain 05ZYH33Δcps2D were picked from the plates and cultured in THB medium at 37°C with shaking until the mid-logarithmic growth phase (OD 600 ≈0.4, about 10 8 The bacteria were collected by centrifugation and resuspended in sterile PBS buffer. Thirty 4-week-old SPF BALB / c mice were randomly divided into three groups and injected intraperitoneally with 1 mL of wild-type and mutant bacterial solution (about 10 8 CFU / mouse), and a negative THB control group (1 mL / mouse) was established. Significant changes in the onset and survival of mice were recorded. The results showed that 24 hours after challenge with a lethal dose of the wild-type strain 05ZYH33, all 10 mice died. However, 12 hours after challenge with the same dose of the knockout strain 05ZYH33Δcps2D, 5 mice survived, 24 hours later, and 48 hours later, 8 mice had died and 2 mice survived. None of the surviving mice showed any symptoms of disease at the end of the 7-day experiment. All 10 mice in the negative control group were in good condition. This suggests that knockout of the cps2D gene affects the virulence of 05ZYH33 and could be used in the development of attenuated and multivalent subunit vaccines against Streptococcus suis type 2.

[0079] <110> Military Medical Research Institute of Nanjing Military Region of the Chinese People's Liberation Army

[0080] <120> Construction and application of cps2D gene knockout mutant of Streptococcus suis type 2

[0081] <160> 14

[0082] <210> 1

[0083] <211> 695

[0084] <212> DNA

[0085] <213> Streptococcus suis 05ZYH33

[0086] <220>

[0087] <221>CDS

[0088] <223>The coding gene between the 15th and 710th positions of the histidine triad protein cps2D

[0089] <400>1

[0090] ATATCATATTTGGTGTGGGATGACGGTCCCAAAACTATTGAAGAGAGCCTG

[0091] AGTTTGATAAGCGAAGCTTATCGTCAAGGTGTTCGCTATATCGTAGCGACAT

[0092] CTCATAGACGAAAAGGGATGTTTGAAACACCAGAAAAAATCATCATGATTA

[0093] ACTTTCTTCAACTTAAAGAGGCAGTAGCAGAAGTTTATCCTGAAATACGAT

[0094] TGTGCTATGGTGCTGAATTGTATTATAGTAAAGATATCTTAAGCAAACTTGA

[0095] AAAAAAGAAAGTACCAACACTTAATGGCTCGTGCTATATTCTCTTGGAGTT

[0096] CAGTACGGATACTCCTTGGAAAGAGATTCAAGAAGCAGTGAACGAAATGA

[0097] CGCTACTTGGGCTAACTCCCGTACTTGCCCATATAGAGCGTTATGATGCTCT

[0098] [[ID=Z4]]

[0099] CTCAGGTAAATAGTAACCATGTGTTGAAGCCTGCTTTAATTGGCGAACGAG

[0100] CAAAAGAATTTAAAAAACGTACTCGATATTTTTTAGAGCAGGATTTAGTACA

[0101] ​TTGTGTTGCTAGCGATATGCATAATTTATATAGTAGACCTCCGTTTATGAGGG

[0102] AGGCGTATCAGCTTGTAAAAAAAGAGTATGGTGAGGATAGAGCGAAGGCT

[0103] TTGTTCAAGAAAAATCCTTTGTTGATATT

[0104] <210>2

[0105] <211>1030

[0106] <212>DNA

[0107] <213>Streptococcus suis 05ZYH33

[0108] <220>

[0109] <221>CDS

[0110] <223>The upstream DNA sequence of the cps2C encoding gene, which is the homologous left arm for gene knockout

[0111] <400>2

[0112] CGGTACCCGGGGATCGTGCAAAAGGTTGTTGAGGTCACCAAGGTAAGCGAT

[0113] GTGACGACACTTGAAGAAGCAGTCCCAGCGGAAGAACCAACCACTCCAAA [[ID=3…]]

[0114] TACAAAACGAAATATCTTGCTTGGTTTATTAGCTGGAGGTATCTTGGCAACA

[0115] GGTCTTGTACTGGTTATGGAGGTTTTGGATGACCGTGTAAAACGTCCTCAGG

[0116] ACATCGAAGAGGTAATGGGATTGACATTGCTAGGTATAGTACCAGATTCGAA

[0117] GAAATTAAAATAGGAGAACAATATGGCGATGTTAGAAATTGCACGTACAAA

[0118] AAGAGAGGGAGTAAATAAAACCGAGGAGTATTTCAATGCTATCCGTACCAAT

[0119] ATTCAGCTTAGCGGAGCAGATATTAAGGTTGTTGGTATTACCTCTGTTAAATC

[0120] GAATGAAGGTAAGAGTACAACTGCGGCTAGTCTCGCTATTGCCTATGCTCGT

[0121] TCAGGTTATAAGACCGTCTTGGTGGATGCAGATATCCGAAATTCAGTCATGC

[0122] CTGGTTTCTTCAAGCCAATTACAAAGATTACAGGTTTGACGGATTACCTAGC

[0123] AGGGACAACAGACTTGTCTCAAGGATTATGCGATACAGATATTCCAAACTTG

[0124] ACCGTAATTGAGTCAGGAAAGGTTTCTCCCAACCCTACTGCCCTTTTACAAA

[0125] GTAAGAATTTTGAAAATCTACTTGCGACTCTTCGTCGCTATTATGATTATGTTA

[0126] TCGTTGACTGTCCACCATTAGGACTGGTAGTTGATGCAGCTATCATTGCACA

[0127] AAAATGTGATGCGATGGTTGCAGTAGTAGAAGCAGGCAATGTTAAGTGCTC

[0128] ATCTTTGAAAAAAGTAAAAGAGCAGTTGGAAAAAACAGGCACACCGTTCTT

[0129] AGGCGTTATCTTGAACAAATATGATATTGCCACTGAGAAGTATAGTGAATAC

[0130] GGAAATTACGGCAAAGAAAGCCTAATTTCTCAGATAACATAAGTTTGATAAG

[0131] TAGGTATTAATATGATTGATATCCATTCGCGTTCGTGAATACATG

[0132] <210> 3

[0133] <211> 1130

[0134] <212> DNA

[0135] <213> Artificial sequence

[0136] <220>

[0137] <223> DNA sequence encoding the spectinomycin resistance cassette

[0138] <400> 3

[0139] gttcgtgaat acatgttata ataactataa ctaataacgt aacgtgactg gcaagagata60

[0140] tttttaaaac aatgaatagg tttacactta ctttagtttt atggaaatga aagatcatat120

[0141] catatataat ctagaataaa attaactaaa ataattatta tctagataaa aaatttagaa180

[0142] gccaatgaaa tctataaata aactaaatta agtttattta attaacaact atggatataa240

[0143] aataggtact aatcaaaata gtgaggagga tatatttgaa tacatacgaa caaattaata300

[0144] aagtgaaaaa aatacttcgg aaacatttaa aaaataacct tattggtact tacatgtttg360

[0145] gatcaggagt tgagagtgga ctaaaaccaa atagtgatct tgacttttta gtcgtcgtat420

[0146] ctgaaccatt gacagatcaa agtaaagaaa tacttataca aaaaattaga cctatttcaa480

[0147] aaaaaatagg agataaaagc aacttacgat atattgaatt aacaattatt attcagcaag540

[0148] aaatggtacc gtggaatcat cctcccaaac aagaatttat ttatggagaa tggttacaag600

[0149] agctttatga acaaggatac attcctcaga aggaattaaa ttcagattta accataatgc660

[0150] tttaccaagc aaaacgaaaa aataaaagaa tatacggaaa ttatgactta gaggaattac720

[0151] tacctgatat tccattttct gatgtgagaa gagccattat ggattcgtca gaggaattaa780

[0152] tagaatta tcaggatgat gaaaccaact ctatattaac tttatgccgt atgattttaa840

[0153] ctatggacac gggtaaaatc ataccaaaag atattgcggg aaatgcagtg gctgaatctt900

[0154] ctccattaga acatagggag agaattttgt tagcagttcg tagttatctt ggagagaata960

[0155] ttgaatggac taatgaaaat gtaaatttaa ctataaacta tttaaataac agattaaaaa1020

[0156] aattataaaa aaattgaaaa aatggtggaa acactttttt caattttttt gttttattat1080

[0157] ttaatatttg ggaaatattc attctaattg gtaatcagat tttagaaaac 1130

[0159] <210> 4

[0160] <211> 1093

[0161] <212> DNA

[0162] <213> Streptococcus suis 05ZYH33

[0163] <220>

[0164] <223> The downstream DNA sequence encoding the gene cps2C is the homologous right arm of the gene knockout

[0165] <400> 4

[0166] CAGATTTTAGAAAACGAAAAATCAAGTACAGTAACCTCATAGAAATAGTGG

[0167] AGGAGCTATGAATATTGAAATAGGATATCGCCAAACGAAATTGGCATGTTT

[0168] GATATGATAGCAGTTACGATTTCTGCAATCTTAACAAGTCATATACCAAATGC

[0169] TGATTTAAATCGTTCTGGAATTTTTATCATAATGATGGTTCATTATTTTGCATTT

[0170] TTTATATCTCGTATGCCGGTTGAATTTGAGTATAGAGGTAATCTGATAGAGTTT

[0171] GAAAAAACATTTAACTATAGTATAATATTTGTAATTTTTCTTATGGCAGTTTCA

[0172] TTTATGTTAGAGAATAATTTCGCACTTTCAAGACGTGGTGCCGTGTATTTCAC

[0173] ATTAATAAACTTCGTTTTGGTATACCTATTTAACGTAATTATTAAGCAGTTTAA

[0174] GGATAGCTTTCTATTTTCGACAACCTATCAAAAAAAGACGATTCTAATTACA

[0175] ACGGCTGAACTATGGGAAATATGCAAGTTTTATTTGAATCAGATATACTATT

[0176] TCAAAAAAATCTTGTTGCATTGGTAATTTTAGGTACAGAATAGATAAAATTA

[0177] ATTTACCATTACCGCTCTATTATTCTGTTGAAGAAGCTATAGAGTTTTCAACA

[0178] AGGGAAGTGGTCGACTACGTCTTTATAAATTTACCAAGTGAATATTTTGACTT

[0179] AAAGCAATTAGTTTCAGACTTTGAGTTGTTAGGTATTGATGTAGGCGTTGATA

[0180] TTAATTCATTCGGTTTTACTGTGTTGAAGAATAAAAAAATCCAAATGCTAGG

[0181] TGACCATGCATCGTCACTTTTTCCACAAATTTTTATAAGCCTAGTCACATCT

[0182] TGATGAAACGACTTTTAGATATACTTGGAGCAGTAGTCGGGTTAATTATTTGT

[0183] GGTATAGTTTCTATTTTGTTAATTCCAATTATTCGTAGAGATGGTGGACCAGC

[0184] CATTTTTGCTCAGAAACGAGTTGGACAGAATGGACGCATATTTACATTCTAC

[0185] AAGTTTCGTGATCCTCTAGAGTCG

Claims

1. A Streptococcus suisserotype 2 cps2D gene knockout mutant strain 05ZYH33Δcps2D, characterized in that: The cps2D gene in strain 05ZYH33 was replaced by the spectinomycin resistance gene cassette Spc from position 31 to 1000. R Replaced by.

2. The method for constructing the Streptococcus suis serotype 2 cps2D gene knockout mutant strain 05ZYH33Δcps2D according to claim 1, characterized in that: The following steps are involved: (1) Based on the upstream DNA sequence of the cps2D coding gene in the genome of the wild strain 05ZYH33 of S. suis 2, PCR specific primers LA1 and LA2 were designed; based on the downstream DNA sequence of the cps2D coding gene in the genome of the wild strain 05ZYH33 of S. suis 2, PCR specific primers RA1 and RA2 were designed; using the pSET2 plasmid as a template, a pair of specific primers spc-F and spc-R were designed; (2) Using 05ZYH33 genomic DNA as a template, LA1 / LA2 and RA1 / RA2 as primers were used to amplify the target gene cps2D upstream DNA sequence LA fragment containing EcoR I / Sma I restriction sites at both ends, and the target gene cps2D downstream DNA sequence RA fragment containing Sal I / Sph I restriction sites at both ends; using pSET2 plasmid as a template, spc-F / spc-R as specific primers were used to amplify the spectinomycin resistance gene cassette containing SmaI / SalI restriction sites at both ends; the PCR products amplified by the three pairs of primers LA1 / LA2, RA1 / RA2 and spc-F / spc-R were detected by 1% agarose gel electrophoresis, and the target fragment sizes were 1030 bp (LA fragment), 1030 bp (RA fragment) and 1130 bp (Spc fragment). R ), the PCR products were recovered and purified, and double-digested with EcoR I / Sma I, Sal I / Sph I, and Sma I / Sal I, respectively. The double-digested products were recovered, purified, and frozen for later use; (3) Construction of gene knockout vector pUC::cps2D: The LA fragment-spectinomycin resistance gene cassette-RA fragment was inserted into the EcoR I / Sph I restriction enzyme sites of the pUC19 vector to obtain the gene knockout vector pUC::cps2D; (4) Identification of gene knockout vector pUC::cps2D: The positive recombinant gene knockout vector pUC::cps2D was sequenced (BGI Genomics Co., Ltd.). The sequencing results showed that in Spc R The construction of the cps2D target gene with homologous sequences on both sides of the gene and the gene knockout vector pUC::cps2D was completely correct; (5) The gene knockout vector pUC::cps2D was electroporated into 05ZYH33 competent cells; (6) Preliminary screening of Δcps2D mutants: S. suis colonies were selected from spectinomycin THB plates and cultured in 2 mL of liquid THB (100 mg / mL spc r ) medium, and the bacterial liquid was used as a template. A preliminary PCR screening was performed using primers CheckIn-F / R (located within the cps2D gene). If the cps2D gene was knocked out, the PCR amplification would yield a negative result. If a product of the expected size (375 bp) could still be amplified, it indicated that the cps2D gene was not knocked out. Through this method, a cps2D gene knockout mutant was initially screened and obtained, which was named Δcps2D. (7) Identification of the Δcps2D mutant: The Δcps2D mutant was successfully identified by combined PCR and RT-PCR, and the cps2D gene knockout mutant was named 05ZYH33Δcps2D.

3. The construction method according to claim 2, characterized in that Step (3) The method for constructing the gene knockout vector pUC::cps2D comprises the following steps: (a) Cloning of LA: The LA fragment, double-digested with EcoR I / Sma I, was ligated with the pUC19 vector, which had been double-digested with the same enzymes. The ligation product was transformed into DH5a E. coli competent cells at 16°C overnight. After selection with ampicillin, clones on the LB plate were selected and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double-digestion with EcoR I / Sma I. The recombinant plasmid containing a DNA fragment of approximately 1000 bp was designated pUC19-LA. (b) Spectinomycin resistance gene Spc R Cloning: The product of Sma I / Sal I double digestion was ligated with the recombinant plasmid pUC19-LA, which had been double digested with the same endonucleases. After incubation at 16°C overnight, the ligation product was transformed into DH5a competent E. coli cells. After double selection with spectinomycin and ampicillin, clones on the LB plate were picked and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sma I / Sal I. The recombinant plasmid with a DNA fragment of approximately 1100 bp was named pUC19-LS. (c) Cloning of RA: The RA fragment double-digested with Sal I / Sph I was ligated with the recombinant plasmid pUC19-LS, which had been double-digested with the same endonucleases. After incubation at 16°C overnight, the ligation product was transformed into DH5a Escherichia coli competent cells. After double selection with spectinomycin and ampicillin, colonies on LB plates were selected and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double-digestion with Sal I / Sph I. Positive plasmids containing DNA fragments of approximately 1000 bp were selected. Plasmid PCR was then performed using six primer pairs: LA1 / LA2, RA1 / RA2, spc-F / spc-R, LA1 / spc-R, spc-F / RA2, and LA1 / RA2. The resulting positive recombinant plasmid was designated pUC::cps2D.

4. The construction method according to claim 2, characterized in that Step (7) Identification of the Δcps2D mutant comprises the following steps: ① Combined PCR identification: Design a pair of primers Out-F / Out-R on the outside of LA and RA of the upstream and downstream homologous sequences of the cps2D knockout target gene. If the gene knockout vector pUC::cps2D recombines with the bacterial chromosome, three situations will occur: a. Double cross-over homologous recombination event (double cross-over), that is, allele replacement, in this case spc R The gene replaces the cps2D gene; b. 3′ end single cross-over recombination event (3′ single cross-over), at this time the entire vector DNA sequence is integrated into the bacterial chromosome along with the 3′ end homologous sequence; c. 5′ end single cross-over recombination event (5′ single cross-over), at this time the vector sequence is integrated into the bacterial chromosome along with the 5′ end homologous sequence. If allelic replacement occurs, PCR with primers Out-F / Spc-R can amplify a 2266bp fragment, PCR with primers Spc-F / Out-R can amplify a 2245bp fragment, and PCR with primers Spc-F / Spc-R can amplify a spc R gene, while a negative result should be obtained in 05ZYH33. However, using the 05ZYH33 genome as a template, primers CheckIn-F / R were able to amplify a 375bp target fragment. The sizes of the PCR products were consistent with the theoretical values and were verified by DNA sequencing, confirming the successful construction of the 05ZYH33Δcps2D mutant strain at the genetic level. ②RT-PCR identification: In order to further verify the 05ZYH33Δcps2D mutant strain, the cDNA obtained by reverse transcription of the mutant strain and the wild strain was PCR amplified using CheckIn-F / R primers. The result was positive in the wild strain 05ZYH33, indicating that cps2D was transcribed normally; while it was negative in the mutant strain 05ZYH33Δcps2D. After identification of the transcription level, the cps2D gene knockout mutant strain was successfully obtained and named 05ZYH33Δcps2D.

5. Use of the Streptococcus suis serotype 2 cps2D gene knockout mutant according to claim 1 in the preparation of attenuated Streptococcus suis serotype 2 vaccines and subunit vaccines.

6. A method for constructing a Streptococcus suis type 2 cps2D gene knockout vector pUC::cps2D, characterized in that: The following steps are involved: (a) Cloning of LA: The LA fragment, double-digested with EcoR I / Sma I, was ligated with the pUC19 vector, which had been double-digested with the same enzymes. The ligation product was transformed into DH5a E. coli competent cells at 16°C overnight. After selection with ampicillin, clones on the LB plate were selected and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double-digestion with EcoR I / Sma I. The recombinant plasmid containing a DNA fragment of approximately 1000 bp was designated pUC19-LA. (b) Spectinomycin resistance gene Spc R Cloning: The product of Sma I / Sal I double digestion was ligated with the recombinant plasmid pUC19-LA, which had been double digested with the same endonucleases. After incubation at 16°C overnight, the ligation product was transformed into DH5a competent E. coli cells. After double selection with spectinomycin and ampicillin, clones on the LB plate were picked and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sma I / Sal I. The recombinant plasmid with a DNA fragment of approximately 1100 bp was named pUC19-LS. (c) Cloning of RA: The RA fragment double-digested with Sal I / Sph I was ligated with the recombinant plasmid pUC19-LS, which had been double-digested with the same endonucleases. After incubation at 16°C overnight, the ligation product was transformed into DH5a Escherichia coli competent cells. After double selection with spectinomycin and ampicillin, colonies on LB plates were selected and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double-digestion with Sal I / Sph I. Positive plasmids containing DNA fragments of approximately 1000 bp were selected. Plasmid PCR was then performed using six primer pairs: LA1 / LA2, RA1 / RA2, spc-F / spc-R, LA1 / spc-R, spc-F / RA2, and LA1 / RA2. The resulting positive recombinant plasmid was designated pUC::cps2D.

7. The Streptococcus suis type 2 cps2D gene knockout vector pUC::cps2D obtained according to the construction method of claim 6.

8. Use of the Streptococcus suis serotype 2 cps2D gene knockout vector pUC::cps2D according to claim 7 in constructing a Streptococcus suis serotype 2 cps2D gene knockout mutant strain.

9. Use of the Streptococcus suis type 2 cps2D gene knockout vector pUC::cps2D according to claim 7 in the preparation of an attenuated Streptococcus suis type 2 vaccine or subunit vaccine.

Images