Gallid alphaherpesvirus 3 (MDV-2), a viral vector against different avian pathogens: a new vaccination strategy in the poultry farming industry

Abstract

The present invention relates to the veterinary field in general and specifically to the development of vectored vaccines using the Gallid alphaherpesvirus 3 (GaHV-3) or Marek's disease serotype 2 (MDV-2) vector, which contains protective antigens against different avian pathogens such as Newcastle disease virus (NDV), infectious laryngotracheitis virus (ILTV), infectious bursal disease virus (IBDV) or Gumboro disease, avian influenza virus (AIV), and infectious bronchitis virus (IBV).

Description

[0001] Gallid Alphaherpesvirus 3 (MDV-2), a viral vector against different avian pathogens: a new vaccination strategy in the poultry industry

[0002] FIELD OF INVENTION

[0003] The invention describes obtaining new vectored vaccines with the insertion and expression of different genes and / or antigens that protect against different viral pathogens.

[0004] The present invention describes the procedure for obtaining new recombinant and / or vectored vaccines based on the Gallic! alphaherpesvirus 3 (GaHV-3) or Marek disease serotype 2 (MDV-2) vector, as well as the procedure for selecting recombinant clones with high stability, expression and immunogenicity.

[0005] The genes of interest in the invention include: the fusion gene (F) of Newcastle disease virus (NDV) genotype XII, or at least one other neuraminidase hemagglutinin (HN) gene of genotypes XII, I, II, and / or V1, or the glycoproteins D and I (gD-I) of avian infectious laryngotracheitis (ILTV), or at least one gene from the following genes: gB, gE, and gC; the VP2 protein of infectious Gumboro disease (IBDV), or at least one gene from the following genes: VP3, VP4, and VP5. X of IBDV, the hemagglutinin (HA) and neuraminidase (NA) gene of H5N1, H5N9, H X N X of avian influenza (AIV), avian infectious bronchitis (IBV) at least one Spike (S) gene, S1, and S2.

[0006] DESCRIPTION OF THE RELATED TECHNIQUE

[0007] Marek's disease virus (MDV), also known as Gallid alphaherpesvirus 2 (GaHV-2), is the causative agent of Marek's disease. It is an alphaherpesvirus that affects domestic fowl (Gallus gallus domesticus), where it establishes itself as a chronic infection. Marek's disease (MD) is characterized by immunosuppression, neurological disorders, and neoplastic changes in CD4 cells. + , located around the peripheral nerve and visceral organs of the host (1).

[0008] MDV is a ubiquitous virus in the commercial poultry industry worldwide, primarily controlled through vaccination. Significant losses before the advent of vaccines precluded the possibility of raising broiler chickens in confinement. Currently, all laying hens and broilers in North and South America are vaccinated against MDV as a mandatory requirement (1).

[0009] Over the past 40 years, live vaccines of different strains have been used in various combinations for the control of Marek's disease (MD) (2-4). These include the naturally attenuated vaccine against Marek's disease serotype 1 (MDV-1) strain Rispens (CVI-988), Marek's disease serotype 2 (MDV-2) Gallid alphaherpesvirus 3 (GaHV-3), including strains SB-1, 301 B / 1, and HPRS-24, and turkey herpesvirus (HVT) Meleagrid herpesvirus 1 (MeAHV-1) strain Fc126. The most commonly used combination is SB-1 and MeAHV-1 strain Fc126, as they appear to have an additive effect in protecting chickens against virulent strains of MDV (5).

[0010] Gallid alphaherpesvirus 3 (GaHV-3) belongs to the family Herpesviridae, subfamily Alphaherpesvirinae, genus Mardivirus. According to the International Committee on Taxonomy of Viruses (ICTV), the genus Mardivirus is classified into three species: Gallid alphaherpesvirus 2, Gallid alphaherpesvirus 3 (non-oncogenic strains: SB-1, 301 B / 1, and HPRS-24), and Meleagrid herpesvirus 1, formally known as MDV serotype 1 (MDV-1), MDV serotype 2 (MDV-2), and MDV serotype 3 (MDV-3), respectively.Additionally, the advantages of these vaccines are successful due to their long-lasting protection against MD; these vaccine strains of herpesvirus have been recognized as recombinant viral vectors, including protection against a number of avian viral pathogens, such as: Gumboro disease (IBD), avian influenza (AI), infectious laryngotracheitis (ILT), Newcastle disease (ND), etc. (6-9).

[0011] Although the HVT vaccine vector provides extreme and effective protection, meaning that these vaccines used individually have proven to be extremely effective, however, when more than one HVT vector vaccine is used, the opposite occurs; that is, problematic results are obtained in obtaining the desired immune response against each vaccine used in combination.

[0012] The recommendations against using the HVT vector with recombinant vectors are clear, due to the potential for interference, resulting in poor efficacy against foreign inserts. Therefore, given these restrictions on the HVT vector's use in multivalent vaccines, there is a need to develop other vectored vaccine platforms that would significantly improve protection against multiple vaccine components.

[0013] Alphaherpesviruses have a double-stranded DNA genome of approximately 178 kilobase pairs (kbp), which contains several non-essential regions for their replication, such as 10 genes in the unique short (US) region and 23 genes in the unique long (UL) region, thus allowing them to integrate or replace genes from other pathogens. Specifically, the US7 and UL40 genes and the intergenic regions UL45-46 of the HVT genome, and the US2 and UL41 genes of the MDV genome, tend to be used as insertion sites. Recently, a comparative study of non-essential genes has shown that US2 is more effective at promoting the expression of heterologous genes than the US10 insertion site (6).

[0014] The promoters commonly used to obtain alphaherpesvirus-based viral vectors are those of cytomegalovirus, simian virus 40, and chicken beta-actin, as well as some MDV-specific promoters (unidirectional or bidirectional), which have been successful. The technology for obtaining recombinant MDV and HVT involves plasmids, bacmids, and fosmids.

[0015] Although these techniques allow the insertion of protective genes against other avian pathogens, these strategies have limitations and tend to be very time-consuming for obtaining vaccines (10).

[0016] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)ZCas is a new gene editing system derived from the same immune system of bacteria, which allows them to remember and destroy phages as a defense tool against viral invasions (11).

[0017] CRISPR associated with Cas9 (CRISPR / Cas9) of the type II system, consisting of a guide RNA that is guided by the Cas9 endonuclease of Streptococcus pyogenes, and which consists of: a simple guide RNA (gRNA) and trans-activated crRNA (tracrRNA), has recently been developed for the editing of eukaryotic cells, introducing in a precise and efficient manner a double cut in the double strand of DNA (DNA: double-stranded deoxyribonucleic acid). These double-strand breaks (DSBs) are subsequently repaired by nonhomologous end joining (NHEJ), which repairs DNA by causing indels in the region (e.g., insertions or deletions), or by homology directed repair (HDR), which repairs DNA in the presence of a donor homologous to the DNA.CRISPR / Cas9 is a system that has proven to be a powerful genetic tool that is currently adapted to the editing of viruses whose genomes contain DNA, such as Epstein-Barr virus, pseudorabies virus, and herpes simplex virus type I. CRISPR / Cas9 technology has recently been applied to avian herpesvirus (12).

[0018] From a patent perspective, document WO2022 / 136623 is known, which relates to recombinant HVT constructs (rHVT) useful as a multivalent vaccine vector for poultry. The rHVT comprises four heterologous genes from avian pathogens: the VP2 gene from IBDV, the F gene from NDV, and the gD and gl genes from ILTV. The VP2 and F genes are inserted into the Us region of the rHVT genome. The gD-gl genes are inserted into the UL region of the rHVT genome, either between UL44 and UL45, or between UL45 and UL46. The rHVTs were shown to be genetically stable in vitro and in vivo, and all inserted genes were sufficiently expressed to induce protective immunity in birds vaccinated against IBDV, NDV, and ILTV. The integration of expression cassettes is carried out using CRISPR / Cas9.

[0019] For its part, document ES2719409 discloses a composition or vaccine for use in a process for inducing an immunogenic or protective response in an animal against one or more avian pathogens, said composition or vaccine comprising a vector of the recombinant gallinaceous herpesvirus 3 (MDV-2) strain SB-1, said vector comprising one or more heterologous polynucleotides encoding and expressing at least one antigen of an avian pathogen, wherein the heterologous polynucleotide encodes the Newcastle disease virus NDV-F protein.The heterologous polynucleotide is a codon-optimized NDV-F Vlld polynucleotide, the promoter is an SV40 promoter and a polyadenylation signal, wherein the heterologous polynucleotide encoding NDV-F is inserted into the region between ORF UL55 and ORF LORF5 in the long single region (UL) of the Gallid herpesvirus 3 (MDV-2) SB-1 strain vector; or the heterologous polynucleotide is a codon-optimized NDV-F Vlld polynucleotide, the promoter is an SV40 promoter and the polyadenylation signal is endogenous originating from the glycoprotein C (gC) gene, additionally wherein the heterologous polynucleotide encoding NDV-F is inserted into the region encoding glycoprotein C (UL44) of the Gallid herpesvirus 3 (MDV-2) SB-1 strain vector.The genes that encode the antigen or polypeptide described in the invention may be those that encode the Newcastle disease virus (NDV-F) fusion protein, the Newcastle disease virus (NDV-HN) hemagglutinin neuraminidase, among others.

[0020] Also known is document EP3391903, which refers to a recombinant Gallid herpesvirus 3 (GaHV3; MDV-2) vector comprising one or more heterologous polynucleotides encoding and expressing at least one antigen of an avian pathogen, inserted into the UL3 / UL4 and / or UL21 / UL22 intergenic regions of the Gallid herpesvirus 3 vector. Preferably, the recombinant Gallid herpesvirus 3 vector is a vector of the SB-1 strain of recombinant Gallid herpesvirus 3. Preferably, the at least one antigen protects against infectious bursal disease virus (IBDV), infectious laryngotracheitis virus (ILTV), Newcastle disease virus (NDV), avian influenza virus (AIV), or avian infectious bronchitis virus (IBV).At least one antigen may be selected from the group consisting of (a) VP2, VP3, VP4, and VPX of infectious bursal disease virus (IBDV); (b) glycoprotein B, glycoprotein I, glycoprotein D, glycoprotein E, and glycoprotein C of ILTV; (c) Newcastle disease virus (NDV-F) fusion protein and viral hemagglutinin neuraminidase (NDV-NH) of NDV; and (d) avian influenza hemagglutinin (HA) and neuraminidase (NA). The Gallid herpesvirus 3 vector contains an expression cassette further comprising a promoter such as cytomegalovirus (CMV) and SV40 promoter.

[0021] US2020 / 0323978 describes recombinant multivalent non-pathogenic Marek's disease virus constructs that encode and express foreign antigens from three or more avian viruses, and methods for using multivalent avian virus vaccines. Recombinant non-pathogenic Marek's disease virus (rMDVnp) vectors (including HVT vectors) that encode and express antigens from three or more foreign pathogenic chicken viruses are provided. The rMDVnp vector encodes one or more antigens from laryngotracheitis virus (ILTV), one or more antigens from infectious bursal disease virus (IBDV), and one or more antigens from Newcastle disease virus (NDV).

[0022] Also known is document WO2018 / 193110, which pertains to a recombinant Gallid herpesvirus 3 vector encoding heterologous avian pathogenic antigens, comprising one or more heterologous polynucleotides inserted at the intergenic sites UL3 / UL4 and / or UL21 / UL22. Additional methods are provided for treating an avian species for protection against one or more diseases caused by avian pathogens, and a method for producing the recombinant Gallid herpesvirus 3 vector encoding heterologous avian pathogenic antigens. The recombinant viral vector may have a polynucleotide encoding a gene product or viral protein of avian influenza virus (AIV), such as an HA or NA protein or gene product of AIV, and Newcastle disease virus (NDV-F) fusion protein and NDV viral neuraminidase hemagglutinin (NDV-NH).

[0023] In this sense, it is clear that there is an unmet need to obtain a Gallid alphaherpesvirus 3 as a recombinant vector modified for the insertion of the F and HN genes of NDV, gD-l, gB of ILTV, VP2 of IBDV, HA and NA of IAV, and Spike (S), S1, S2 of IBV under the control of a promoter and a terminator, demonstrating an early immune response by serology and complete protection in SPF hens and broilers against NDV, ILTV, IBDV, AIV, IBV and a complete reduction of viral dissemination in cloacal and tracheal swabs.

[0024] DESCRIPTION OF THE FIGURES

[0025] Figure 1 shows the strategy used to generate the rSB1-F virus using CRISPR / Cas9-NHEJ technology. (A) Correct insertion of the NDV genotype XII F gene into the rSB1-GFP-F and rSB1-F genomes was demonstrated using specific primers. (B) The parental virus genome, or SB1wt, is shown with a single long region (UL), a single short region (US), and one long (TRL / IRL) and one short (TRS / IRS) internal repeat region. Strategy used to generate rSB1-F by CRISPR / Cas9-NHEJ. This figure was created with BioRender.com (Figure not to scale). (C) Comparison of the lysis plaque morphology of SB1wt, rSB1-GFP-F, and rSB1-F under bright-field and fluorescence microscopy.

[0026] Figure 2 shows the expression of the NDV F protein in rSB1-F at passage 20. The expression of the F protein was evaluated in CEF cells infected with rSB1-F by Western blot, where we detected a band of ~52kDa corresponding to the (F1) subunit, a band of ~59kDa corresponding to the inactive precursor (FO), and finally a band of ~120kDa corresponding to the F1 dimer (dF1) of the F protein. Beta-actin was detected as a run control, and CEF cells infected with SB1wt were used as a negative control of the experiment, in which no band was detected.

[0027] Figure 3 shows the in vitro evaluation of the stability of the F gene in the Gallid alphaherpesvirus 3 (SB1 strain) rSB1-F genome. CEF cells were infected with the rSB1-F virus for 25 passages. (A) F protein expression was evaluated in rSB1-F-infected CEF cells by Western blot every 5 passages (passages 5 to 20), where we detected a ~52 kDa band corresponding to the (F1) subunit, a ~59 kDa band corresponding to the inactive precursor (FO), and finally a ~120 kDa band corresponding to the F1 dimer (dF1) of the F protein. As a negative control, we used SB1wt-infected CEF cells, in which no bands were detected. (B) The indirect immunofluorescence assay (IFI) demonstrated the expression of the F protein (red fluorescence) in cells infected with the recombinant rSB1-F virus, in passage 20 in CEFs.In addition, the expression of MDV-2 proteins (blue fluorescence) was detected, and the expression of both proteins (blue / red fluorescence) was also detected. CEF cells infected with SB1wt were used as a negative control. (C) Every 5 passages, the presence of the F gene in the rSB1-F genome was evaluated by conventional PCR, SB1wt.

[0028] Figure 4 shows the biological characterization of the rSB1-F virus. (A) Replication kinetics of rSB1-F and SB1wt in CEF cells, infected with the MCI of 0.001, collected every 24 hours (24 to 120 hours post-infection), titers were expressed in plaque-forming units (PFU / ml). (B) Expression kinetics of the NDV F protein in CEF cells infected with rSB1-F. Cells were infected with the 0.001 MCI of rSB1-F and SB1wt. Every 24 hours, cell lysates were collected and analyzed by Western blot, detecting a ~52kDa band (F1), a ~59kDa band (F0), and finally a ~120kDa band (dF1) of the F protein. Beta-actin acti(nβa-) was detected as a run control, and CEF cells infected with SB1wt, in which no band was detected, were used as a negative control. (C) Infection process and formation of lysis plaques of rSB1-F and SB1wt in CEF cells. Cells were infected with the 0.001 MCI.001, every 24 hours post-infection, the cells were fixed with 4% paraformaldehyde, finally the images were captured using an inverted phase-contrast microscope.

[0029] Figure 5 shows the results of the humoral immune response assessment using an ELISA assay of the ID Screen Newcastle Disease Indirect (ID. Vet) - NDVS kit from Experiment No. 1 in SPF birds. (A) Antibodies were monitored in serum samples at 34, 46, and 55 days post-immunization, using an ELISA kit specific for NDV F protein. The mean titer and standard deviation are represented by a horizontal bar and whiskers. Positive samples were considered above the cutoff limit (993 titer). (B) Survival percentages from Experiment No. 1 (Groups: No. 1 and No. 2) were evaluated up to 14 days post-challenge.

[0030] Figure 6 shows the results of the humoral immune response assessment using an ELISA assay from the ID Screen Newcastle Disease Indirect (ID. Vet) - NDVS kit in Experiment No. 2 in broiler chickens. (A) Antibodies were monitored in serum samples at 20, 34, and 41 days post-immunization using an ELISA kit specific for NDV F protein. The mean titer and standard deviation are represented by a horizontal bar and whiskers. Positive samples were considered above the cutoff limit (993 titer). (B) Survival percentages from Experiment No. 2 (Groups: No. 1 and No. 2) were evaluated up to 14 days post-challenge.

[0031] Figure 7 shows the strategy used to generate the rSB1-ILTV (gD-l) virus using CRISPR / Cas9-NHEJ technology. (A) The parental virus genome, or SB1wt, is shown with a single long region (UL), a single short region (US), and a long (TRL / IRL) and short (TRS / IRS) internal repeat region. Strategy used to generate rSB1-ILTV (gD-l) by CRISPR / Cas9-NHEJ. This figure was created with BioRender.com (Figure not to scale). (B) Confirmation of the correct insertion of the ILTV Dl gene expression cassette into the rSB1-GFP-ILTV and rSB1-ILTV genomes was demonstrated using specific primers via conventional PCR.

[0032] Figure 8 shows the evaluation and selection of recombinant clones by conventional PCR of rSB1-GFP-ILTV (gD-l) obtained from the transfection stage. The recombinant clones C6, C7, C8, C13, C15, C16, and C20 were evaluated by PCR with specific primers that amplify the entire expression cassette; the product amplified an expected band of 6855 bp.

[0033] Figure 9 shows the in vitro evaluation of the stability of the expression cassette containing the genes encoding ILTV glycoproteins D and I in the Gallid alphaherpesvirus 3 genome. CEF cells were infected with the rSB1-ILTV virus (gD-l). (A) The expression of glycoproteins D and I was evaluated in rSB1-ILTV-infected CEF cells (gD-l) by Western blot every 5 passages (passages 5 to 25), where we detected a band of ~48.5 kDa corresponding to glycoprotein D (gD) and a band of ~39.5 kDa corresponding to glycoprotein I (gl). Beta-actin α (βc-tin) ~42 kDa was detected as a run control, and CEF cells infected with SB1wt were used as a negative control, in which no bands were detected.(B) Every 5 passages (passages 5 to 20), the presence of the inserted cassette containing the genes encoding ILTV glycoproteins D and I in the rSB1-ILTV (gD-l) genome was assessed by conventional PCR using specific primers. SB1wt was used as a control. (C) The indirect immunofluorescence assay (IFA) demonstrated the expression of glycoproteins D and I (green fluorescence) in cells infected with the recombinant rSB1-ILTV (gD-l) virus in passages 10, 15, 20, and 25 in CEFs. Lower panel (fluorescence emission) and upper panel (bright field). CEFs infected with SB1wt were used as a negative control. Digital images were captured at 200x magnification and processed using an AxioCam MRc5 camera (Carl Zeiss, Germany).

[0034] Figure 10 shows the results of the humoral immune response assessment using an ELISA assay specific to ILTV glycoprotein I (gl) IDScreen ILT gl Indirect (ID. Vet, Cat. No. ILTGIS) and the survival percentage of Experiment No. 1 in broiler chickens. (A) Antibodies were monitored in serum samples at 21, 34, 42, and 49 days post-immunization, using an ELISA kit specific for ILTV glycoprotein I. The mean titer and standard deviation are represented by a horizontal bar and whiskers. Positive samples were considered above the cutoff limit (Cut-off: > 611 titer). (B) Clinical sign score. The groups of birds were challenged with an ILTV strain at 42 days post-vaccination. Subsequently, clinical signs were monitored until day 10 post-challenge.Clinical sign scores were designated as follows: 0 = no clinical signs; 1 = mild conjunctivitis, respiratory distress, or hoarseness; 2 = moderate conjunctivitis, respiratory distress, or hoarseness; 3 = severe conjunctivitis, respiratory distress, or hoarseness. (C) Viral shedding of the challenge virus. Tracheal swabs were collected on days 3, 5, and 7 post-challenge from the groups of birds (n = 7). The viral load of the challenge virus was determined using quantitative real-time PCR, with detection of the ILTV glycoprotein B (gB) gene.

[0035] Figure 11 shows the strategy used to generate the rSB1-VP2 virus using CRISPR / Cas9-NHEJ technology, employing two sgRNAs from the US2 gene region (SB1 sg1 / US2 and SB1 sg2 / US2). The genome of the parental virus, or SB1wt, is shown with a single long region (UL), a single short region (US), and a long (TRL / IRL) and short (TRS / IRS) internal repeat region. This figure was created using BioRender.com (the figure is not to scale). Figure 12 shows the evaluation and selection of recombinant clones of rSB1-GFP-VP2 obtained from transfection by conventional PCR.Recombinant clones: C10, C11, C15, C16, C17, and C18 (corresponding to SB1 sg1 / US2), clones C2, C3, C5, C8, and C12 (corresponding to SB1 sg2 / US2), were evaluated by PCR with specific primers MDV2-US2-5F + MDV2-US2-5R that amplify the flanking region of the reporter cassette, the product amplified an expected band of 6027 bp.

[0036] Figure 13 shows the evaluation and selection of recombinant clones obtained by conventional PCR of rSB1-GFP-VP2. Recombinant clones: C10, C11, C15, C16, C17, and C18 (corresponding to SB1 sg1 / US2 (50)), clones C2, C3, C5, C8, and C12 (corresponding to SB1 sg2 / US2 (51)), were evaluated by PCR with specific primers MDV2-US2-6F + MDV2-US2-VP2-6R that amplify the junction region between the expression cassette and the vector genome; the amplified products showed a band size of 918 and 768 bp respectively.

[0037] Figure 14 shows the evaluation and selection of recombinant clones obtained by conventional PCR of rSB1-GFP-VP2. Recombinant clones: C10, C11, C15, C16, C17, and C18 (corresponding to SB1 sg1 / US2 (50)), clones C2, C3, C5, C8, and C12 (corresponding to SB1 sg2 / US2 (51)), were evaluated by PCR with specific primers MDV2-EGFP-US2-7F + MDV2-US3-7R that amplify the junction region between the expression cassette and the vector genome; the amplified products showed a band with a size of 514 and 664 bp respectively.

[0038] Figure 15 shows the in vitro evaluation of the stability of the expression cassette containing the gene encoding the VP2 protein in the Gallid alphaherpesvirus 3 genome. CEF cells were infected with the rSB1-GFP-VP2 virus. The IFA assay demonstrated the expression of the VP2 gene (red fluorescence) in cells infected with the recombinant rSB1-GFP-VP2 virus. CEF cells infected with SB1wt were used as a negative control. Digital images were captured at 200x magnification and processed using an AxioCam MRc5 camera (Carl Zeiss, Germany).

[0039] Figure 16 shows the expression of the IBDV VP2 protein in CEF cells infected with rSB1-GFP-VP2 (IBDV). Cells were infected with a 0.0001 MCI of rSB1-GFP-VP2 and SB1wt. After 48 hours, cell lysates were collected and analyzed by Western blotting, detecting a ~48kDa band (VP2). As a negative control, CEF cells infected with SB1wt were used, in which no band was detected.

[0040] DETAILED DESCRIPTION OF THE INVENTION

[0041] The present invention falls within the veterinary pharmaceutical industry and relates to recombinant molecular biology methods for the development of immunogenic products for use in animals, such as birds. In particular, the present invention relates to the field of preventive veterinary medicine.

[0042] In one embodiment, the invention encompasses a recombinant Gallid alphaherpesvirus 3 (GaHV-3, MDV-2) virus, expressing the fusion gene (F) of Newcastle disease virus (NDV) genotype XII comprising identification sequence SEQ. ID. NO. 4.

[0043] In a further embodiment, the invention encompasses a recombinant Gallid alphaherpesvirus 3 (GaHV-3, MDV-2) virus expressing the fusion gene (F) of Newcastle disease virus (NDV) genotype XII wherein the fusion gene (F) insertion is inserted into the non-coding intergenic region between UL45 / 46 of the genome of Gallid alphaherpesvirus 3 (GaHV-3, MDV-2) non-oncogenic strains: SB-1 (SEQ. ID. NO. 1), 301 B / 1, and HPRS-24.

[0044] In a further embodiment, the invention encompasses a recombinant Gallid alphaherpesvirus 3 (GaHV-3, MDV-2) virus expressing the fusion gene (F) of Newcastle disease virus (NDV) genotype XII wherein the cleavage or cutting site has been modified from polybasic ( 112 RRQKRF 117 ) to dibasic ( 112 GRQGRL 117 ).

[0045] In a further embodiment, the invention comprises a recombinant Gallid alphaherpesvirus 3 (GaHV-3, MDV-2) virus expressing the fusion gene (F) of Newcastle disease virus (NDV) genotype XII according to claim 1, wherein the synthetic sequence of cassette F is stored in the pUC57-F plasmid. In a further embodiment, the invention comprises an immunogenic composition comprising the recombinant Gallid alphaherpesvirus 3 (GaHV3; MDV-2) virus expressing the F gene of NDV genotype XII identified with SEQ ID No. 5 and pharmaceutically acceptable excipients.

[0046] In a further embodiment, the invention encompasses an immunogenic composition comprising the recombinant Gallid alphaherpesvirus 3 (GaHV3; MDV-2), expressing the D and I glycoproteins of ILTV strain VFAR-043 identified with SEQ ID NO. 22, and pharmaceutically acceptable excipients.

[0047] In a further embodiment, the invention encompasses an immunogenic composition comprising the recombinant Gallid alphaherpesvirus 3 (GaHV3; MDV-2), expressing the VP2 gene of IBDV Faragher strain 52 / 70, identified with SEQ ID NO. 36, and pharmaceutically acceptable excipients.

[0048] In a further embodiment, the invention encompasses a recombinant Gallid alphaherpesvirus 3 (GaHV3; MDV-2) virus expressing the fusion gene (F) of Newcastle disease virus (NDV) genotype XII wherein the synthetic sequence of cassette F (genotype XII) is stored in the pUC57-F plasmid, the sequence of cassette F and HN of NDV may vary or be obtained from other strains; Clone 30, LaSota, and B1, these being able to belong to genotype I, II, and Vil.

[0049] In another embodiment, the invention covers a process for generating a recombinant Gallid alphaherpesvirus 3 (GaHV3; MDV-2) virus that expresses antigenic genes against different avian diseases NDV, ILTV, IBDV, IBV, and AIV, wherein the process comprises: a) Design and construction of the gRNAs and the donor plasmid; b) Generation of recombinants; c) Recovery of the recombinant viruses; e) Selection and characterization of the recombinant viruses containing the GFP cassette + the cassette of interest (protective antigen), by conventional PCR amplifying the entire inserted cassette and the junction regions between the genome of the obtained recombinant virus and the genome of the modified virus itself; f) Removal of the expression cassette of the fluorescent reporter gene “GFP” by the Cre-Lox system and selection of recombinant clones using conventional PCR;g) Detection of protein expression of interest in cells infected with recombinant viruses by indirect immunofluorescence (IFA); h) Determination of gene expression by Western blot (WB); i) Evaluation of genetic stability of the cassette inserted into the viral genome by conventional PCR and / or Western blot (WB); and j) Measurement of in vitro growth properties.

[0050] In another additional embodiment, the invention covers a kit comprising a vaccine or immunogenic composition and a medium which may be a bag containing a nutrient medium called DMEM as a sterile diluent and which may be refrigerated at 4°C.

[0051] In another additional embodiment, the invention covers a vaccine comprising the recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) wherein the virus concentration required to achieve the antigenic response is 3000 plaque-forming units per bird (PFU / bird).

[0052] In another additional embodiment, the invention encompasses a viral vector comprising a recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) according to the invention, useful in the control against Newcastle disease virus (NDV), against infectious bursal disease or Gumboro virus (IBDV), against avian infectious bronchitis virus (IBV), against avian infectious laryngotracheitis virus (ILTV), and against avian influenza virus (IAV).

[0053] In another additional embodiment, the invention encompasses a vaccine comprising the recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) according to the invention, wherein the Gallid alphaherpesvirus 3 (GaHV3; MDV-2) is selected from the non-oncogenic strains: SB-1, 301 B / 1, and HPRS-24.

[0054] Example 1: Construction, immunogenicity, and protective efficacy of Gallid alphaherpesvirus 3 (GaHV-3) that efficiently expresses the Newcastle disease virus (NDV) genotype XII fusion gene in SPF birds and broilers. I. Methodology

[0055] Animals

[0056] Specific pathogen-free (SPF) White leghorn 1 day old (Charles River Avian Vaccine Services, Norwich, USA) (Experiment No. 1) and broiler chickens 1 day old (Experiment No. 2).

[0057] Cells vs. viruses

[0058] For the generation and maintenance of the recombinant rSB1-F virus, chicken embryo fibroblast cells (CEFs) were extracted from 9-10 day-old pathogen-free (SPF) embryonated eggs (Charles River Avian Vaccine Services, Norwich, USA). The CEFs were maintained in Dulbecco's Modified Eagle medium / F12 (DMEM, Thermo Fisher Scientific) supplemented with 5% inactivated fetal bovine serum (FBS) (SFB, Thermo Fisher Scientific) and antibiotic-antifungal 1* (Thermo Fisher Scientific), at 37°C, under a 5% CO2 atmosphere.

[0059] The Gallid alphaherpesvirus 3 (GaHV3) or MDV-2 (MDV serotype 2) strain SB1 (GenBank Accession No.: HQ840738.1) (SEQ ID NO.1) was used for the generation of the recombinant virus rSB1-F in CEFs cells by CRISPR / Cas9 technology and by the NHEJ repair pathway.

[0060] The NDV challenge strain known as NDV / peacock / Peru / 2011 (PP2011) (GenBank accession no. KR732614) belonging to class II genotype XII with an intracerebral pathogenicity index (ICPI) of 1.80 with characteristics of a velogenic pathotype, was previously isolated and characterized in Peru.

[0061] Design and construction

[0062] The recombinant virus rSB1-F was obtained by CRISPR / Cas9-NHEJ technology using the plasmids and sgRNAs: pGEM-sgA-GFP-F, px459v2.0-sgRNA-sgA, and px459v2.0-sgRNA1-SB1 / UL45-46, px459v2.0-sgRNA2-SB1 / UL45-46, px459v2.0-sgRNA3-SB1 / UL45-46, px459v2.0-sgRNA4-SB1 / UL45-46.

[0063] Design and construction of the sqRNAs v of the donor plasmid

[0064] Selection and design of sqRNAs

[0065] The target sequence in this invention was the intergenic region of the UL45 and UL46 genes of the Gallid alphaherpesvirus 3 genome, which was submitted for gRNA design (http: / / crispr.mit.edu / ), and four sequences with the highest scores were selected. These sequences are shown in Table 1.

[0066] The px459v2.0 plasmid (catalog no. 62988; Addgene, USA) was digested with Bbsl-HF (Neb New England BioLabs, Inc) and then purified using the QIAquick Gel Extraction Kit (Qiagen) following the manufacturer's instructions.

[0067] The sgRNAs were presented as oligo-DNA primers corresponding to the sgRNA of the target sequence. They were synthesized and cloned into the px459v2.0 cloning vector, which had been previously digested, to construct the px459v2.0-sgRNA. The sg-A sequence was taken from a previous publication and cloned into the px459v2.0 plasmid in the same manner. The correct insertion of the sgRNAs was confirmed by digestion with the Bbsl-HF enzyme (Data not shown).

[0068] Sequence of the non-coding intergenic region between UL45 / 46 of the Gallid alphaherpesvirus 3 (strain SB1) genome (SEQ ID NO.2)

[0069] Size: 119pb >acgcgagagaccgagcattagagtagcacttatttattctatcgcagagaaacaccgcgcgcgttcaaaaaaaacacagg cggggtacgataaatttacgcggccgcgctatgtttact

[0070] Table 1. sgRNA sequences designed based on the 119 bp sequence of the UL45 / 46 intergenic region of the Gallid alphaherpesvirus 3 genome (SB1 strain) (GenBank Accession No.: HQ840738.1) https: / / www.ncbi.nlm.nih.gov / nuccore / HQ840738.1.

[0071] B = Lower DNA strand, T = Upper DNA strand

[0072] sgRNA cloning procedure

[0073] sgRNA hybridization

[0074] The sgRNA was synthesized as oligo: 5'CACCNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNCAAA 5'

[0075] *The sgRNA was resuspended in nuclease-free water and diluted 1 / 10 to have a final working concentration of 10 pM.

[0076] 1x hybridization reaction:

[0077] 'Hybridization buffer solution: 10mM Tris, pH 7.5-8; 50mM NaCl, 1 mM EDTA.

[0078] The samples were placed in the thermocycler under the following conditions: 90°C for 3 min and 37°C for 1 hour.

[0079] The samples were qualified by spectrophotometry using an Eppendorf BioPhotometer plus, yielding an average value of 200 ng / pl. A 1 / 10 dilution was performed to obtain a working stock of 20 ng / pl. Digestion or linearization of the pX459-v2.0 plasmid vector (catalog No. 62988; Addgene, USA)

[0080] 1X digestion reaction:

[0081] The samples were placed in the thermocycler at 37°C for 6 hours.

[0082] An electrophoresis assay was performed to purify the band of interest, which contains the linear DNA. The gel was cut and the DNA was extracted using the QIAquick® Gel Extraction Kit 250. The linearized DNA was quantified and stored at 4°C.

[0083] Ligation of sgRNAs with the pX459-v2.0 vector

[0084] The protocol described by NEB (Quick ligation protocol - M2200) was followed.

[0085] 1x ligation reaction:

[0086] The ligation products (sgRNA + px459-v2.0 vector) that gave rise to the new plasmids were identified:

[0087] The px459v2.0-sgRNA1-SB1 / UL45-46 plasmid was selected for the following cloning steps. Transformation into DH5a-competent E. coli bacteria with the ligation product yielded the recombinant plasmid px459v2.0-sqRNA1-SB1 / UL45-46.

[0088] The ligation product (sgRNA + px459-v2.0 vector) was added to competent E. coli DH5a cells, followed by a 4-hour heat shock o at 42°C.

[0089] The transformed bacteria were grown in Luria Bertani (LB) broth supplemented with the antibiotic ampicillin (100pg / ml), and were transferred by plating to LB agar plates supplemented with ampicillin (100pg / ml) for subsequent selection of clones (recombinant plasmids).

[0090] Extraction and purification of the recombinant plasmid px459v2.0-sqRNA1-SB1 / UL45-46

[0091] Clones (recombinant plasmids) were selected and grown in LB broths supplemented with ampicillin (100 pg / ml). The bacterial pellet was concentrated, and the plasmid was extracted using the QIAprep® Spin Miniprep Kit (250), according to the manufacturer's instructions, using the QIAcube instrument. The correct insertion of the sgRNA into the pX459-v2.0 plasmid was verified by analyzing the digestion product with the Bbsl-HF digestion enzyme in a 1% agarose gel electrophoresis run. Finally, the UL45-46 specific SB1 sgRNA was named px459v2.0-sgRNA1-SB1 / UL45-46.

[0092] Design and construction of the donor plasmid

[0093] To construct the donor plasmid, two consecutive cloning processes were performed: the open reading frame (ORF) of the fusion protein (F) of genotype XII strain PP2011 (NDV / peacock / Peru / 2011) (GenBank accession number: KR732314) (SEQ ID NO. 3), which is flanked at both ends by the Sfil restriction site (upstream and downstream). This sequence was synthesized and subsequently cloned into the pUC57 plasmid by GenScript; the resulting plasmid was named pUC57-F.

[0094] The pGEM-sgA-GFP plasmid, previously constructed. This plasmid was digested and linearized by the Sfil enzyme. The pGEM-sgA-GFP plasmid (this plasmid contains: sgA + cytomegalovirus rnurino promoter + Sfi cleavage sites + an SV40 Poly A signal sequence + a GFP expression cassette for the expression of the fluorescence reporter gene, the latter flanked by LoxP + sgA sequences).

[0095] The pUC57-F plasmid was digested by the Sfil enzyme to release the F cassette, then this cassette was cloned into the pGEM-sgA-GFP plasmid (linearized), the resulting plasmid was named pGEM-sgA-GFP-mCMV-F-Pol¡ A (8886bp).

[0096] The correct insertion and orientation of the F expression cassette was verified by PCR using specific primers and by sequencing (data not shown).

[0097] Table 2. List of primers and sgRNAs used in this invention study

[0098] Generation of recombinant rSB1-GFP-F

[0099] 0.5x10 were sown 6CEF cells were placed in a 6-well cell culture plate in maintenance medium (1x DMEM + 5% FBS) at 37 °C under 5% atmospheric CO2. After 24 hours, the supernatant was removed and the monolayer was washed three times consecutively with DPBSIx to remove any remaining cellular debris. The cells were infected with SB1wt at a multiplicity of infection (MOI) of 0.001 for 8 hours at 37 °C and 5% CO2 in 1x DMEM + 5% FBS.

[0100] The next day, 1 pg of the pGEM-sgA-GFP-mCMV-F-Poly A plasmid containing the mCMV-F-polyA cassette, 0.5 pg of sgRNA-sgA, and 0.5 pg sgRNA SB1 UL45-46, were co-transfected for 24 hours using Lipofectamine® Reagent (Thermo Fisher Scientific) following the manufacturer's instructions.

[0101] At 24 hours post-transfection, the supernatant containing the DNA:Lipofectamine complex was removed and replaced with a fresh maintenance medium, to avoid any toxicity in the cell monolayer.

[0102] Three days post-transfection, the infected / transfected cells were transferred and distributed into 2 six-well plates of pre-seeded CEF cell culture.

[0103] Four days post-transfection / infection, lysis plates exhibiting GFP fluorescence were visible, corresponding to the recombinant virus. Selected clones were then purified using three rounds of plate purification. For this purpose, single cells expressing the F / GFP protein were selected and distributed into 96-well cell culture plates by fluorescence-activated cell sorting (FACS) on a BD FACSMelody™ Cell Sorter (BD Biosciences). The new recombinant virus was named rSB1-GFP-F (SEQ ID NO. 4). Subsequently, the presence and expression of the F cassette were verified by conventional PCR, IFA, and Western blot.

[0104] Selection of recombinant rSB1-GFP-F clones

[0105] Recombinant rSB1-GFP-F clones were evaluated by conventional PCR to confirm the correct insertion of the F / GFP cassette into the SB1 genome post-transfection and purification. Twelve clones (C1 to C12) were selected and infected into pre-seeded CEF cells, then trypsinized once an infection rate of 70% was reached. Viral DNA was extracted and analyzed by conventional PCR using the following specific primers: MDV2-UL45-UL46 F2Z and MDV2-UL45-UL46 R2 (Data not shown). Removal of the GFP reporter cassette was performed using the Cre-Lox system.

[0106] The GFP expression cassette (flanked by LoxP sequences) of rSB1-GFP-F was removed using the Cre-Lox system. A CEF cell monolayer was prepared in a 6-well cell culture plate, and the monolayer was then infected with the rSB1-GFP-F virus at an MOI of 0.01 for 24 hours. Subsequently, the infected monolayer was co-transfected with 2 pg of Cre-recombinase using Lipofectamine® Reagent (Thermo Fisher Scientific) according to the manufacturer's instructions.

[0107] Twelve hours post-transfection, the culture medium was changed to avoid any cytotoxic effects. Complete removal of the GFP reporter gene expression cassette was confirmed by the appearance of new non-fluorescent lysis plaques. Finally, the new recombinant virus obtained was named rSB1-F (SEQ ID NO. 5).

[0108] Selection of recombinant rSB1-F clones post-removal of the GFP reporter cassette

[0109] The complete removal of the GFP reporter cassette in the rSB1-GFP-F clones was verified by conventional PCR using specific primers: MDV2-UL45-UL46 F2 / MDV2-UL45-UL46 R2. Likewise, these same primers allowed the evaluation of the integrity of the F cassette in SB1.

[0110] Indirect immunofluorescence assay (IFI) detection of F protein expression

[0111] CEF cells were grown in 12-well cell culture plates and then infected with SB1wt and rSB1-F at a MOI of 0.001. After 48 hours post-infection (hpi), the cells were washed three times with 1x DPBS and then fixed with 4% paraformaldehyde for 30 min at room temperature. The cells were incubated with the primary antibody in a 5% bovine serum albumin (BSA) solution in DPBS for 1 h at room temperature. A chicken anti-MDV antibody (Charles River Avian Vaccine Services, Norwich, USA) was used as a positive control for the detection of SB1 infection, and a rabbit primary antibody against NDV F (GenScript, Piscataway, NJ, USA) was used for the detection of F protein expression.After three washes with 1x DPBS, the cells were incubated with Alexa Fluor® 405 (Abeam, Cambridge, MA, USA) goat anti-chicken IgY antibody (blue fluorescence) and Alexa Fluor® 594 (Abeam, Cambridge, MA, USA) goat anti-rabbit IgG H&L antibody (red fluorescence), respectively, in 1x DPBS with 5% BSA for 45 min at room temperature. The results were observed using an ObserverAI fluorescence microscope (Carl Zeiss, Germany). Digital images were taken at 50x magnification and processed with an AxioCam MRc5 camera (Carl Zeiss, Germany).

[0112] Western blot

[0113] To evaluate NDV F protein expression, CEF cells were infected with recombinant virus at an MCI of 0.01. At 72 hpi, the CEF cells were lysed and analyzed by Western blot. The Western blot analysis was performed using a primary specific antibody against NDV F (GenScript) diluted 10 / 5000 in 1% milk in 0.1% PBS-T for 15 hours at room temperature with constant agitation. Subsequently, three washes were performed with 0.1% PBS-T (each wash lasting 10 minutes with constant agitation). At the end of the washings, the membrane was incubated with the monoclonal anti-Rabbit IgG HRP secondary antibody (Catalog No. A01827, GenScript, Piscataway, NJ, USA) diluted 1 / 5000 in 1% milk in 0.1% PBS-T for 2 hours at room temperature with constant stirring.

[0114] Protein expression visualizations were detected using a photodocumentation system and an AZURE CCD camera (Azure Biosystems, Inc., Dublin, USA).

[0115] In vitro genetic stability of rSB1-F

[0116] Genetic stability was evaluated in CEFs up to passage 20. Viral DNA was extracted from infected CEF cells; every 5 passages the presence of the F cassette and insert was verified, which was confirmed by conventional PCR, using specific primers MDV2-UL45-UL46 F2 / MDV2-UL45-UL46 R2. The expression of the F protein was evaluated every 5 passages by Western blot assay, previously described in the Western blot section.

[0117] Experimental design No. 1: Immunization of SPF birds with the rSB1-F vaccine

[0118] Twenty one-day-old SPF chicks were randomly divided into two groups: Group 1 = rSB1-F (n=10), which was immunized with 3000 plaque-forming units (PFU) of the rSB1-F vaccine per bird via subcutaneous injection, and Group 2 = non-immunized control (n=10). At 34, 46, and 55 days post-immunization, serum samples were collected to evaluate the humoral immune response by detecting specific antibodies against the NDV Fusion protein, using an ID Screen Newcastle Disease Indirect (ID. Vet) - NDVS ELISA Kit.

[0119] To evaluate the protective efficacy of rSB1-F, immunized and non-immunized birds were partially transferred to the biosafety level 3 (BSL-3) facilities of FARVET SAC. The birds were challenged 59 days post-immunization with 10 40.1 ml of NDV genotype XII strain PP2011 TCID50 (0.05 ml through the ocular cavity and 0.05 ml through the nasal cavity) was administered. Clinical signs were observed for 14 days post-challenge (dpd) and recorded and reported daily. To determine viral shedding, oral and cloacal swab samples were collected (3, 5, and 7 dpd) from immunized and non-immunized birds, respectively. Following collection, the swabs were immediately immersed in 1 ml of 1x PBS supplemented with an antibiotic-antifungal (final concentration of 10x) and incubated for 30 minutes at 4°C. Each swab was then removed and the supernatant was clarified to remove cellular debris and / or food / fecal remnants by centrifugation at 3000 rpm for 15 min at 4°C. The samples were quantified by plate assay.

[0120] Experimental Design No. 2:

[0121] Immunization of broiler chickens with the rSB1-F vaccine

[0122] Twenty one-day-old broiler chicks were randomly divided into two groups: Group 1 = rSB1-F (n=10), which was immunized with 3000 PFU of rSB1-F per bird subcutaneously, and Group 2 = non-immunized control (n=10). At 20, 34, and 41 days post-immunization, serum samples were collected to evaluate the humoral immune response by detecting specific antibodies against the NDV F protein, using an ELISA Kit from ID Screen Newcastle Disease Indirect (ID. Vet) - NDVS.

[0123] To evaluate the protective efficacy of rSB1-F, immunized and non-immunized birds were partially transferred to the BSL-3 facilities of FARVET SAC. The birds were challenged 44 days post-immunization with 10 4TCID5o of NDV genotype XII strain PP2011 with 0.1 ml (0.05 ml through the ocular cavity and 0.05 ml through the nasal cavity). Observations were made for a period of 14 days post-dwell to evaluate clinical signs; these were noted and reported daily.

[0124] To determine viral shedding, oral and cloacal swab samples (3, 5, and 7 days post-infection [dpd]) were collected from immunized and non-immunized birds, respectively. Following collection, the swabs were immediately immersed in 1 ml of 1x PBS supplemented with an antibiotic-antifungal (final concentration of 10x) and incubated for 30 min at 4°C. Each swab was then removed, and the supernatant was clarified to remove cellular debris and / or food / fecal remnants by centrifugation at 3000 rpm for 15 min at 4°C. The samples were quantified by plate assay.

[0125] Statistical analysis

[0126] All statistical analysis was performed using GraphPad Prism version 8.01 (GraphPad Software, San Diego, CA). Two-way ANOVA was used to compare data between different groups. Differences were considered significant with a p-value <0.0001. ELISA titers were analyzed using Tukey's multiple comparisons test at the 95% confidence level.

[0127] I. Results:

[0128] Construction and recovery of the recombinant virus rSB1-F

[0129] The small gRNAs (sgRNA-sgA and sgRNA-UL45-46) were designed, synthesized, and cloned into the px459v.2O plasmid, which contains the Cas9 gene of S. pyogenes. The resulting plasmids were named px459v2.0-sgRNA-sgA and px459v2.0-sgRNA-UL45-46. The donor plasmid pGEM-sgA-GFP-F contains the reporter GFP expression cassette, which is flanked by two LoxP sequences for its separation from the expression F cassette. Both cassettes were flanked by sg-A sites to introduce a desired cleavage for cassette release and integration into the UL45-46 intergenic region of the SB1wt genome. The Cas9 endonuclease promotes the insertion of the GFP and NDV cassette into the UL45-46 intergenic region of the SB1wt genome, see Figure 1.

[0130] For the generation of the rSB1-GFP-F virus, CEF cells were co-transfected with the plasmids pGEM-sgA-GFP-F, px459v2.0-sgRNA-sgA, and px459v2.0-sgRNA-UL45-46. At 24 hours post-transfection, the cells were infected with the SB1wt virus at an MOI of 0.01. GFP-expressing plaques were visible 3 days post-transfection / infection, demonstrating successful cassette insertion. The recombinant virus was isolated in three rounds of purification by isolation from Isis plaques and by Cell Sorter.

[0131] Subsequently, the GFP reporter cassette was removed using Cre-recombinase (pcDNA3.1-Cre) treatment via the Cre-LoxP system. Cells infected with the rHVT-GFP-F virus were co-transfected with Cre-recombinase, and plaque lysis without fluorescence was observed 4 days post-transfection / infection. Complete removal was confirmed by conventional PCR using the specific primers MDV2-UL45-UL46 F2 and MDV2-UL45-UL46 R2 (Figure 4C). Finally, the new recombinant virus was named rSB1-F.

[0132] Selection of clones post-removal GFP reporter cassette

[0133] After removal of the GFP reporter cassette, five recombinant rSB1-F clones were selected. Complete removal of the GFP reporter cassette was verified by conventional PCR using the specific primers MDV2-UL45-UL46 F2 / MDV2-UL45-UL46 R2. Clones C1 to C5 exhibited the expected size of 4112 bp, demonstrating complete removal of the reporter cassette and integrity of the NDV F cassette in the UL45-46 intergenic region of the Gallid alphaherpesvirus 3 (SB1) genome. Clone C1 was selected for further evaluations as a characterization of the recombinant virus.

[0134] Stability of the F gene in the recombinant rSB1-F virus genome. CEF cells were infected with the rSB1-F virus for 20 passages to determine the genetic stability of the virus using indirect immunofluorescence (IFA), polymerase chain reaction (PCR), and Western blotting. Viral DNA was analyzed every 5 passages by conventional PCR, where we detected the presence of the F gene with a band of ~4112 bp (Figure 3C). Similarly, every 5 passages (passage 5 to 20) we confirmed the expression of the F protein by Western blotting (Figure 3A) where we detected three bands: a band of ~52kDa that corresponds to subunit (F1), a band of ~59kDa that corresponds to the inactive precursor (F0), and finally a band of ~120kDa that corresponds to the F1 dimer (dF1) of the F protein. IFA demonstrated the expression of the F protein in cells infected with the recombinant virus in passage 20 in CEFs (Figure 3B).These results demonstrated that the presence and expression of the NDV F protein gene did not affect the replication of the recombinant virus, confirming the stability of the F gene in the recombinant viral genome.

[0135] Humoral response

[0136] A specific immune response against NDV was detected in group #1 rSB1-F (Experiment #1) at 46 days post-immunization (585.33 ± 175.22), with 100% being positive at 55 days post-immunization (10 / 10) (8342.9 ± 1506.28). On the other hand, in the non-immunized control group #2 (Experiment #1), no immune response was detected at 46 (21.40 ± 6.32) and 55 days post-immunization (116.200 ± 30.44), with the kit cut-off being 993. This latter monitoring was significant compared to the non-immunized control group (p < 0.0001 ****), see Figure 5A.

[0137] To determine if the rSB1-F vaccine was able to overcome maternal antibodies like the recombinant vector HVT, a second experiment was carried out in broiler chickens (experiment No. 2). Chickens immunized on the first day of age were monitored at 21 days post-immunization, detecting high antibody titers (1959.00 ± 1366.98) with the kit cut-off being 993, which were interpreted as maternal antibody titers because only 9 out of 10 chickens (9 / 10) were positive. Then, at 34 days post-immunization, 2 / 10 were positive (1190.22 ± 1909.31), with a kit cut-off of 993. And finally, at 41 days post-immunization, 8 / 10 were positive (4521.55 ± 6401.52), with a kit cut-off of 993, see Figure 6A. Efficacy against NDV genotype XII challenge

[0138] The protective efficacy in experiments No. 1 and 2 was demonstrated by the absence of clinical signs and mortality during the 14 days post-challenge (dpd). One-day-old birds were immunized with a single full dose of the rSB1-F vaccine (in 0.2 ml of diluent / dose), subcutaneously in the back of the neck, then challenged at 59 and 44 days post-immunization respectively, with NDV genotype XII, via the oculonasal route.

[0139] All immunized chickens (Experiments 1 and 2) showed complete protection, resulting in 100% viability and protection (10 / 10). In contrast, the non-immunized control chickens (Experiments 1 and 2) presented the typical clinical signs of the disease between 3 and 4 days post-adaptation (dpd), accumulating a total mortality of 100% (10 / 10) by 5 dpd (Table 5), see Figures 5B and 6B.

[0140] Viral shedding of the NDV challenge virus genotype XII in birds (Experiments 1 and 2) was quantified using plate assays (3, 5, and 7 days post-dwell) from tracheal and cloacal swab samples. A significant reduction in viral shedding titers was observed in respiratory tract samples (tracheal swab samples) from vaccinated birds compared to the unvaccinated control group after challenge. Surprisingly, viral shedding in the intestinal tract was completely eliminated; that is, viral replication of NDV genotype XII was neutralized in SPF birds and broiler chickens. Conversely, the unimmunized control groups in both Experiments 1 and 2 exhibited significantly high viral shedding compared to the immunized groups (see Tables 3 and 4).

[0141] Table 3. Frequency of tracheal and cloacal viral dissemination of the NDV challenge virus genotype XII, in SPF birds immunized with rSB1-F experiment No. 1 59 days post-immunization

[0142] 3 dpd (a > 5 dpd 7 dpd

[0143] Groups

[0144] TrachealCloacalTrachealCloacalTrachealCloacal

[0145] Group No.l= rSBl-F 2 / 7 0 / 7 1 / 7 0 / 7 0 / 7 0 / 7

[0146] Group No. 2 = Control No. 7 / 7 6 / 7 4 / 4 4 / 4 NS (b > NS immunized

[0147] Table 4. Frequency of tracheal and cloacal viral dissemination of the NDV challenge virus in immunized birds (broiler chickens) with rSB1-F experiment No. 2

[0148] 44 days post-immunization

[0149] (a) dpd = days post-challenge

[0150] (b) NS = No survivors

[0151] Table 5. Percentage of viability and mortality post-challenge of birds challenged with NDV genotype XII at 59 and 44 days post-immunization with rSB1 -F(XII) in experiment No. 1 (SPF chickens) and No. 2 (broiler chickens).

[0152] NS: Non-survivor.

[0153] List of Sequences:

[0154] SEQ ID NO.1 Nucleotide sequence of the Gallid alphaherpesvirus 3 (GaHV-3) genome, strain SB-1, with accession number by GenBank: HQ840738.1

[0155] Length: 165,994 base pairs (bp). SEQ ID NO.2 Nucleotide sequence of the non-coding intergenic region between UL45 / 46 of the Gallid alphaherpesvirus 3 (GaHV-3) genome strain SB-1, with accession number by GenBank: HQ840738.1 Length: 119 bp. SEQ ID NO.3 Nucleotide sequence of the F gene of NDV genotypes strain NDV / peacock / Peru / 2011 XII, with accession number by GenBank: KR732614; CDS: 4550-6211 bp.

[0156] Length: 1662 bp. SEQ ID NO.4 Nucleotide sequence of the complete genome of the rSB1-GFP-F virus Length: 171,856 bp.

[0157] SEQ ID NO.5 Nucleotide sequence of the complete genome of the rSB1-F virus Length: 169, 390 bp.

[0158] SEQ ID NO.6 Nucleotide sequence of the primer or forward primer 1 F in the 5' to 3' direction Length: 20 bp.

[0159] SEQ ID NO.7 Nucleotide sequence of the primer or reverse primer 1 R in the 5' to 3' direction Length: 20 bp.

[0160] SEQ ID NO.8 Nucleotide sequence of the primer or forward primer 2F in the 5' to 3' direction Length: 20 bp.

[0161] SEQ ID NO.9 Nucleotide sequence of the primer or reverse primer 2R in the 5' to 3' direction Length: 20 bp.

[0162] SEQ ID NO.10 Nucleotide sequence of the primer or forward primer MDV2-UL45-UL46 F2 in the 5' to 3' direction Length: 20 bp.

[0163] SEQ ID NO.11 Nucleotide sequence of the primer or reverse primer MDV2-UL45-UL46 R2 in the 5' to 3' direction Length: 20 bp.

[0164] SEQ ID NO.12 Nucleotide sequence of the primer or forward primer SB1_FXII_UL46F in the 5' to 3' direction Length: 20 bp.

[0165] SEQ ID NO.13 Nucleotide sequence of the primer or reverse primer SB1_FXII_UL46R in the 5' to 3' direction. Length: 20 bp. SEQ ID NO.14 Nucleotide sequence of the upper strand oligo gRNA1_UL45 / 46 / SB1_T. Length: 24 bp.

[0166] SEQ ID NO.15 Nucleotide sequence of the lower strand oligo gRNA1_UL45 / 46 / SB1_B Length: 24 bp.

[0167] Example 2:

[0168] Construction, immunogenicity and protective efficacy of Gallid alphaherpesvirus 3 (GaHV-3) that efficiently expresses the D-I glycoproteins (gD-l) of the avian infectious laryngotracheitis virus (ILTV) in broiler chickens

[0169] II. Methodology

[0170] Animals

[0171] One-day-old broiler chickens (Experiment No. 1) were used to evaluate the immunogenicity and efficacy of the rSB1-ILTV (gD-l) vaccine against avian infectious laryngotracheitis virus (ILTV).

[0172] Cells and viruses

[0173] For the generation and maintenance of the recombinant rSB1-ILTV (gD-l) virus, CEF cells extracted from 9-10 day-old SPF embryonated eggs (Charles River Avian Vaccine Services, Norwich, USA) were used. The CEF cells were maintained in DMEM / F12 (Thermo Fisher Scientific) supplemented with 5% inactivated FBS (Thermo Fisher Scientific) and 1x antibiotic-antifungal (Thermo Fisher Scientific), at 37 °C, under a 5% CO2 atmosphere.

[0174] The GaHV3 or MDV-2 virus strain SB1 (GenBank Accession No.: HQ840738.1) (SEQ ID NO.1) was used for the generation of the recombinant virus rSB1-ILTV (gD-l), in CEFs cells by CRISPR / Cas9 technology and by the NHEJ repair pathway.

[0175] The ILT challenge strain used to evaluate the efficacy of the rSB1-ILTV (gD-l) vaccine was the VFAR-043 strain isolated and reported in South American countries (10.1637 / 11939-073018-Reg.1). Design and construction

[0176] The recombinant virus rSB1-ILTV (gD-l) was obtained by CRISPR / Cas9-NHEJ technology using the plasmids and sgRNAs: pGEM-sgA-GFP-mCMV-ILTV (gD-l)-Poli A, px459v2.0- sgRNA-sgA, and px459v2.0-sgRNA1-SB1 / UL45-46, px459v2.0-sgRNA2-SB1 / UL45-46, px459v2.0-sgRNA3-SB1 / UL45-46, and px459v2.0-sgRNA4-SB1 / UL45-46.

[0177] Design and construction of sgRNAs and the donor plasmid

[0178] Selection and design of sgRNAs

[0179] The target sequence in this invention was the intergenic region of the UL45 and UL46 genes of the Gallid alphaherpesvirus 3 (SB1 strain) genome, which was submitted for gRNA design (http: / / crispr.mit.edu / ), and four sequences with the highest scores were selected. These sequences are shown in Table 1.

[0180] The px459v2.0 plasmid (catalog no. 62988; Addgene, USA) was digested with Bbsl-HF (Neb New England BioLabs, Inc) and then purified using the QIAguick Gel Extraction Kit (Qiagen) following the manufacturer's instructions.

[0181] The sgRNAs were presented as corresponding DNA oligo-primers for the target sgRNA sequence, which were synthesized and cloned into the px459v2.0 cloning vector previously digested for the construction of px459v2.0-sgRNA. The sg-A sequence was taken from a previous publication and cloned into the px459v2.0 plasmid in the same manner. The correct insertion of the sgRNAs was confirmed by digestion with the Bbsl-HF enzyme (Data not shown).

[0182] Sequence of the non-coding intergenic region between UL45 / 46 of the Gallid alphaherpesvirus 3 (strain SB1) genome (SEQ ID NO.2)

[0183] Size: 119pb

[0184] >acgcgagagaccgagcattagagtagcacttatttattctatcgcagagaaacaccgcgcgcgttcaaaaaaaacacagg cggggtacgataaatttacgcggccgcgctatgtttact Table 6. sgRNA sequences designed based on the 119 bp sequence of the UL45 / 46 intergenic region of the Gallid alphaherpesvirus 3 genome (SB1 strain) (GenBank Accession No.: HQ840738.1)

[0185] B = Lower DNA strand, T = Upper DNA strand

[0186] sgRNA cloning procedure

[0187] sgRNA hybridization

[0188] The sgRNA was synthesized as an oligo:

[0189] 5'CACCNNNNNNNNNNNNNNNNNNN

[0190] NNNNNNNNNNNNNNNNNNNNNNCAAA 5'

[0191] *The sgRNA was resuspended in nuclease-free water and diluted 1 / 10 to have a final working concentration of 10 pM.

[0192] 1x hybridization reaction:

[0193] 'Hybridization buffer solution: 10mM Tris, pH 7.5-8; 50mM NaCl, 1 mM EDTA.

[0194] The samples were placed in the thermocycler under the following conditions:

[0195] The samples were heated at 90°C for 3 minutes and then at 37°C for 1 hour. The samples were quantified by spectrophotometry using an Eppendorf BioPhotometer plus, yielding an average value of 200 ng / pl. A 1 / 10 dilution was performed to obtain a working stock of 20 ng / pl.

[0196] Digestion or Linearization of the pX459-v2.0 plasmid vector (catalog No. 62988; Addgene, USA)

[0197] 1X digestion reaction:

[0198] The samples were placed in the thermocycler at 37°C for 6 hours.

[0199] An electrophoresis assay was performed to purify the band of interest, which contains the linear DNA. The gel was cut and the DNA was extracted using the QIAquick® Gel Extraction Kit 250. The linearized DNA was quantified and stored at 4°C.

[0200] Ligation of sgRNAs with the pX459-v2.0 vector

[0201] The protocol described by NEB (Quick ligation protocol - M2200) was followed.

[0202] 1x ligation reaction:

[0203] The ligation products (sgRNA + px459-v2.0 vector) that gave rise to the new plasmids were identified:

[0204] px459v2.0-sgRNA1-SB1 / UL45-46 was selected for the following cloning steps.

[0205] Transformation in DH5a competent E. coli bacteria with the ligation product to obtain the recombinant plasmid px459v2.0-sqRNA1-SB1 / UL45-46.

[0206] The ligation product (sgRNA + px459-v2.0 vector) was added to competent E. coli DH5a cells, followed by a 4-hour heat shock o at 42°C.

[0207] The transformed bacteria were grown in LB broth supplemented with the antibiotic ampicillin (100pg / ml), and were transferred by plating to LB agar plates supplemented with ampicillin (100pg / ml) for subsequent selection of clones (recombinant plasmids).

[0208] Extraction and purification of the recombinant plasmid px459v2.0-sqRNA1-SB1 / UL45-46

[0209] Recombinant plasmids were selected and grown in LB broths supplemented with ampicillin (100 pg / ml). The bacterial pellet was concentrated, and the plasmid was extracted using the QIAprep® Spin Miniprep Kit (250), according to the manufacturer's instructions, using the QIAcube instrument. The correct insertion of the sgRNA into the pX459-v2.0 plasmid was verified by analyzing the digestion product with the Bbsl-HF digestion enzyme in a 1% agarose gel electrophoresis run. Finally, the UL45-46 specific sgRNA of SB1 was named px459v2.0-sgRNA1-SB1 / UL45-46.

[0210] Design and construction of the donor plasmid

[0211] To construct the donor plasmid, two consecutive cloning processes were performed: the open reading frame (ORF) of the D and I genes of ILTV (GenBank accession number: MG:MG775218.1) Gallid alphaherpesvirus 1 strain VFAR-043, complete genome - Nucleotide - NCBI (nih.gov) (SEQ ID NO. 20), which is flanked at both ends by the Sfil restriction site (upstream and downstream). This sequence was synthesized and subsequently cloned into the pUC57 plasmid by GenScript; the resulting plasmid was named pUC57-ILTV (gD-l).

[0212] The pGEM-sgA-GFP plasmid, previously constructed. This plasmid was digested and linearized by the Sfil enzyme. The pGEM-sgA-GFP plasmid (this plasmid contains: sgA + murine cytomegalovirus promoter + Sfi cleavage sites + an SV40 Poly A signal sequence + a GFP expression cassette for the expression of the fluorescence reporter gene, the latter flanked by LoxP + sgA sequences).

[0213] The pUC57-ILTV (gD-l) plasmid was digested by the Sfil enzyme to release the gD-l cassette, then this cassette was cloned into the pGEM-sgA-GFP (linearized) plasmid, the resulting plasmid was named pGEM-sgA-GFP-mCMV-ILTV (gD-l)-Poly A (9144bp).

[0214] The correct insertion and orientation of the ILTV expression cassette (gD-l) was verified by PCR using specific primers and by sequencing (data not shown).

[0215] Table 7. List of primers and sgRNAs used in this invention study

[0216] Generation of recombinant rSB1-GFP-ILTV (qD-l) 0.5x10 were seeded 6 CEF cells were cultured per well in a 6-well plate supplemented with maintenance medium (1x DMEM + 5% FBS) at 37 °C under 5% atmospheric CO2. After 24 hours, the supernatant was removed and the monolayer was washed three times consecutively with DPBSIx to remove cell debris. The cells were infected with SB1wt at an MOI of 0.001 for 8 hours at 37 °C and 5% CO2 in 1x DMEM + 5% FBS.

[0217] The next day, 1 pg of the pGEM-sgA-GFP-mCMV-ILTV (gD-l)-Poli A plasmid containing the mCMV-ILTV (gD-l)-Poli A cassette, 0.5 pg of sgRNA-sgA, and 0.5 pg sgRNA SB1 UL45-46, were co-transfected for 24 hours using Lipofectamine® Reagent (Thermo Fisher Scientific) following the manufacturer's instructions.

[0218] At 24 hours post-transfection, the supernatant containing the DNA:Lipofectamine complex was removed and replaced with a fresh maintenance medium, to avoid any toxicity in the cell monolayer.

[0219] Three days post-transfection, the infected / transfected cells were transferred and distributed into 2 six-well plates of pre-seeded CEF cell culture.

[0220] Four days post-transfection / infection, lysis plates with GFP fluorescence were visible, corresponding to the recombinant virus. Selected clones were then purified in three rounds of plate purification. For this purpose, single cells expressing the ILTV (gD-l)-GFP expression cassette were selected and distributed into 96-well cell culture plates using FACS in a BD FACSMelody™ Cell Sorter (BD Biosciences). The new recombinant virus was named rSB1-GFP-ILTV (gD-l) (SEQ ID NO. 21). The presence and expression of the ILTV (gD-l) cassette were subsequently verified by conventional PCR, IFA, and Western blot.

[0221] Selection of recombinant clones rSB1 -GFP-ILTV (qD-l)

[0222] Recombinant clones of rSB1-GFP-ILTV (gD-l) were evaluated by conventional PCR to confirm the correct insertion of the ILTV (gD-l) / GFP cassette into the SB1 genome post-transfection and purification. Seven clones were selected and infected in previously seeded CEF cells, then trypsinized upon reaching a 70% infection rate. Viral DNA was extracted and analyzed by conventional PCR using the following specific primers: MDV2-UL45-UL46 F2 / MDV2-UL45-UL46 R2 (Data not shown).

[0223] Removal of the GFP reporter cassette by the Cre-Lox system

[0224] The GFP expression cassette (flanked by LoxP sequences) of rSB1-GFP-ILTV (gD-l) was removed using the Cre-Lox system. A CEF cell monolayer was prepared in a 6-well cell culture plate, and the monolayer was then infected with the rSB1-GFP-ILTV (gD-l) virus at an MCI of 0.01 for 24 hours. Subsequently, the infected monolayer was co-transfected with 2 pg of Cre-recombinase using Lipofectamine® Reagent (Thermo Fisher Scientific) according to the manufacturer's instructions.

[0225] Twelve hours post-transfection, the culture medium was changed to avoid any cytotoxic effects. Complete removal of the GFP reporter gene expression cassette was confirmed by the appearance of new non-fluorescent lysis plaques. Finally, the new recombinant virus obtained was named rSB1-ILTV(gD-l) (SEQ ID NO. 22).

[0226] Selection of recombinant rSB1-ILTV (qD-l) clones post-removal of the GFP reporter cassette

[0227] The complete removal of the GFP reporter cassette in the rSB1-GFP-ILTV (gD-l) clones was verified by conventional PCR using specific primers: MDV2-UL45-UL46 F2 / MDV2-UL45-UL46 R2. Likewise, these same primers allowed the evaluation of the integrity of the ILTV (gD-l) expression cassette in SB1.

[0228] Indirect immunofluorescence assay (IFI)

[0229] CEF cells were grown in a 6-well cell culture plate and infected with a 0.001 MCI containing SBIwt and rSB1-ILTV (gD-l) in passages 10, 15, 20, and 25. After 48 hours post-infection (hp1), the cells were washed three times with DPBS 1 xy and then fixed with 4% paraformaldehyde for 30 min at room temperature. The cells were incubated with the primary antibody in a 5% bovine serum albumin (BSA) solution in DPBS for 1 hour at room temperature. A primary antibody: anti-serum Infectious laryngotracheitis (Catalog No. N0118) (Avian Vaccine Services, LLC dba AVS Bio, Norwich, USA) for the detection of gD-l glycoprotein expression. After three washes with DPBS 1x, the cells were incubated with a secondary antibody goat anti-chicken IgY H&L Alexa Fluor® 488 at a dilution of 1:1000 (Catalog No.(from catalog ab150169, Abeam, Cambridge, MA, USA) (green fluorescence), respectively in DPBS 1x with 5% BSA for 1 hour at room temperature. The results were observed using an ObserverAI fluorescence microscope (Carl Zeiss, Germany). Digital images were taken at 200x magnification and processed with the AxioCam MRc5 camera (Carl Zeiss, Germany).

[0230] Western blot for detection of ILTV Dl glycoproteins (gD-l)

[0231] To evaluate the expression of ILTV gD-1 glycoproteins, CEF cells were infected with the recombinant virus at an MCI of 0.01. At 72 hpi, the CEF cells were lysed and analyzed by Western blot. The Western blot analysis was performed using a primary antibody: anti-serum Infectious laryngotracheitis (Catalog No. N0118, Avian Vaccine Services, LLC dba AVS Bio, Norwich, USA) diluted 20 / 5000 in 1% milk in 0.1% PBS-T for 15 hours at room temperature with constant agitation. Subsequently, three washes were performed with 0.1% PBS-T (each wash lasting 10 minutes with constant agitation). At the end of the washes, the membrane was incubated with the secondary antibody Goat Anti-Chicken IgY (H&L) [HRP] (Catalog No. A00165, GenScript, Piscataway, NJ, USA) diluted 1 / 5000 in 1% milk in 0.1% PBS-T for 2 hours at room temperature with constant stirring.

[0232] Protein expression visualizations were detected using a photodocumentation system and an AZURE CCD camera (Azure Biosystems, Inc., Dublin, USA).

[0233] In vitro genetic stability of rSB1-ILTV (gD-l). Genetic stability was evaluated in CEFs up to passage 20. Viral DNA was extracted from infected CEF cells. Every 5 passages, the presence of the ILTV (gD-l) cassette and insert was verified and confirmed by conventional PCR using specific primers MDV2-UL45-UL46 F2 / MDV2-UL45-UL46 R2. The expression of the gD-l glycoproteins was evaluated every 5 passages by Western blot assay, as previously described in the Western blot section.

[0234] Experimental design No. 1: Immunization of broiler chickens with the rSB1-ILTV vaccine (gD-l)

[0235] For the immunization experiment, three recombinant virus clones obtained rSB1-ILTV (gD-l) clones were evaluated: 15.1, 16.3, 15.7, as a control a commercial rHVT-ILTV vaccine, isolated rHVT-ILTV, and a non-immunized control group were used.

[0236] Seventy-two 1-day-old broiler chickens were randomly divided into six groups: Group No. 1 = rSB1-ILTV (gD-l) clone 15.1 (n=12), Group No. 2 = rSB1-ILTV (gD-l) clone 16.3 ( =12), Group No. 3 = rSB1-ILTV (gD-l) clone 15.7 ( =12) , Group No. 4 = HVT-ILTV (commercial) (n=12) , Group No. 5 = rHVT-ILTV isolated (n=12) and Group No. 6 = non-immunized control (n=12). Chickens were immunized with a dose of 3000 PFU / bird. At 20, 34, and 41 days post-immunization, serum samples were collected to evaluate the humoral immune response by detecting specific antibodies against ILTV glycoprotein I (gl), using IDScreen ILT I Indirect (ID.Vet Cat. No ILTGIS).

[0237] To evaluate the efficacy against ILTV challenge, immunized and non-immunized birds were partially transferred to the BSL-3 facility of FARVET SAC. The birds were challenged 42 days post-immunization via ocular (50 pl in each eye) and intratracheal (50 pl) routes, and clinical signs were monitored for 10 days, recorded, and reported daily. Clinical sign scores were designated as follows: 0: no clinical signs; 1: mild conjunctivitis, respiratory distress, or hoarseness; 2: moderate conjunctivitis, respiratory distress, or hoarseness; 3: severe conjunctivitis, respiratory distress, or hoarseness. To determine viral shedding, oral and cloacal swab samples were collected (3, 5, and 7 dpd) from immunized and non-immunized birds, respectively.Following collection, the swabs were immediately immersed in 1 ml of 1x PBS supplemented with an antibiotic-antifungal (final concentration of 10x) and incubated for 30 min at 4°C. Each swab was then removed, and the supernatant was clarified to remove cellular debris and / or food / fecal remnants by centrifugation at 3000 rpm for 15 min at 4°C. The samples were quantified using quantitative real-time PCR.

[0238] Statistical analysis

[0239] All statistical analysis was performed using GraphPad Prism version 8.01 (GraphPad Software, San Diego, CA). Two-way ANOVA was used to compare data between different groups. Differences were considered significant with a p-value <0.0001. ELISA titers were analyzed using Tukey's multiple comparisons test at the 95% confidence level.

[0240] Results:

[0241] Construction and recovery of the recombinant virus

[0242] The sgRNAs (sgRNA-sgA and sgRNA-UL45-46) were designed, synthesized, and cloned into the px459v.2O plasmid, which contains the Cas9 gene of S. pyogenes. The resulting plasmids were named px459v2.0-sgRNA-sgA and px459v2.0-sgRNA-UL45-46.

[0243] The donor plasmid pGEM-sgA-GFP-mCMV-ILTV (gD-l)-Poly A contains the GFP reporter expression cassette, which is flanked by two LoxP sequences for its separation from the ILTV (gD-l) expression cassette. Both cassettes are flanked by sg-A sites to introduce a desired cleavage, allowing cassette release and integration into the UL45-46 intergenic region of the SB1wt genome. The Cas9 endonuclease promotes the insertion of the GFP and ILTV cassettes into the UL45-46 intergenic region of the SB1wt genome (see Figure 7).

[0244] For the generation of the rSB1-GFP-ILTV (gD-l) virus, CEF cells were co-transfected with the plasmids pGEM-sgA-GFP-mMCV-ILTV (gD-l) Poly A, px459v2.0-sgRNA-sgA, and px459v2.0-sgRNA-UL45-46. At 24 hours post-transfection, the cells were infected with the SB1wt virus with an MOI of 0.01. GFP-expressing plaques were visible 4 days post-transfection / infection, demonstrating successful cassette insertion. The recombinant virus was isolated in three rounds of purification by isolation from lysis plaques and by Cell Sorter.

[0245] Subsequently, the GFP reporter cassette was removed using Cre-recombinase (pcDNA3.1-Cre) treatment via the Cre-LoxP system. Cells infected with the rSB1T-GFP-ILTV (gD-l) virus were transfected with Cre-recombinase, and plaque lysis without fluorescence was observed 4 days post-transfection / infection. Complete removal was confirmed by conventional PCR using specific primers MDV2-UL45-UL46 F2 and MDV2-UL45-UL46 R2 (Figure 9B). Finally, the new recombinant SB1 was named rSB1-ILTV (gD-l).

[0246] Selection of clones post-removal GFP reporter cassette

[0247] C8, C15, and C16 clones of the rSB1-GFP-ILTV (gD-l) virus had the expected size of 6855 bp (Figure 8) before GFP reporter cassette removal, and were therefore selected for GFP reporter cassette removal.

[0248] After removal of the GFP reporter cassette, seven recombinant rSB1-ILTV (gD-l) clones were selected, from which complete removal of the GFP reporter cassette was verified by conventional PCR using specific primers: MDV2-UL45-UL46 F2 / MDV2-UL45-UL46 R2. Demonstrating complete removal of the reporter cassette and integrity of the ILTV (gD-l) cassette in the UL45-46 intergenic region of the Gallid alphaherpesvirus 3 (SB1) genome.

[0249] Stability of the D and I genes in the recombinant rSB1-ILTV virus genome (qD-l)

[0250] CEFs cells were infected with the rSB1-ILTV (gD-l) virus to determine the virus's genetic stability using indirect immunofluorescence (IFA), polymerase chain reaction (PCR), and Western blotting. Viral DNA was analyzed every 5 passages (passages 5 oat the 20°) by conventional PCR where we detected the presence of the cassette inserted into the recombinant virus genome with a band of ~4389 bp (Figure 9B). Similarly, every 5 passages (passage 5 oAt passage 25°, we confirmed the expression of glycoproteins D and I by Western blotting (Figure 9A), where we detected two bands: a band of ~48.5 kDa corresponding to glycoprotein D (gD) and a band of ~39.5 kDa corresponding to glycoprotein I (gl). Beta-actin α(cβt-in) ~42 kDa was detected as a run control, and CEF cells infected with SB1wt were used as a negative control, in which no expression of the proteins of interest was detected. IFA demonstrated the expression of both gD-l glycoproteins in cells infected with the recombinant virus at passages 10° to 25° in CEFs (Figure 9C). These results demonstrated that the presence and expression of the ILTV gD-l glycoprotein gene did not affect the replication of the recombinant virus, confirming the stability of glycoproteins D and I in the viral genome of the recombinant virus.

[0251] Humoral immune response

[0252] Immunogenicity was evaluated through the humoral immune response provoked by the vaccines. Chicken sera were collected and evaluated through a specific indirect ELISA for the detection of glycoprotein I (gl) IDScreen ILT gl Indirect (ID. Vet, Cat. No. ILTGIS) on the first day of pre-immune age, 21, 34, 42, and 49 days post-immunization.

[0253] Relatively high titers were detected on the first day of age, which correspond to maternal antibodies (Data not shown).

[0254] At 21 days post-infection (dpv), one bird from group 1 (clone 15.1) showed a high antibody titer, although this was not statistically significant. Conversely, at 34 dpv, ELISA results showed statistically significant higher titers in group 1 (clone 15.1) and group 2 (clone 16.3) compared to the unvaccinated group. At 42 dpv, titers were statistically significantly higher in the vaccinated groups 1 and 2 compared to the unvaccinated group, as determined by two-way ANOVA (Figure 10A). Results were interpreted as positive at titers > 611.

[0255] Efficacy against ILTV challenge The efficacy of the rSB1-ILTV vaccine (gD-l) was evaluated taking into account the score of clinical signs, and viral dissemination.

[0256] The groups of birds in the experiment were challenged with a strain of infectious laryngotracheitis virus 42 days post-vaccination via ocular (50 pL in each eye) and intratracheal (50 pL) routes, and clinical signs were monitored for 10 days. Subsequently, the average clinical sign scores were higher in the non-immunized bird groups and the group of birds immunized with the commercially available rHVT-ILTV vaccine, indicating the severity of symptoms in these groups. Furthermore, it is worth noting that one bird died with severe symptoms of the disease in the non-immunized group. On the other hand, the groups of birds immunized with the vaccines rSB1-ILTV (gD-l) clone 15.1, rSB1-ILTV (gD-l) clone 16.3, rSB1-ILTV (gD-l) clone 15.7, and isolated rHVT-ILTV showed a lower score of clinical signs with a significant difference (Figure 10B).

[0257] The groups of birds in Experiment 1 were challenged with a strain of infectious laryngotracheitis virus 42 days post-vaccination via the ocular route (50 pL in each eye) and intratracheal route (50 pL). To assess viral shedding of the challenge virus, tracheal swabs were collected on days 3, 5, and 7 post-challenge and analyzed using quantitative real-time PCR. The average copies / pL were higher in the non-immunized bird groups and the group immunized with the commercially available rHVT-ILTV vaccine, suggesting greater viral shedding in these groups. On the other hand, the groups of birds immunized with the vaccines rSB1-ILTV (gD-l) clone 15.1, rSB1-ILTV (gD-l) clone 16.3, rSB1-ILTV (gD-l) clone 15.7 and rHVT-ILTV (gD-l) isolated showed a lower average of copies / pl (Figure 10C).

[0258] List of Sequences:

[0259] SEQ ID NO.16 Nucleotide sequence of the primer or forward primer SB1_UL45-F in the 5' to 3' direction

[0260] Length: 20 bp.

[0261] SEQ ID NO.17 Nucleotide sequence of the primer or reverse primer SB1_ILTV_UL45-R in the 5' to 3' direction

[0262] Length: 20 bp. SEQ ID NO.18 Nucleotide sequence of the primer or forward primer SB1_EGFP_UL46- F in the 5' to 3' direction

[0263] Length: 20 bp.

[0264] SEQ ID NO.19 Nucleotide sequence of the primer or reverse primer SB1_ILTV_UL46-R in the 5' to 3' direction

[0265] Length: 20 bp.

[0266] SEQ ID NO.20 Nucleotide sequence of glycoproteins D and I of ILTV strain VFAR-043, with accession number by GenBank: MG775218.1 Length: 3570 bp.

[0267] SEQ ID NO.21 Nucleotide sequence of the rSB1-GFP-ILTV (gD-l) virus of the VFAR-043 strain

[0268] Length: 172,133 bp.

[0269] SEQ ID NO.22 Nucleotide sequence of the rSB1-ILTV (gD-l) virus of strain VFAR-043 Length: 169,667 bp.

[0270] Example 3:

[0271] Construction, immunogenicity and protective efficacy of Gallid alphaherpesvirus 3 (GaHV-3) that efficiently expresses the VP2 glycoprotein of Gumboro disease (IBDV) in broiler chickens.

[0272] III. Methodology

[0273] Animals

[0274] One-day-old broiler chickens (Experiment No. 1) were used to evaluate the immunogenicity and efficacy of the rSB1-VP2 vaccine against the IBDV (Infectious Bovine Dengue Disease Virus).

[0275] Cells and Viruses: For the generation and maintenance of the recombinant rSB1-VP2 virus, CEF cells extracted from 9-10 day-old embryonated SPF eggs (Charles River Avian Vaccine Services, Norwich, USA) were used. The CEF cells were maintained in DMEM / F12 (Thermo Fisher Scientific) supplemented with 5% inactivated FBS (Thermo Fisher Scientific) and 1x antibiotic-antifungal (Thermo Fisher Scientific), at 37 °C, under a 5% CO2 atmosphere.

[0276] The GaHV3 or MDV-2 strain SB1 virus (GenBank Accession No.: HQ840738.1) (SEQ ID NO.1) was used for the generation of the recombinant virus rSB1-VP2, in CEFs cells by CRISPR / Cas9 technology and by the NHEJ repair pathway.

[0277] The IBDV challenge strain used to evaluate the efficacy of the rSB1-VP2 vaccine was the F52 / 70 strain via ocular administration with a titer of 10 4 DIE5o (30pl / dose).

[0278] Design and construction

[0279] The recombinant virus rSB1-VP2 was obtained by CRISPR / Cas9-NHEJ technology using the plasmids and sgRNAs: pGEM-sgA-GFP-VP2, px459v2.0-sgRNA-sgA, px459v2.0-sgRNA1-SB1 / US2, and px459v2.0-sgRNA2-SB1 / US2.

[0280] Design and construction of sgRNAs and the donor plasmid

[0281] Selection and design of sgRNAs

[0282] The target sequence in this invention was the US2 gene region of the Gallid alphaherpesvirus 3 (MDV-2) genome, which was submitted for gRNA design (http: / / crispr.mit.edu / ), and three sequences with the highest scores were selected. These sequences are shown in Table 1.

[0283] The px459v2.0 plasmid (catalog no. 62988; Addgene, USA) was digested with Bbsl-HF (Neb New England BioLabs, Inc.) and then purified using the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer's instructions. The sgRNAs, presented as corresponding DNA primers for the target sequence, were synthesized and cloned into the previously digested px459v2.0 cloning vector to construct the px459v2.0-sgRNA. The sg-A sequence was taken from a previous publication and cloned into the px459v2.0 plasmid in the same manner. Correct insertion of the sgRNAs was confirmed by digestion with the Bbsl-HF enzyme (Data not shown).

[0284] Sequence of the US2 gene region in the Gallid alphaherpesvirus 3 (strain SB1) genome (SEQ ID NO.33) sqRNA cloning procedure

[0285] sqRNA hybridization

[0286] *The sgRNA was resuspended in nuclease-free water and diluted 1 / 10 to have a final working concentration of 10 pM.

[0287] 1x hybridization reaction:

[0288] 'Buffer solution of hybridization:

[0289] 10mM Tris, pH 7.5-8; 50mM NaCl, 1mM EDTA.

[0290] The samples were placed in the thermocycler under the following conditions:

[0291] 90°C for 3 min and 37°C for 1 hour.

[0292] The samples were quantified by spectrophotometry using an Eppendorf BioPhotometer plus, obtaining an average value of 200 ng / pl. A 1 / 10 dilution was performed to obtain a working stock of 20 ng / pl.

[0293] Digestion or Linearization of the pX459-v2.0 plasmid vector (catalog No. 62988; Addgene, USA)

[0294] 1X digestion reaction:

[0295] The samples were placed in a thermocycler at 37°C for 6 hours. An electrophoresis assay was performed to purify the band of interest, which contains the linear DNA. The gel was cut and the DNA was extracted using the QIAquick® Gel Extraction Kit 250. The linearized DNA was quantified and stored at 4°C.

[0296] Ligation of sgRNAs with the pX459-v2.0 vector

[0297] The protocol described by NEB (Quick ligation protocol - M2200) was followed.

[0298] 1x ligation reaction:

[0299] The ligation products (sgRNA + px459-v2.0 vector) that gave rise to the new plasmids were identified:

[0300] The two px459v2.0-sgRNA1-SB1 / US2 and px459v2.0-sgRNA2-SB1 / US2 were selected for the next cloning steps.

[0301] The ligation product (sgRNA + px459-v2.0 vector) was added to competent E. coli DH5a cells, followed by a 4-hour heat shock o at 42°C.

[0302] The transformed bacteria were grown in LB broth supplemented with the antibiotic ampicillin (100 pg / ml) and transferred by plating to LB agar plates supplemented with ampicillin (100 pg / ml) for subsequent clone selection (recombinant plasmids). Extraction and purification of the recombinant plasmids px459v2.0-sqRNA1-SB1 / US2 and px459v2.0-sqRNA2-SB1 / US2

[0303] Recombinant plasmids were selected and grown in LB broths supplemented with ampicillin (100 pg / ml). The bacterial pellet was concentrated, and the plasmid was extracted using the QIAprep® Spin Miniprep Kit (250), according to the manufacturer's instructions, using the QIAcube instrument. The correct insertion of the sgRNAs into the pX459-v2.0 plasmid was verified by analyzing the digestion product with the Bbsl-HF digestion enzyme in a 1% agarose gel electrophoresis run. Finally, the SB1 US2-specific sgRNAs were named px459v2.0-sgRNA1-SB1 / US2 and px459v2.0-sgRNA2-SB1 / US2.

[0304] Design and construction of the donor plasmid

[0305] To construct the donor plasmid, two consecutive cloning processes were performed: the open reading frame (ORF) of the IBDV VP2 gene (GenBank accession number: HG974565.1) (SEQ ID NO. 34), which is flanked at both ends by the Sfil restriction site (upstream and downstream). This sequence was synthesized and subsequently cloned into the pUC57 plasmid using GenScript; the resulting plasmid was named pUC57-VP2.

[0306] The pGEM-sgA-GFP plasmid, previously constructed. This plasmid was digested and linearized by the Sfil enzyme. The pGEM-sgA-GFP plasmid (this plasmid contains: sgA + murine cytomegalovirus promoter + Sfi cleavage sites + an SV40 Poly A signal sequence + a GFP expression cassette for the expression of the fluorescence reporter gene, the latter flanked by LoxP + sgA sequences).

[0307] The pUC57-VP2 plasmid was digested by the Sfil enzyme to release the VP2 cassette, then this cassette was cloned into the pGEM-sgA-GFP plasmid (linearized), the resulting plasmid was named pGEM-sgA-GFP-mCMV-VP2-Pol¡ A (8586bp).

[0308] The correct insertion and orientation of the IBDV expression cassette (VP2) was verified by PCR using specific primers and by sequencing (data not shown). Table 8. List of primers and sgRNAs used in this invention study Generation of recombinant rSB1-GFP-VP2

[0309] 0.5x10 were sown 6 CEF cells were cultured per well in a 6-well plate in maintenance medium (1x DMEM + 5% FBS) at 37 °C under 5% CO2 atmosphere. After 24 hours, the supernatant was removed and the monolayer was washed three times consecutively with DPBSIx to remove cell debris. The cells were then infected with

[0310] SB1wt with an MOI of 0.01 for 8 hours at 37 °C and 5% CO2 in DMEM 1x + 5% SFB medium

[0311] The following day, 1 pg of the pGEM-sgA-GFP-mCMV-VP2-Poly A plasmid containing the mCMV-VP2-Poly A cassette, 0.5 pg of sgRNA-sgA, and 0.5 pg of sgRNA SB1 US2 were co-transfected for 24 hours using Lipofectamine® Reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. At 24 hours post-transfection, the supernatant containing the DNA:Lipofectamine complex was removed and replaced with a fresh maintenance medium to prevent any toxicity to the cell monolayer.

[0312] Three days post-transfection, the infected / transfected cells were transferred and distributed into 4 six-well plates of pre-seeded CEF cell culture.

[0313] Four days post-transfection / infection, lysis plates with GFP fluorescence were visible, corresponding to the recombinant virus. Selected clones were then purified in three rounds of plate purification (sub-clones). For this purpose, single cells expressing the VP2-GFP expression cassette were selected and distributed onto 96-well cell culture plates using FACS in a BD FACSMelody™ Cell Sorter (BD Biosciences). The new recombinant virus was named rSB1-GFP-VP2 (SEQ ID NO. 35). Subsequently, the presence and expression of the VP2 cassette (IBDV) were verified by conventional PCR and IFA.

[0314] Selection of recombinant rSB1-GFP-VP2 clones

[0315] Recombinant rSB1-GFP-VP2 clones were evaluated by conventional PCR to confirm the correct insertion of the VP2 / GFP cassette into the SB1 genome post-transfection and purification. Five clones were selected and infected into previously seeded CEF cells, which were then trypsinized once an infection rate of 70% was reached. Viral DNA was extracted and analyzed by conventional PCR using the following specific primers (see Table 3).

[0316] Removal of the GFP reporter cassette by the Cre-Lox system

[0317] The GFP expression cassette (flanked by LoxP sequences) of rSB1-GFP-VP2 was removed using the Cre-Lox system. A monolayer of CEF cells was prepared in a 6-well cell culture plate, and the monolayer was then infected with the rSB1-GFP-VP2 virus at a Cre-Lox concentration of 0.01 for 24 hours. The infected monolayer was then co-transfected with 2 pg of Cre-recombinase using Lipofectamine® Reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. Twelve hours post-transfection, the culture medium was changed to avoid any cytotoxic effects. Verification of complete removal of the GFP reporter gene expression cassette was confirmed by the appearance of new non-fluorescent lysis plaques. Finally, the new recombinant virus obtained was named rSB1-VP2 (SEQ ID NO. 36).

[0318] Selection of recombinant rSB1-VP2 clones post-removal of the GFP reporter cassette

[0319] The verification of the complete removal of the GFP reporter cassette in the rSB1-GFP-VP2 clones was verified by conventional PCR using specific primers (see Table 3). Likewise, these same primers allowed the evaluation of the integrity of the IBDV VP2 expression cassette in SB1.

[0320] Indirect immunofluorescence assay (IFI)

[0321] CEF cells were grown in 6-well cell culture plates and infected with a 0.001 MOI using SBIwt and rSB1-VP2. After 48 hours post-infection (hpi), the cells were washed three times with DPBS 1* and then fixed with 4% paraformaldehyde for 30 min at room temperature. The cells were incubated with the primary antibody in a 5% bovine serum albumin (BSA) solution in DPBS for 1 hour at room temperature. The primary antibody was anti-serum for Infectious Bursal Disease Virus (Catalog No. #G0114) (Avian Vaccine Services, LLC dba AVS Bio, Norwich, USA) for the detection of VP2 expression. After three washes with DPBS 1x, the cells were incubated with a goat anti-chicken IgY H&L Alexa Fluor® 594 secondary antibody at a dilution of 1:200 (No.(from catalog ab150172, Abeam, Cambridge, MA, USA) (red fluorescence), respectively in DPBS 1* with 5% BSA for 1 hour at room temperature. The results were observed using an ObserverAI fluorescence microscope (Carl Zeiss, Germany). Digital images were taken at 200x magnification and processed with the AxioCam MRc5 camera (Carl Zeiss, Germany).

[0322] Western blotting for VP2 protein detection in rSB1-VP2 cells. To evaluate VP2 protein expression, CEF cells were infected with recombinant virus at an MOI of 0.01. At 72 hpi, the CEF cells were lysed and analyzed by Western blotting. The Western blot analysis was performed using an anti-IBDV, VP2 Mouse primary antibody (catalog no. MBS312798, MyBioSource) diluted 2 / 5000 in 1% milk in 0.1% PBS-T for 15 hours at room temperature with constant agitation. Subsequently, three washes were performed with 0.1% PBS-T (each wash for 10 minutes with constant agitation). At the end of the washes, the membrane was incubated with the secondary antibody Anti-Mouse IgG [HRP] (Catalog No. A00160, GenScript, Piscataway, NJ, USA) diluted 2 / 5000 in 1% milk in 0.1% PBS-T for 2 hours at room temperature with constant stirring.

[0323] Protein expression visualizations were detected using a photodocumentation system and an AZURE CCD camera (Azure Biosystems, Inc., Dublin, USA).

[0324] Experimental design No. 1: Immunization of broiler chickens with the rSB1-VP2 vaccine

[0325] For the immunization experiment, three sub-clones of recombinant virus obtained rSB1-VP2 clones were evaluated: 3.2, 3.7 and 18.7, as a control a non-immunized control group was used.

[0326] Chickens were immunized with a dose of 3000 PFU / bird. At 20, 34, and 42 days post-immunization, serum samples were collected to evaluate the humoral immune response by detecting antibodies against the IBDV VP2 protein, using an indirect ELISA IDScreen® IBD VP2 Indirect (ID. Vet Cat. No IBDVP2).

[0327] Evaluation schedule in the study:

[0328] At 35 days of age, all birds were challenged with the F52 / 70 strain via ocular injection with a titer of 10 4 DIE 50 (30pl / dose).

[0329] Following the challenge, the birds were clinically examined for 10 days, and mortality, depression, diarrhea, and any other clinical signs were recorded. Necropsies were performed on dead birds to determine and confirm the cause of death.

[0330] Evaluation of macroscopic and microscopic lesions

[0331] For the evaluation of macroscopic and microscopic lesions, 3 birds per group were sacrificed at 45, 48, and 52 days of age; in all cases, the macroscopic and microscopic lesions found were recorded and photographed. Bursal index:

[0332] The bursal index was determined, that is, the weight of the Bursa of Fabricius with respect to body weight, which is used to determine the presence or absence of atrophy of the Bursa of Fabricius.

[0333] The formula is: The resulting stock market index was classified as follows:

[0334] 1.5 - 3.5 = Normal Bursa

[0335] 0.5 - 1.5 = Bursal Atrophy

[0336] < 0.5 = Severe Bursal Atrophy

[0337] Statistical analysis

[0338] Results:

[0339] Construction and recovery of the recombinant virus

[0340] The sgRNAs (sgRNA-sgA and sgRNA-US2) were designed, synthesized, and cloned into the px459v.2O plasmid, which contains the Cas9 gene of S. pyogenes. The resulting plasmids were named px459v2.0-sgRNA-sgA and px459v2.0-sgRNA-US2.

[0341] The donor plasmid pGEM-sgA-GFP-mMCV-VP2-Pol1 A contains the GFP reporter expression cassette, which is flanked by two LoxP sequences for its separation from the VP2 expression cassette. Both cassettes are flanked by sg-A sites to introduce a desired cleavage, allowing cassette release and integration into the US2 intergenic region of the SB1wt genome. The Cas9 endonuclease promotes the insertion of the GFP cassette and VP2 gene into the SB1wt genome gene region (see Figure 11).

[0342] For the generation of the rSB1-GFP-VP2 virus, CEF cells were co-transfected with the plasmids pGEM-sgA-GFP-mMCV-VP2-Pol1 A, px459v2.0-sgRNA-sgA, px459v2.0-sgRNA1-US2, and px459v2.0-sgRNA2-US2. At 24 hours post-transfection, the cells were infected with the SB1wt virus at an MOI of 0.01. GFP-expressing plaques were visible 4 days post-transfection / infection, demonstrating successful cassette insertion. The recombinant virus was isolated in three rounds of purification by isolation from lysis plaques and by Cell Sorter.

[0343] Subsequently, the GFP reporter cassette was removed using Cre-recombinase (pcDNA3.1-Cre) treatment via the Cre-LoxP system. Cells infected with the rSB1-GFP-VP2 virus were transfected with Cre-recombinase, and plaque lysis without fluorescence was observed 4 days post-transfection / infection. Complete removal was confirmed by applying various conventional PCRs with specific primers that amplified the entire region and attachment ends of the insert to the viral genome (Figures 12, 13, and 14). Finally, the new recombinant SB1 was named rSB1-VP2.

[0344] Selection of clones post-removal GFP reporter cassette

[0345] Prior to reporter cassette removal, clones C3, C8, C11, C16, and C18 of the rSB1-GFP-VP2 virus were selected for removal because they exhibited a DNA band size of 6855 bp by conventional PCR, which indicated the presence of both the GFP reporter cassette and the VP2 cassette.

[0346] After removal of the GFP reporter cassette, five recombinant rSB1-VP2 clones were selected, from which the complete removal of the GFP reporter cassette was verified, using a conventional PCR, see table 3, demonstrating the complete removal of the reporter cassette and integrity of the VP2 cassette in the US2 gene region of the Gallid alphaherpesvirus 3 (SB1) genome.

[0347] Detection of VP2 expression in the rSB1-VP2

[0348] VP2 protein expression was confirmed by Western blotting with a 45 kDa band. CEF cells infected with SB1wt and uninfected cells were used as a negative control for the experiment, and no band was detected in these cells (Figure 16). IFA demonstrated VP2 protein expression in CEF cells infected with the recombinant virus (Figure 15). These results showed that the presence and expression of the IBDV VP2 gene did not affect recombinant virus replication.

[0349] Humoral immune response and protection

[0350] Starting in the third week post-immunization, antibody levels in immunized birds were measured and detected. After challenge with IBDV, all groups of birds, except for the non-immunized control group, showed 100% protection against IBDV. Therefore, these studies demonstrate that this novel recombinant Gallid alphaherpesvirus 3 vaccine vector induces similar antibody levels to other conventional commercial vaccines. The average clinical score and percentage of bird survival during the IBDV challenge evaluation indicated the efficacy of the recombinant vaccine in immunized birds. The results show that GaHV-3 can be used as a vaccine vector against IBDV disease expressing the VP2 protein in day-old chicks, resulting in 100% protection against challenge with a lethal dose of IBDV.

[0351] Percentage of post-challenge mortality in both groups List of Sequences:

[0352] SEQ ID NO.23 Nucleotide sequence of the primer or forward primer MDV2-US2-5F in the 5' to 3' direction

[0353] Length: 21 base pairs. SEQ ID NO.24 Nucleotide sequence of the primer or reverse primer MDV2-US2-5R in the 5' to 3' direction

[0354] Length: 20 base pairs.

[0355] SEQ ID NO.25 Nucleotide sequence of the primer or forward primer MDV2-US2-6F in the 5' to 3' direction

[0356] Length: 20 base pairs.

[0357] SEQ ID NO.26 Nucleotide sequence of the primer or reverse primer MDV2-VP2-6R in the 5' to 3' direction

[0358] Length: 20 base pairs.

[0359] SEQ ID NO. 27 Nucleotide sequence of the primer or reverse primer MDV2-EGFP-US2-7F in the 5' to 3' direction

[0360] Length: 20 base pairs.

[0361] SEQ ID NO. 28 Nucleotide sequence of the primer or reverse primer MDV2-US3-7R in the 5' to 3' direction

[0362] Length: 20 base pairs.

[0363] SEQ ID NO.29 Nucleotide sequence of the upper strand oligo gRNA1_US2 / SB1_T Length: 24 bp.

[0364] SEQ ID NO.30 Nucleotide sequence of the lower strand oligo gRNA1_US2 / SB1_B Length: 24 bp.

[0365] SEQ ID NO.31 Nucleotide sequence of the upper strand oligo gRNA2_US2 / SB1_T Length: 24 bp.

[0366] SEQ ID NO.32 Nucleotide sequence of the lower strand oligo gRNA2_US2 / SB1_B Length: 24 bp.

[0367] SEQ ID NO. 33 Gene sequence of US2 of Gallid alphaherpesvirus 3 with accession number by GenBank: HQ840738.1 Length: 816 bp. SEQ ID NO. 34 Nucleotide sequence of the VP2 glycoproteins of IBDV Faragher strain

[0368] 52 / 70, with GenBank access number: Y14958.1

[0369] Longitud: 1362 pb.

[0370] SEQ ID NO.35 Secuencia de nucleótidos del virus rSB1-GFP-VP2 (IBDV) Longitud: 171 ,562 pb.

[0371] SEQ ID NO.36 Secuencia de nucleótidos del virus rSB1-VP2 (IBDV) Longitud: 169, 094 pb.

[0372] Bibliografía:

[0373] 1. Jarosinski KW, Tischer BK, Trapp S, Osterrieder N. 2006. Marek’s disease virus: Lytic replication, oncogenesis and control. Expert Review of Vaccines 5:761-772.

[0374] 2. Petherbridge L, Xu H, Zhao Y, Smith LP, Simpson J, Baigent S, Nair V. 2009. Cloning of Gallid herpesvirus 3 (Marek’s disease virus serotype-2) genome as infectious bacterial artificial chromosomes for analysis of viral gene functions. Journal of Virological Methods 158:11-17.

[0375] 3. Kim T, Spatz SJ, Dunn JR. 2020. Vaccinal efficacy of molecularly cloned Gallid alphaherpesvirus 3 strain 301 B / 1 against very virulent Marek’s disease virus challenge. Journal of General Virology 101 :542-552.

[0376] 4. Iqbal M. 2012. Progress toward the development of polyvalent vaccination strategies against multiple viral infections in Chickens ussing herpesvirus of turkeys as vector. Bioengineered 3:222-226.

[0377] 5. Romanutti C, Keller L, Zanetti FA. 2020. Current status of virus-vectored vaccines against pathogens that affect poultry. Vaccine 38:6990-7001 .

[0378] 6. Sadigh Y, Powers C, Spiro S, Pedrera M, Broadbent A, Nair V. 2018. Gallid herpesvirus 3 SB-1 strain as a recombinant viral vector for poultry vaccination, npj Vaccines 3:1-7.

[0379] 7. Calderon K, Rojas-Neyra A, Carbajal-Levano B, Lujan-Valenzuela L, Ticona J, Isasi-Rivas G, Montalvan A, Criollo-Orozco M, Huaccachi-Gonzales E, Tataje-Lavender L, Alvarez KLF, Fernandez-Sanchez M, Fernandez-Diaz M, Tang N, Yao Y, Nair V. 2022. A Recombinant Turkish Herpesvirus Expressing the F Protein of Newcastle Disease Virus Genotype XII Generated by NHEJ-CRISPR / Cas9 and Cre-LoxP Systems Confers Protection against Genotype XII Challenge in Chickens. Viruses 2022, Vol 14, Page 793 14:793.

[0380] [ PMC free article ] [ PubMed ] 8. Baron MD, Iqbal M, Nair V. 2018. Recent advances in viral vectors in veterinary vaccinology. Current Opinion in Virology 29:1-7.

[0381] 9. Hein R, Koopman R, Garcia M, Armor N, Dunn JR, Barbosa T, Martinez A. 2021 . Review of Poultry Recombinant Vector Vaccines. Avian Diseases 65:438-452.

[0382] 10. Salsman J, Dellaire G. 2017. Precision genome editing in the CRISPR era. Biochemistry and Cell Biology https: / / doi.Org / 10.1139 / bcb-2016-0137.

[0383] 11. Suenaga T, Kohyama M, Hirayasu K, Arase H. 2014. Engineering large viral DNA genomes using the CRISPR-Cas9 system. Microbiology and Immunology https: / / doi.org / 10.1111 / 1348-0421.12180.

[0384] 12. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. 2013. Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8:2281-2308. 13. Chumbe A, Izquierdo-Lara R, Tataje-Lavanda L, Figueroa A, Segovia K, Gonzalez

[0385] R, Cribillero G, Montalvan A, Fernández-Díaz M, Icochea E. 2015. Characterization and Sequencing of a Genotype XII Newcastle Disease Virus Isolated from a Peacock ( Pavo cristatus ) in Peru. Genome Announcements 3:e00792-15.

Claims

1. CLAIMS 1. A recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) virus expressing a heterologous polynucleotide encoding and expressing a gene or antigen of an avian pathogen, inserted in the UL45 / UL46 intergenic region and in the Gallid alphaherpesvirus 32 gene regions (GaHV-3; MDV-2).

2. The recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) according to claim 1 , further characterized because the Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) selects from among the following non-oncogenic strains: SB-1, B / 101, and MDV-1 HPRS- 24.

3. The recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) according to claim 1, characterized in that the heterologous polynucleotide sequences that can be inserted into the Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) genome are: (i) fusion gene (F) (SEQ. ID. NO. 3) from Newcastle disease virus (NDV) genotype XII, or at least one other neuraminidase hemagglutinin (HN) gene, (ii) glycoproteins D and I (gD-I) (SEQ. ID. NO. 20) from avian infectious laryngotracheitis (ILTV) or at least one gene from the following genes: gB, gE, and gC, (iii) VP2 protein (SEQ. ID. NO. 34) from infectious Gumboro disease virus (IBDV) or at least one gene from the following genes: VP3, VP4 of IBDV, (iv) the hemagglutinin (HA) and neuraminidase (NA) genes of H5N1, H5N9, avian influenza (AIV), avian infectious bronchitis (IBV) at least one Spike (S) gene, S1, and S2, 4. The recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) virus, expressing the fusion gene (F) of NDV genotype XII, the glycoproteins D and I of ILT, according to claim 1, characterized in that the insertion of the NDV F gene and glycoproteins D and I of ILT is inserted into the non-coding intergenic region between UL45 / 46 of the Gallid alphaherpesvirus 3 genome, having SEQ ID NO.

2.

5. The recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) virus, expressing the IBDV VP2 protein gene, according to claim 1, characterized in that the IBDV VP2 gene insertion is inserted into the US2 gene region not essential for the genome of Gallid alphaherpesvirus 3 (GaHV-3; MDV-2), which has SEQ ID NO.

33.

6. The recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) virus expressing the fusion gene (F) of Newcastle disease virus (NDV) genotype XII according to claim 3, characterized in that the polybasic cleavage or cutting site ( 112 RRQKRF 117 ) is modified to dibasic ( 112 GRQGRL 117 ).

7. The recombinant Gallid alphaherpesvirus 3 (GaHV3; MDV-2) virus expressing the fusion gene (F) of Newcastle disease virus (NDV) genotype XII according to claim 1, characterized in that the synthetic sequence of cassette F (genotype XII) is stored in the pUC57-F plasmid, the cassette F and HN sequence of NDV.

8. An immunogenic composition characterized in that it comprises recombinant Gallid alphaherpesvirus 3 (GaHV3; MDV-2), expressing the NDV genotype XII F gene identified with SEQ ID NO. 5 and pharmaceutically acceptable excipients.

9. An immunogenic composition characterized in that it comprises the recombinant Gallid alphaherpesvirus 3 virus (GaHV3; MDV-2), which expresses glycoproteins D and I of ILTV strain VFAR-043 identified with SEQ ID NO.22 and pharmaceutically acceptable excipients.

10. An immunogenic composition characterized in that it comprises the recombinant Gallid alphaherpesvirus 3 virus (GaHV3; MDV-2), which expresses the VP2 gene of IBDV strain Faragher 52 / 70, identified with SEQ ID NO.36 and pharmaceutically acceptable excipients.

11. A method for generating a recombinant Gallid alphaherpesvirus 3 (GaHV3; MDV-2) virus expressing antigenic genes against different avian diseases NDV, ILTV, IBDV, IBV, AIV, wherein the method comprises: a) Design and construction of the gRNAs and the donor plasmid; b) Generation of recombinants; c) Recovery of the recombinant viruses; e) Selection and characterization of recombinant viruses containing the GFP cassette + the cassette of interest (protective antigen), by conventional PCR amplifying the entire inserted cassette and the junction regions between the genome of the obtained recombinant virus and the modified virus genome; f) Removal of the expression cassette of the fluorescent reporter gene “GFP” by the Cre-Lox system and selection of recombinant clones using conventional PCR; g) Detection of expression of proteins of interest in cells infected with the recombinant viruses by indirect immunofluorescence (IFA); h) Determination of gene expression by Western blot (WB); i) Evaluation of genetic stability of the cassette inserted into the virus genome by conventional PCR and / or Western blot (WB); and j) Measurement of in vitro growth properties.

12. A kit comprising a vaccine or immunogenic composition according to claim 3, 4 and 5 and a means.

13. An immunogenic composition comprising a recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) according to claim 3, 4, and 5, further characterized in that the virus concentration required to achieve the antigenic response is 3000 plaque-forming units per bird (PFU / bird).

14. A viral vector comprising a recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) according to claim 3, 4, and 5, useful in the control against Newcastle disease virus (NDV), infectious bursal disease or Gumboro virus (IBDV), avian infectious bronchitis virus (IBV), avian infectious laryngotracheitis virus (ILTV), and avian influenza virus (IAV).

15. An immunogenic composition comprising recombinant Gallid alphaherpesvirus 3 (GaHV-3; MDV-2) according to claim 3, 4, and 5, further characterized because the Gallid alphaherpesvirus 3 (GaHV3; MDV-2), is selected among the non-oncogenic strains: SB-1 , 301 B / 1 , and HPRS-24.

Images