Photoelectrochemical biosensor for detecting exosome lncRNA as well as construction method and application of photoelectrochemical biosensor

Abstract

The invention provides a photoelectrochemical biosensor for detecting exosome lncRNA as well as a construction method and application of the photoelectrochemical biosensor. Specifically, an ITO / COF / TiO2 electrode prepared from photoelectric active material COF nanospheres and TiO2 nanospheres generates initial light current under light excitation in a visible light range. Then the electrode is assembled step by step, porous active sites of the TiO2 nanospheres on the surface of the electrode are sealed by pDNA of which the 3'end is modified with a phosphate group, and the phosphate group can ensure that the pDNA is not influenced by subsequent TdT. Then, target lncRNA competes for pDNA on the electrode through base complementary pairing to expose a site, and Tyr can be adsorbed on the surface of the electrode through the pores of the TiO2 nanospheres. TdT catalyzes dCTP, poly (C) is generated in situ on the surface of the electrode by taking a phenolic hydroxyl group of Tyr as a polymerization site, NaBH4 is used for reducing AgNO3 to generate DNA-AgNCs, and the DNA-AgNCs strengthens a photocurrent signal through an SPR (Surface Plasmon Resonance) effect. The sensor has high selectivity and high sensitivity for detecting the content of lncRNA in human plasma exosome lysate, and has huge application potential for biomarker detection in early diagnosis of lung cancer.

Description

Technical Field

[0001] The present invention relates to the field of photoelectrochemical analysis technology, and in particular to a photoelectrochemical biosensor for detecting exosomes, a construction method thereof, and applications thereof. Background Art

[0002] Exosomes are extracellular vesicles approximately 30-150 nm in diameter, secreted by cells and carrying bioactive molecules such as proteins, nucleic acids (such as mRNA and miRNA), and lipids. They serve as "natural messengers" for intercellular communication. Different cell types can release exosomes, and under normal physiological conditions, exosomes can also be isolated from blood, urine, breast milk, and bronchial lavage fluid. They can carry proteins and RNA, playing a vital role in the transduction of substances and information between cells. Exosomes may influence disease progression by regulating immune function. Long non-coding RNA (lncRNA) is a class of RNA molecules with transcripts longer than 200 nucleotides. While generally believed not to encode proteins, lncRNAs are involved in regulating nearly every stage of gene expression, playing a crucial role in the development and progression of numerous human diseases and are closely associated with autoimmune diseases. Therefore, the detection of exosomal lncRNAs holds significant significance in medical and biological research.

[0003] Photoelectrochemical sensors are an emerging sensing technology that has rapidly developed in recent years. With advantages such as high sensitivity, low cost, and simple operation, they have attracted considerable attention in the detection of various disease markers. Invention patent application CN 115753923 A discloses a photoelectrochemical sensor for detecting long noncoding RNA NEAT1 (lncRNA) derived from rheumatic exosomes, as well as its preparation method and application. The sensor utilizes a ZnCo2O4NNs@Zn / Co-ZIF nanocomposite material as a working electrode, enhancing the sensor's photoelectric performance. The sensor exhibits excellent electrode selectivity, sensitivity, and reproducibility, as well as rapid response, addressing the strategic development of a method for detecting long noncoding RNA NEAT1 derived from rheumatic exosomes. Therefore, the sensor has promising practical application value.

[0004] Existing technology reports that lncRNA HOTAIR is a nucleic acid that can be encapsulated in exosomes and transported between tumor cells. It has functions such as regulating tumor apoptosis, proliferation and migration, and has the potential to become a diagnostic and prognostic biomarker for various cancers. Therefore, developing a new photoelectrochemical sensing method for exosomal lncRNA detection and achieving highly sensitive and accurate detection of exosomal lncRNA HOTAIR is a technical challenge that urgently needs to be solved. Summary of the Invention

[0005] In view of this, the main purpose of the present invention is to provide a photoelectrochemical (PEC) biosensor for detecting exosomal lncRNA and its construction method and application, so as to achieve highly sensitive and accurate detection of exosomal lncRNA.

[0006] To achieve the above objectives, the present invention constructs a PEC biosensor for detecting lncRNA based on the target competing with the porous sites of MOF to induce the phenolic hydroxyl group of tyrosine (Tyr), outputting a photocurrent detection signal, and constructing a high-selectivity and high-sensitivity detection of lncRNA content in various exosomes.

[0007] Specifically, the technical solutions provided by the present invention are as follows: A method for constructing a PEC biosensor comprises the following steps: Preparation of composite electrode: Physically adsorbing COF nanospheres and TiO2 nanospheres on the surface of ITO electrode in sequence to prepare ITO / COF / TiO2 composite electrode; Assembling the electrode: using pDNA modified with a phosphate group at the 3′ end to block the porous active sites of the TiO2 nanospheres on the surface of the ITO / COF / TiO2 composite electrode to form an ITO / COF / TiO2 / pDNA composite electrode; Adding a target: using the target lncRNA to compete with the pDNA on the ITO / COF / TiO2 / pDNA composite electrode through base complementary pairing, exposing the active site to form an ITO / COF / TiO2 / pDNA / lncRNA composite electrode; Adding tyrosine: adsorbing tyrosine on the surface of the ITO / COF / TiO2 / pDNA / lncRNA composite electrode to form an ITO / COF / TiO2 / pDNA / lncRNA / Tyr composite electrode; In situ generation of poly (C): a TdT / dCTP mixed solution is added dropwise to the surface of the ITO / COF / TiO2 / pDNA / lncRNA / Tyr composite electrode for incubation, and poly (C) is generated in situ on the surface of the composite electrode using the phenolic hydroxyl group of Tyr as a polymerization site to form an ITO / COF / TiO2 / pDNA / lncRNA / Tyr / poly (C) composite electrode, wherein the TdT / dCTP mixed solution comprises terminal transferase (TdT) and deoxycytidine triphosphate (dCTP); In situ generation of DNA-AgNCs: Silver nitrate solution and NaBH4 solution were sequentially added dropwise to the surface of the ITO / COF / TiO2 / pDNA / lncRNA / Tyr / poly (C) composite electrode for incubation. Silver nitrate was in situ reduced to form DNA-protected silver nanoclusters (DNA-AgNCs), thereby preparing an ITO / COF / TiO2 / pDNA / lncRNA / Tyr / DNA-AgNCs composite electrode.

[0008] Furthermore, by changing the target lncRNA and its base-paired pDNA, the detection of various exosomal lncRNAs can be achieved. Therefore, the target lncRNA is exosomal lncRNA HOTAIR, lncRNA NEAT1, lncRNAMALAT1, lncRNA HULC or lncRNAMEG3, etc.

[0009] Furthermore, the particle size of the COF nanospheres is 200-400 nm. Preferably, the preparation method of the COF nanospheres comprises: synthesizing the COF nanospheres using 2,4,6-tris(4-aminophenyl)-1,3,5-triazine (TAPT), 1,3,5-benzenetricarboxaldehyde, and acetonitrile as raw materials.

[0010] Furthermore, the TiO2 nanospheres preferably have a particle size of 7.5-10 nm and a specific surface area of 120-140 m² / g; they are primarily obtained by calcining Ti-MOFs. The TiO2 nanosphere preparation method may include: synthesizing Ti-MOFs via a hydrothermal method using titanium isopropoxide, tetraphenylporphyrin, methanol, and N,N-dimethylformamide as raw materials; and heating the Ti-MOFs at 350-400°C for 3-5 hours in an air atmosphere to obtain the TiO2 nanosphere particles.

[0011] Furthermore, to further improve the photocurrent signal of the PEC biosensor, the competition time of the target lncRNA is preferably 30-120 min; the adsorption time of Tyr is preferably 90-180 min; and the reaction time of TdT is preferably 20-80 min. A PEC biosensor constructed by the above construction method.

[0012] An application of the above-mentioned PEC biosensor in detecting target lncRNA.

[0013] Furthermore, the application includes: placing the PEC biosensor in a Tril-HCl buffer solution containing ascorbic acid for photocurrent detection, detecting the photocurrent signal of the target lncRNA at different concentrations; and constructing a linear equation between the lncRNA concentration and the photocurrent signal based on the detection results.

[0014] Furthermore, the target lncRNA is lncRNA HOTAIR, and the linear equation between its concentration and photocurrent signal is: I = -0.205LgC HOTAIR -2.340, of which I The photocurrent signal is μA; C HOTAIR is the concentration of lncRNA HOTAIR, fmol / L; correlation coefficient R 2 is 0.998.

[0015] The PEC biosensor provided by the present invention exposes porous sites on the MOF derivative TiO2 through competition with target species, allowing the adsorption of the biomolecule tyrosine (Tyr). Terminal transferase (TdT) catalyzes the extension of dCTP to the 3' end of the phenolic hydroxyl group of tyrosine to form a poly(C) complex. Sodium borohydride reduces silver nitrate to generate DNA-AgNCs in situ. The DNA-AgNCs amplify the photocurrent signal, enabling highly selective and sensitive detection of lncRNA content in human plasma exosome lysates. The developed PEC biosensor has significant potential for biomarker detection in the early diagnosis of lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the principle of the PEC biosensor provided by the present invention for detecting exosomal lncRNA; Figure 2 SEM (A), XRD (B), and UV-vis (C) characterization results of COF nanospheres; Figure 3 SEM images of TiO2 nanospheres (B) and their precursor Ti-MOFs (A); Figure 4 XRD patterns of TiO2 nanospheres (B) and their precursor Ti-MOFs (A); Figure 5 N2 adsorption and desorption test results (A) and UV-vis spectrum (B) of TiO2 nanospheres; Figure 6 UV-vis spectra of poly (C), AgNPs, and DNA-AgNCs, where curve a: Tyr + Poly (C), b: AgNPs, and c: Tyr + Poly (C)-AgNCs; Figure 7 HRTEM image of DNA-AgNCs; Figure 8 Photocurrent response graph (A) and EIS response graph (B) during the assembly process of the PEC biosensor provided in Example 2; Figure 9 Results of the target competition time optimization (A), tyrosine adsorption time optimization (B), and TdT reaction time optimization (C) for the PEC biosensor constructed based on Example 2 are shown; Figure 10 The photocurrent response (A) and standard curve (B) of the PEC biosensor constructed based on Example 2 for detecting different concentrations of lncRNA HOTAIR; Figure 11 Figure 2 shows the selectivity (A) and stability (B) of the PEC biosensor constructed based on Example 2, where the horizontal axis of Figure (A) represents Blank, lncRNA HULC, lncRNA MEG3, lncRNA MALAT1, miRNA-let-7a, miRNA-486, circSTAB2, lncRNA HOTAIR, and Mixture (a mixture of the seven RNAs). Figure 12 This is a box plot of actual samples detected by the PEC biosensor constructed based on Example 2 (10 lung cancer patients and 10 non-lung cancer patients). DETAILED DESCRIPTION

[0017] In order to make the purpose, technical solutions and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0018] Unless otherwise specified, "M" in the concentration unit herein refers to "mol / L," e.g., "mM" refers to "mmol / L," "aM" refers to "amol / L," "pM" refers to "pmol / L," and "fM" refers to "mol / L." The terms used in the present invention are commonly used in the art. The preparation processes and testing methods used in each embodiment, unless otherwise specified, are conventional means well known to those skilled in the art. All raw materials and equipment used are commercially available. The sources and trade names of all reagents used, as well as their constituent components, where necessary, are indicated upon their first appearance.

[0019] The materials of some test kits in the examples are as follows: ascorbic acid (Sinopharm Chemical Reagent Co., Ltd.), tyrosine (Aladdin Biochemical Technology Co., Ltd.), ITO electrode (Zhuhai Kaiwei Optoelectronics Technology Co., Ltd.), calomel electrode and platinum electrode (Shanghai Yidian Scientific Instrument Co., Ltd.).

[0020] Milli-Q water (resistivity ≥ 18.2 MΩ·cm at 25 °C) was used in all experiments.

[0021] TdT (2500 units) and dCTP (100 mM) used in the experiment were obtained from Beyotime (Shanghai) Biotechnology Co., Ltd.

[0022] The nucleic acids used were purchased from Sangon Biotech (Shanghai) Co., Ltd., see Table 1 for details.

[0023] Table 1. Nucleic acid names and base sequences Serial number sequence name Nucleic acid sequence (5′ to 3′) SEQ ID NO: 1 LncRNA HOTAIR GCAACUCUAUAAUAUGCUUAUAUUAGGUCUAGAAG SEQ ID NO:2 pDNA CTTCTAGACCTAATATAAGCATATTATAGAGTTGC-P SEQ ID NO:3 MiRNA-let-7a UGAGGUAGUAGGUUGUAUAGUU SEQ ID NO:4 MiRNA-486 UCCUGUACUGAGCUGCCCCGAG SEQ ID NO:5 LncRNA MALAT1 UAAGAUUUCCCAAGCAGACAGCCCGUGCUGCUCCG SEQ ID NO:6 LncRNA HULC UGAGAAGGACCGAACGUCUAACCCCGGAACGACGACAU SEQ ID NO:7 LncRNA MEG3 CCUCUUAUUUAUUCUGUUCAUUCUGUUCGU SEQ ID NO:8 CircSTAB2 A AGA GUG GCA UUC AAC CGC ACA CAGGUU UGA UGA UUC CUG UCU UUU GUG U The 3' end of pDNA is modified with a phosphate group to avoid the influence of TdT.

[0024] The solutions configured in each test of the present invention are as follows: (1) 0.1 mmol / L Tris-HCl (pH = 7.4) buffer: Weigh 12.114 g of tris(hydroxymethyl)aminomethane (Tris), dissolve it in 900 mL of Milli-Q water, adjust the pH to 7.4 with 0.1 mmol / L hydrochloric acid (HCl), and make up to 1000 mL.

[0025] (2) TdT / dCTP mixed solution: Dissolve 2 µL of terminal transferase (TdT) and 4 µL of 2.5 mmol / L deoxycytidine triphosphate (dCTP) in 4 µL of buffer.

[0026] Photocurrent experimental method The gradual assembly process on the electrode surface was verified by photocurrent experiments. These experiments were conducted on a CHI660E electrochemical workstation using a standard three-electrode system: a 5.6 mm diameter ITO electrode as the working electrode, a saturated calomel electrode (SCE) as the reference electrode, and a platinum wire as the auxiliary electrode. The modified electrode was placed in a Tris-HCl (0.1 mol / L, pH 7.4) buffer containing 0.1 mol / L ascorbic acid (AA) and subjected to photocurrent measurement at a voltage of -0.2 V.

[0027] AC impedance test method AC impedance testing is a test method that applies a small amplitude sinusoidal potential wave as a disturbance signal to the electrochemical system. The diameter of the semicircle in the Nyquist plot represents the interfacial charge transfer resistance of the electrode ( R ct), so the electrode assembly process was monitored by EIS. The electrochemical impedance spectroscopy experiment was performed on a CHI 660E electrochemical workstation using a standard three-electrode system. The modified electrode was placed in a solution containing 5 mmol / L [Fe(CN)6] 3- / 4- The tests were carried out in a 1 mmol / L potassium chloride solution with a (1:1) ratio, a frequency range of 0.1 Hz to 100 kHz, and an applied amplitude of 5 mV.

[0028] In order to improve the specificity of the target lncRNA detection method, the present invention introduces the signal amplification technology based on COF / TiO2 and DNA-AgNCs. The principle of the PEC biosensor of the present invention is as follows Figure 1 As shown. First, the ITO / COF / TiO2 electrode prepared from the photoelectrically active materials COF nanospheres and TiO2 nanospheres generates an initial photocurrent under light excitation in the visible light range. Then the electrodes are assembled step by step. First, the porous active sites of the TiO2 nanospheres on the electrode surface are blocked with pDNA modified with a phosphate group at the 3′ end to form an ITO / COF / TiO2 / pDNA electrode, in which the phosphate group can ensure that the pDNA is not affected by subsequent TdT. Next, the target lncRNA competes for the exposed sites of the pDNA on the ITO / COF / TiO2 / pDNA electrode through complementary base pairing, and tyrosine Tyr can be adsorbed on the surface of the ITO / COF / TiO2 / pDNA / lncRNA electrode through the porous TiO2 nanospheres. TdT catalyzes deoxycytidine triphosphate dCTP and generates poly (C) in situ on the surface of the ITO / COF / TiO2 / pDNA / lncRNA / Tyr electrode with the phenolic hydroxyl group of Tyr as the polymerization site. Due to Ag + The researchers used silver nitrate (AgNO3) to reduce silver nitrate with sodium borohydride (NaBH4) to generate DNA-protected silver nanoclusters (DNA-AgNCs), which have a high affinity for poly(C). The DNA-AgNCs in this composite electrode enhanced the photocurrent signal through the SPR effect.

[0029] Example 1 Preparation of Sensing Materials (1) Preparation of COF nanospheres To a glass vial, 14.20 mg of 2,4,6-tris(4-aminophenyl)-1,3,5-triazine, 5 mL of acetonitrile, and 6.50 mg of 1,3,5-benzenetricarboxaldehyde were added. After sonication for 30 minutes, 0.4 mL of 12 mol / mL glacial acetic acid was added. After 96 hours of reaction, the mixture was centrifuged and washed to obtain a yellow solid product. The chitosan solution was then mixed with the COF synthesized above and reacted for 3 hours. The mixture was then centrifuged at 4000 rpm for 5 minutes to obtain the precipitate (chitosan-modified COF nanospheres), which was then redissolved in deionized water to improve the photocurrent signal and dispersion.

[0030] SEM, XRD and UV-vis were used to characterize the COF nanospheres. Figure 2 shown. Figure 2 A shows that the COF has a clear spherical shape with a size of 200-400 nm. XRD analysis can determine the crystal structure of the material components. Figure 2 Figure B shows a strong 2Theta diffraction peak at 5.7°, corresponding to the (100) plane of COF, and a broad peak at 25.6°, likely caused by chitosan. The light absorption capacity of a material greatly affects its optoelectronic properties and can be analyzed using UV-Vis-NIR testing. Figure 2 C shows that COF nanospheres have a broad absorption peak and have the potential for excellent optoelectronic properties.

[0031] (2) Preparation of TiO2 nanospheres 0.78 mL of titanium isopropoxide and 240 mg of tetraphenylporphyrin were dissolved in a mixture of 54 mL of N,N-dimethylformamide (DMF) containing 3 mL of methanol. After ultrasonic stirring for 10 minutes, the mixture was transferred to a 100 mL polytetrafluoroethylene reactor, sealed, and placed in an oven at 150°C for 72 hours. After the reaction, the reactor was cooled to room temperature, the solution was removed and purified by centrifugation, and then repeatedly washed with DMF and methanol to remove impurities. Finally, the dried powder was heated at 380°C in air for 4 hours to obtain TiO2 nanospheres.

[0032] (3) Characterization of nanosphere performance TiO2 nanospheres were characterized by SEM, XRD, nitrogen (N2) adsorption and desorption test, and UV-vis. The results are as follows Figure 3-Figure 5 shown. Figure 3 The SEM images shown reveal the morphology and size of TiO2 precursor Ti-MOFs and TiO2 nanospheres. Figure 3 As can be seen in A, the Ti-MOFs appear to be spherical particles. Figure 3B shows the TiO2 nanosphere particles after calcination and oxidation in an air atmosphere. It can be seen that it still exhibits a spherical structure, but its size is smaller than that of the precursor Ti-MOFs.

[0033] Figure 4 It shows that the crystal structure of TiO2 nanospheres can be characterized by XRD. Figure 4 A is the XRD pattern of the precursor Ti-MOFs. Figure 4 Figure B shows that 2 Theta has corresponding diffraction peaks at 25.5°, 37.8°, 48.1°, 53.8°, 55.1° and 62.7°, corresponding to the (101), (004), (200), (105), (211) and (204) crystal planes of TiO2 (JCPDS, PDF#21-1272). It can be seen that the diffraction peaks of Ti-MOFs disappear after calcination.

[0034] The N2 adsorption-desorption test can obtain the pore size characteristics and specific surface area of TiO2 nanospheres, such as Figure 5 As shown in Figure A, the BET surface area of the TiO2 nanospheres is calculated to be 134.43 m² / g, and the pore size distribution curve shows an average pore diameter of 8.86 nm. This mesoporous structure provides ample binding sites for pDNA and tyrosine. Figure 5 B shows the UV-vis spectrum of TiO2 nanospheres, which has a broad absorption peak in the visible region, indicating that TiO2 nanospheres can be used as an excellent photoelectric active material.

[0035] Example 2 Construction of PEC biosensor This embodiment provides a method for constructing a PEC biosensor, comprising the following steps: First, 25 μL of a 2 mg / mL COF solution was added to a cleaned ITO electrode and air-dried. After complete physical adsorption onto the ITO electrode, an ITO / COF electrode was formed. Then, 20 μL of a 1 mg / mL TiO2 solution was added and air-dried until adsorbed onto the ITO / COF electrode, forming an ITO / COF / TiO2 electrode. Then, 10 μL of 2 μmol / L pDNA was incubated on the ITO / COF / TiO2 electrode for 90 minutes, forming an ITO / COF / TiO2 / pDNA electrode. 10 μL of the target lncRNA HOTAIR at varying concentrations was added to the ITO / COF / TiO2 / pDNA electrode and incubated for 60 minutes, competing with the pDNA on the electrode surface to expose active sites, forming an ITO / COF / TiO2 / pDNA / lncRNA HOTAIR electrode. Then, 10 μL of 10 μmol / L Tyr solution was added dropwise to the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR electrode and incubated for 135 min to form the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr electrode. Subsequently, 10 μL of TdT / dCTP mixed solution was added to the surface of the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr electrode and incubated for 60 min. TdT catalyzed dCTP and used the phenolic hydroxyl group of Tyr in the electrode as the polymerization site to generate poly (C) in situ, forming the ITO / COF / TiO2 / pDNA / lncRNAHOTAIR / Tyr / poly (C) electrode. 10 μL of 0.1 mM AgNO3 solution was added to the surface of the ITO / COF / TiO2 / pDNA / lncRNAHOTAIR / Tyr / poly (C) electrode and incubated in the dark for 30 min to allow the silver ions in it to adsorb to the poly (C). 10 μL of 0.1 mM NaBH4 solution was added to the surface of the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr / poly (C) electrode and incubated for 30 min. min, allowing NaBH4 to in situ reduce silver ions to form DNA-protected silver nanoclusters DNA-AgNCs, and prepare the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr / DNA-AgNCs composite electrode.Finally, the PEC test was performed using the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr / DNA-AgNCs composite electrode in 0.1 mol / L Tris-HCl solution (pH 7.4) containing 0.1 mol / L AA with a bias voltage of -0.2 V, completing the construction of the sensor.

[0036] (1) Characterization of DNA-AgNCs UV-vis spectra of ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr / poly (C) electrode (curve a), AgNCs (curve b) and ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr / DNA-AgNCs composite electrode (curve c) were processed respectively. The results are shown in Figure 2. Figure 6 shown. Figure 6 The formation of DNA-AgNCs was verified. The peak at 260 nm in curve a is the UV absorption peak of Tyr-Poly(C), the peak at 430 nm in curve b is the UV absorption peak of AgNCs, and curve c shows two peaks at 260 nm and 400 nm, respectively, confirming the formation of DNA-AgNCs with the help of poly(C). The AgNCs (curve b) were prepared by adding 10 µL of a 0.1 mM NaBH₄ solution dropwise to a 10 µL 0.1 mM AgNO₃ solution.

[0037] To further characterize DNA-AgNCs, HRTEM experiments were performed, and the results are shown in Figure 7 shown. Figure 7 The TEM image of A shows that DNA-AgNCs are well dispersed with an average diameter of 2-3 nm. Figure 7 The HRTEM image of B shows a lattice spacing of 0.205 nm.

[0038] (2) Feasibility analysis To confirm the feasibility of the dual-mode biosensor detection, photocurrent response and EIS response were used for verification, and the results are shown in Figure 2. Figure 8 shown.

[0039] Figure 8Figure A shows that the ITO / COF / TiO2 electrode initially generates an initial photocurrent response (curve a). Then, pDNA is introduced to protect the photoactive material on the electrode surface. Due to the poor conductivity of DNA, the photocurrent response decreases (curve b). When the target lncRNA HOTAIR competes for the pDNA on the ITO / COF / TiO2 / pDNA electrode surface, the photocurrent response recovers and increases (curve c). When Tyr adsorbs onto exposed active sites on the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR electrode surface, the photocurrent response decreases (curve d). Subsequently, TdT induces dCTP to extend poly(C) on the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr electrode surface, and the photocurrent response further decreases (curve e). When NaBH₄ reduced AgNO₃ to DNA-AgNCs in situ, the photocurrent response of the ITO / COF / TiO₂ / pDNA / lncRNA HOTAIR / Tyr / DNA-AgNCs electrode increased (curve f). These phenomena confirmed the successful construction of a PEC biosensor for detecting lncRNA HOTAIR.

[0040] like Figure 8 As shown in Figure 2, the ITO / COF / TiO2 electrode has a small semicircular diameter (curve a). When pDNA blocks and protects the electrode surface, the semicircular diameter of the ITO / COF / TiO2 / pDNA electrode increases due to its poor conductivity and steric hindrance (curve b). As the target lncRNA HOTAIR is added, it competes with the pDNA on the ITO / COF / TiO2 / pDNA / lncRNAHOTAIR electrode, causing the semicircular diameter of the ITO / COF / TiO2 / pDNA / lncRNAHOTAIR electrode to decrease (curve c). When Tyr adsorbs onto exposed active sites on the electrode surface, the semicircular diameter of the ITO / COF / TiO2 / pDNA / lncRNAHOTAIR / Tyr electrode increases again (curve d). Subsequently, TdT triggers the extension of dCTP onto the electrode surface. Due to the poor conductivity and steric hindrance of poly(C), the semicircular diameter of the ITO / COF / TiO2 / pDNA / lncRNAHOTAIR / Tyr / poly(C) electrode increases (curve e). Finally, when NaBH4 reduced AgNO3 into DNA-AgNCs in situ, the good conductivity of AgNCs made the semicircular diameter of the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr / DNA-AgNCs composite electrode smaller (curve f).

[0041] Condition optimization experiment The competition time of target lncRNA, the adsorption time of Tyr and the reaction time of TdT all have an important influence on the photocurrent response of PEC biosensor. Figure 9 shown.

[0042] (1) Competition time of target lncRNA Experimental conditions: The competition time of the target lncRNA was 0, 30, 60, 90, and 120 min, respectively. The other step parameters were the same as those in the construction method of the PEC biosensor provided in Example 2.

[0043] like Figure 9 As shown in Figure A, as the target lncRNA HOTAIR competes for pDNA on the ITO / COF / TiO2 / pDNA electrode surface for an increasing amount of time, the photocurrent response gradually increases and reaches a plateau at 90 minutes, indicating that the competition time for lncRNA HOTAIR with pDNA has reached saturation. Therefore, the competition time for the target lncRNA is preferably 60-120 minutes, with 90 minutes being selected as the optimal competition time for the target lncRNA in this experiment.

[0044] (2) Tyr adsorption time Experimental conditions: The adsorption times of Tyr were 0, 45, 90, 135, and 180 min, respectively. Other step parameters were the same as those in the construction method of the PEC biosensor provided in Example 2.

[0045] like Figure 9 As shown in Figure B, as the adsorption time of Tyr on the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR electrode increases, the photocurrent response value gradually decreases and reaches a plateau at 135 minutes, indicating that the adsorption time of Tyr reaches saturation. Therefore, the adsorption time of Tyr is preferably 90-180 minutes, and 135 minutes is selected as the optimal adsorption time of Tyr in this experiment.

[0046] (3) TdT reaction time Experimental conditions: The reaction times of TdT were 0, 20, 40, 60, and 80 min, respectively. Other step parameters were the same as those in the construction method of the PEC biosensor provided in Example 2.

[0047] like Figure 9As shown in Figure C, as the reaction time of TdT on the ITO / COF / TiO2 / pDNA / lncRNA HOTAIR / Tyr electrode increases, the photocurrent response value gradually decreases and reaches a plateau at 60 minutes, indicating that the reaction time of TdT reaches saturation. Therefore, the reaction time of TdT is preferably 40-80 minutes, and 60 minutes was selected as the optimal reaction time of TdT in this experiment.

[0048] Example 3 Application of PEC biosensor in LncRNA detection The concentration of lncRNA HOTAIR was detected using the PEC biosensor constructed under the optimal conditions of Example 2, and a standard curve was constructed. Specifically, when 500 aM, 1 fM, 5 fM, 10 fM, 100 fM, 1 pM, 10 pM, 50 pM, and 100 pM of lncRNA HOTAIR were detected by PEC, each concentration was measured in triplicate. The results of the photoelectrochemical experiment were linearly fitted to establish a standard curve for detecting lncRNA. The results are shown in Figure 2. Figure 10 shown.

[0049] Figure 10 A shows that in the range of 500aM to 100pM, the photocurrent increases with the increase of lncRNA HOTAIR concentration. Figure 10 B shows the linear response curve of the photocurrent signal (I) and the logarithm of the lncRNA HOTAIR concentration (logC). The linear regression equation of lncRNA HOTAIR is: I (μA) = -0.205LgC HOTAIR -2.340, of which C HOTAIR Unit: fmol / L, correlation coefficient R 2 The detection limit was 0.998 and 116 amol / L.

[0050] (1) Selectivity Six RNAs (lncRNA MALAT1, lncRNA HULC, lncRNA MEG3, miRNA-let-7a, miRNA-486, and circSTAB2) were selected as interfering agents. The established method was used to detect 1 nmol / L of lncRNA MALAT1, lncRNA HULC, lncRNA MEG3, miRNA-let-7a, miRNA-486, and circSTAB2, as well as mixtures of these six RNAs and 10 pmol / L of the target lncRNA HOTAIR. The selectivity of the method was evaluated by measuring the photocurrent response values in different experimental groups.

[0051] like Figure 11 As shown in Figure A, the photocurrent response of HOTAIR is significantly higher than that of other RNAs. Furthermore, the signal response of the HOTAIR-free control is not significant compared to the blank control. Furthermore, the expression of the mixed interference is also higher than that of other RNAs and the blank control. Therefore, this detection platform has excellent selectivity for the detection of HOTAIR.

[0052] (2) Stability The stability of the PEC biosensor constructed in Example 2 was studied by storing it at 4°C for 7 and 14 days. The photoelectrochemical signal value was measured and compared with the signal value corresponding to the initial target substance. The target substance concentration used was 1 pmol / L. Figure 11 As shown in Figure 3B, the photocurrents detected by lncRNAHOTAIR maintained 96.3% and 92.7% of the initial values, respectively, indicating that the prepared biosensor has good stability.

[0053] (3) Reproducibility At the same time, in order to evaluate the repeatability of the PEC biosensor constructed in Example 2, five test electrodes assembled under the same conditions were used to detect the reproducibility of the PEC biosensor, and the calculated results were: RSD The PEC biosensor constructed in this embodiment of the present invention has good reproducibility and good repeatability for the quantitative detection of lncRNA.

[0054] (4) Spike recovery experiment To explore the feasibility of the developed biosensor for detection in actual samples, three concentrations of lncRNA HOTAIR (low, medium, and high) (1 fmol / L, 100 fmol / L, and 5 pmol / L) were added to exosome lysates extracted from plasma. The PEC biosensor constructed in Example 2 was used to detect the content of lncRNA HOTAIR in the exosome lysates. Each concentration was measured in triplicate. The results are shown in Table 2.

[0055] Table 2 Recovery rate of lncRNA HOTAIR in exosome lysate As shown in Table 2, the average recovery rates of lncRNA HOTAIR when 1 fmol / L, 100 fmol / L, and 5 pmol / L were added to the exosome lysate extracted from plasma were 96.3%, 97.7%, and 95.3%, respectively, indicating that the constructed biosensor has good application prospects for detecting lncRNA in actual samples.

[0056] (5) Clinical sample analysis Finally, in order to evaluate the practicality of the developed biosensor in actual clinical samples, 20 clinical blood samples were collected from the First Affiliated Hospital of Zhengzhou University, including 10 non-lung cancer patients and 10 lung cancer patients. The content of lncRNA in the exosome lysate extracted from the plasma of these two groups of 20 cases was detected using the method of the present invention. The results are as follows: Figure 12 shown.

[0057] Figure 12 The results showed that the average concentration of lncRNA HOTAIR in the lung cancer group was 310.63 amol / L, while the average concentration of lncRNA HOTAIR in the non-lung cancer group was 134.51 amol / L. Therefore, the average concentration of lncRNA HOTAIR in the lung cancer group was higher than that in the non-lung cancer group, and the difference was statistically significant ( P <0.05). This indicates that the PEC biosensor developed in this embodiment of the present invention can be used to detect the expression level of HOTAIR related to lung cancer patients.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to preferred embodiments, ordinary technicians in the field should understand that the specific implementation methods of the present invention can still be modified or some technical features can be replaced by equivalents without departing from the spirit of the technical solutions of the present invention. They should all be included in the scope of the technical solutions claimed for protection by the present invention.

Claims

1. A method for constructing a PEC biosensor for detecting exosomal lncRNA, comprising the following steps: Preparation of composite electrode: Physically adsorbing COF nanospheres and TiO2 nanospheres on the surface of ITO electrode in sequence to prepare ITO / COF / TiO2 composite electrode; Assembling the electrode: using pDNA modified with a phosphate group at the 3′ end to block the porous active sites of the TiO2 nanospheres on the surface of the ITO / COF / TiO2 composite electrode to form an ITO / COF / TiO2 / pDNA composite electrode; Adding a target: using the target lncRNA to compete with the pDNA on the ITO / COF / TiO2 / pDNA composite electrode through base complementary pairing, exposing the active site to form an ITO / COF / TiO2 / pDNA / lncRNA composite electrode; Adding tyrosine: adsorbing tyrosine on the surface of the ITO / COF / TiO2 / pDNA / lncRNA composite electrode to form an ITO / COF / TiO2 / pDNA / lncRNA / Tyr composite electrode; In situ generation of poly (C): a TdT / dCTP mixed solution is added dropwise to the surface of the ITO / COF / TiO2 / pDNA / lncRNA / Tyr composite electrode for incubation, and poly (C) is generated in situ on the surface of the composite electrode using the phenolic hydroxyl group of Tyr as a polymerization site to form an ITO / COF / TiO2 / pDNA / lncRNA / Tyr / poly (C) composite electrode, wherein the TdT / dCTP mixed solution comprises terminal transferase and deoxycytidine triphosphate; In situ generation of DNA-AgNCs: Silver nitrate solution and sodium borohydride solution were sequentially added dropwise to the surface of the ITO / COF / TiO2 / pDNA / lncRNA / Tyr / poly (C) composite electrode for incubation. Silver nitrate was reduced in situ to form DNA-protected silver nanoclusters, thereby preparing an ITO / COF / TiO2 / pDNA / lncRNA / Tyr / DNA-AgNCs composite electrode.

2. The construction method according to claim 1, wherein The target lncRNA is exosomal lncRNAHOTAIR, lncRNANEAT1, lncRNAMALAT1, lncRNAHULC or lncRNAMEG3.

3. The construction method according to claim 1, wherein The particle size of the COF nanospheres is 200-400 nm, the particle size of the TiO2 nanospheres is 7.5-10 nm, and the specific surface area is 120-140 m² / g.

4. The construction method according to any one of claims 1 to 3, wherein The competition time of the target lncRNA is 30-120 min.

5. The construction method according to claim 4, wherein: The adsorption time of Tyr is 90-180 min.

6. The construction method according to claim 5, wherein: The reaction time of TdT is 20-80 min.

7. A PEC biosensor constructed by the construction method according to any one of claims 1 to 6.

8. Use of the PEC biosensor according to claim 7 in detecting target lncRNA.

9. The use according to claim 8, characterized in that include: The PEC biosensor is placed in a Tril-HCl buffer solution containing ascorbic acid for photocurrent detection to detect the photocurrent signal of the target lncRNA at different concentrations; and a linear equation between the target lncRNA concentration and the photocurrent signal is constructed based on the detection results.

10. The use according to claim 9, characterized in that The target lncRNA is lncRNA HOTAIR, and the linear equation between its concentration and photocurrent signal is: I = -0.205LgC HOTAIR -2.340, of which I The photocurrent signal is μA; C HOTAIR is the concentration of the target lncRNA HOTAIR, f mol / L; correlation coefficient R 2 is 0.998.

Images