Method for preparing col17a1 protein and use thereof

By using the EDIL3 protein signal peptide to express COL17A1 protein in HEK-293T cells, the problem of low expression efficiency of recombinant COL17A1 protein was solved, achieving high yield and high bioactivity, promoting fibroblast function, and expanding its application in multiple biomedical fields.

CN120591345BActive Publication Date: 2026-02-03广州景旸生物科技有限公司
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510791212.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2026-02-03
Estimated Expiration
2045-06-13

AI Technical Summary

Technical Problem

In the existing technology, the recombinant COL17A1 protein has low expression efficiency in mammalian cells, resulting in high production costs and high immunogenicity, making it difficult to mass-produce and limiting its application in the biomedical field.

Method used

COL17A1 protein was expressed in HEK-293T cells, and the EDIL3 protein signal peptide was used as the signal peptide to improve the expression level and biological activity of COL17A1 protein. Efficient preparation was achieved through vector-mediated transfection.

Benefits of technology

We have achieved the preparation of high-yield, highly bioactive COL17A1 protein, which promotes the proliferation, adhesion, and migration of fibroblasts, expanding its application potential in tissue regeneration, wound healing, regenerative medicine, gene therapy, skin disease treatment, and anti-aging products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120591345B_ABST
    Figure CN120591345B_ABST
Patent Text Reader

Abstract

The application provides a preparation method of COL17A1 protein and application thereof, and relates to the technical field of biology.The preparation method comprises expressing the COL17A1 protein by using HEK-293T cells, and using an EDIL3 protein signal peptide as a signal peptide of the COL17A1 protein.The preparation method can make the HEK-293T cells express the COL17A1 protein in a high yield and high biological activity, and is helpful to the application of the COL17A1 protein in tissue regeneration, wound healing and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for preparing COL17A1 protein and its application. Background Technology

[0002] The following statements are provided only as background information in relation to the present invention and do not necessarily constitute prior art.

[0003] COL17A1 (collagen type XVII α1 chain) belongs to the XVII collagen family and is an important transmembrane protein in the basement membrane region. As a core component of hemidesmosomes, COL17A1 exists in the basement membrane region of the epidermis and dermis, playing a crucial role in maintaining skin structural stability, cell adhesion, signal transduction, and tissue regeneration. It also regulates the stem cell microenvironment, promotes stem cell proliferation, regulates keratinocyte migration, and promotes wound healing. In recent years, it has been widely used in the treatment of skin diseases, gene therapy, regenerative medicine, and anti-aging.

[0004] Natural COL17A1 is present in extremely low amounts in humans and animals, making extraction difficult and yields very low, thus limiting its application prospects. Currently, its main sources rely on recombinant expression in *E. coli*, *Pichia pastoris*, or mammalian cells (such as HEK-293T and CHO). However, recombinant expression systems still face numerous technical challenges. While recombinant expression of COL17A1 using *E. coli* or *Pichia pastoris* is low-cost and yields high volumes, the expressed COL17A1 is unglycosylated and prone to inclusion body formation, leading to decreased protein stability and the potential for endotoxins that could trigger immune responses, limiting its use to scientific research and in vitro experiments. Recombinant human COL17A1 protein expressed in mammalian cells such as HEK-293T and CHO is closer to natural glycosylation, exhibiting lower immunogenicity and higher biological activity, and can be widely used in immunotherapy, regenerative medicine, and anti-aging. However, its protein expression levels are low, and purification steps such as affinity chromatography and ion exchange are required, significantly increasing production costs.

[0005] Therefore, developing an efficient, highly active, low-immunogenic, and low-cost method for preparing recombinant human type XVII collagen COL17A1 and expanding its application in the biomedical field has significant market potential.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] The purpose of this invention is to provide a method for preparing COL17A1 protein, so as to alleviate the problem of low efficiency in expressing COL17A1 protein using mammalian cells in the prior art.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0009] In a first aspect, a method for preparing COL17A1 protein is provided, the method comprising expressing COL17A1 protein using HEK-293T cells and using EDIL3 protein signal peptide as the signal peptide of COL17A1 protein.

[0010] In a second aspect, a polynucleotide is provided, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the EDIL3 protein signal peptide and a sequence encoding the COL17A1 protein, respectively.

[0011] Thirdly, a carrier is provided that carries the polynucleotide described in the second aspect.

[0012] Fourthly, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide of the second aspect, or contains the vector described in the third aspect.

[0013] Fifthly, a method for preparing the COL17A1 protein described in the first aspect, or the COL17A1 protein prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the application of the recombinant HEK-293T cells described in the fourth aspect in any one of (i) to (iii):

[0014] (i) Uses for promoting fibroblast adhesion, proliferation and / or migration for purposes other than diagnosis and treatment;

[0015] (ii) Use in the preparation of products for promoting fibroblast adhesion, proliferation and / or migration;

[0016] (iii) Application in the preparation of products for tissue regeneration or wound healing.

[0017] In a sixth aspect, a method for preparing the COL17A1 protein described in the first aspect, or the COL17A1 protein prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect, are provided for use in the preparation of regenerative medicine products, gene therapy products, skin disease treatment products, or anti-aging products.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This invention utilizes HEK-293T cells to express COL17A1 protein and replaces the traditional signal peptide with the EDIL3 protein signal peptide, thus successfully achieving the preparation of high-yield, highly bioactive COL17A1 protein. Experiments have confirmed a synergistic effect between the EDIL3 protein signal peptide and HEK-293T cells; compared to CHO cells, the EDIL3 protein signal peptide induces higher COL17A1 protein expression levels in HEK-293T cells. Furthermore, the COL17A1 protein prepared by this invention exhibits excellent bioactivity, demonstrating its effective promotion of fibroblast proliferation, adhesion, and migration. Based on these superior properties, this preparation method has enormous application potential and a broad market prospect in multiple fields, including tissue regeneration, wound healing, regenerative medicine product development, gene therapy product research, biomaterial preparation, and the production of skin disease treatment products, anti-aging products, and cosmetic products. Attached Figure Description

[0020] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0021] Figure 1 The plasmid map of the expression plasmid constructed in Example 1;

[0022] Figure 2 The results of Western blot analysis in Example 3 show the expression of COL17A1 linked to signal peptides A, B, and C, respectively.

[0023] Figure 3 The results of immunoblotting in Example 4 show the expression of COL17A1, the linker signal peptide A, in CHO cells and HEK-293T cells.

[0024] Figure 4 The relative adhesion rates of fibroblasts in the negative control and after the well plate was coated with COL17A1 protein in Example 5;

[0025] Figure 5 The relative proliferation rate of fibroblasts treated with different concentrations of COL17A1 protein in Example 6;

[0026] Figure 6 These are photographs of fibroblasts at 0h, 6h, and 24h in the cell scratch experiment of Example 7. Detailed Implementation

[0027] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0028] In this document, “and / or” is used to indicate that one or both of the situations described may occur, for example, A and / or B includes (A and B) and (A or B).

[0029] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or behavior from another, and is not required to require or imply any actual relationship, order, or importance between these entities or behaviors, such as numbering first, second, etc.

[0030] In this document, unless otherwise stated, “optional,” “optional,” “optional,” or “optional” means that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation may or may not occur.

[0031] In this document, the terms “comprising” or “including” mean that the stated elements, integers or steps are included, but do not exclude any other elements, integers or steps.

[0032] In this article, the term "COL17A1 protein" refers to type XVII collagen α1 peptide chain (COL17A1), encoded by the COL17A1 gene. In this article, COL17A1 protein can also refer to a multimer composed of COL17A1 protein; for example, when COL17A1 protein forms a trimer, it is type XVII collagen.

[0033] In this article, peptides, polypeptides, and proteins are not strictly distinguished and can be used interchangeably in some cases. Generally, peptides refer to polymers composed of amino acids linked by peptide bonds, whether naturally occurring or synthetic.

[0034] In this document, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases. When a polynucleotide encodes a protein or polypeptide, it optionally encodes either the sense or antisense strand. Polynucleotides can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably. In an optional embodiment, the polynucleotide is DNA.

[0035] In this document, the term "vector" refers to a delivery system that can operatively insert a genetic element (such as the aforementioned polynucleotide) into itself and enable the expression of that genetic element, for example, to produce a protein, RNA, or DNA encoded by that genetic element, or to replicate the genetic element. Vectors can be used to transform, transduce, or transfect host cells, enabling the expression of the genetic element they carry within the host cells. Examples of vectors include: plasmids, episome plasmids, microcircular DNA, phage particles, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC), bacteriophages such as λ phage or M13 phage, and animal viruses. Vectors may contain various elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain a replication initiation site. Vectors may also include components that facilitate their entry into the cell, including but not limited to viral particles, liposomes, or protein coats. Vectors can be expression vectors or cloning vectors. The vector may also include selection markers, such as, but not limited to, resistance genes and / or fluorescent protein genes.

[0036] In a first aspect, a method for preparing COL17A1 protein is provided, the method comprising expressing COL17A1 protein using HEK-293T cells and using EDIL3 protein signal peptide as the signal peptide of COL17A1 protein.

[0037] In this article, EDIL3 protein refers to epidermal growth factor-like repeats and discoidin I-like domains 3 (EDIL3), also known as developmental endothelial locus-1 (Del-1). EDIL3 is an extracellular matrix protein secreted by endothelial cells and contains a unique integrin ligand, which promotes angiogenesis.

[0038] HEK-293T cells (Human Embryonic Kidney 293T cells) are derived from human embryonic kidney cells and are commonly used as host cells for exogenous expression of target proteins. They possess advantages such as stable and high proliferation capacity and high transfection efficiency in vitro. This invention discovers that using the EDIL3 protein signal peptide as the signal peptide for the COL17A1 protein can significantly enhance the expression of COL17A1 protein in HEK-293T cells.

[0039] In an optional implementation, the COL17A1 protein is secreted and expressed in HEK-293T cells.

[0040] In an optional embodiment, the preparation method further includes the formation of type XVII collagen from COL17A1 protein secreted and expressed in HEK-293T cells.

[0041] In an optional embodiment, the amino acid sequence of the EDIL3 protein signal peptide is shown in SEQ ID NO.1.

[0042] SEQ ID NO. 1: MKRSVAVWLLVGLSLGVPQFGKG.

[0043] In an optional embodiment, the nucleotide sequence encoding the EDIL3 protein signal peptide is shown in SEQ ID NO.2.

[0044] SEQ ID NO.2:

[0045] atgaagcgctcggtagccgtctggctcttggtcgggctcagcctcggtgtcccccagttcggcaaaggt.

[0046] In an optional embodiment, the preparation method includes expressing a polynucleotide in HEK-293T cells, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the EDIL3 protein signal peptide and a sequence encoding the COL17A1 protein.

[0047] The sequences encoding the EDIL3 protein signal peptide and the sequences encoding the COL17A1 protein can be integrated or not integrated into the genome of HEK-293T cells.

[0048] In an optional embodiment, the preparation method includes: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and causing the HEK-293T cells to express COL17A1 protein.

[0049] In optional embodiments, those skilled in the art can introduce polynucleotides encoding the EDIL3 protein signal peptide and polynucleotides encoding the COL17A1 protein into HEK-293T cells in any known manner of introducing exogenous nucleic acids into cells, such as, but not limited to, liposome transfection, cationic polymer transfection, electroporation, microinjection, gene gun or viral vector-mediated transfection.

[0050] It is understood that those skilled in the art can culture the HEK-293T cells using any methods that are optional and known in the art, including optional and known culture media, culture environments, culture containers, and culture equipment.

[0051] In an optional embodiment, the preparation method further includes isolating, enriching and / or purifying recombinant HEK-293T cells expressing COL17A1 protein.

[0052] In an optional embodiment, the COL17A1 protein carries a His tag, and the preparation method further includes purifying the COL17A1 protein using a filler material modified with nickel ions.

[0053] The COL17A1 protein prepared by the method described in the first aspect includes wild-type COL17A1 protein or artificially modified COL17A1 protein. The artificial modification includes, but is not limited to, peptides or proteins mutated, truncated, or fused with other domains. The COL17A1 protein prepared by the method described in the first aspect can be a single chain or form a multimer; the present invention is not limited in this regard. For example, it can form a trimer, i.e., form type XVII collagen. Therefore, the preparation method provided in the first aspect of the present invention can also be a method for preparing type XVII collagen.

[0054] The COL17A1 protein prepared by the preparation method described in the first aspect can be a COL17A1 protein from any species in the art, such as a COL17A1 protein from mammals, including but not limited to humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, alpacas, poultry, goats, and sheep. In an optional embodiment, the COL17A1 protein prepared by the preparation method described in the first aspect is a human-derived COL17A1 protein. In an optional embodiment, the protein expressed by the preparation method is a COL17A1 protein encoded by the nucleotide sequence shown in SEQ ID NO. 7.

[0055] In a second aspect, a polynucleotide is provided, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the EDIL3 protein signal peptide and a sequence encoding the COL17A1 protein, respectively.

[0056] In an optional embodiment, the amino acid sequence of the EDIL3 protein signal peptide is shown in SEQ ID NO.1.

[0057] In an optional embodiment, the polynucleotide sequence encoding the EDIL3 protein signal peptide is shown in SEQ ID NO.2.

[0058] In an optional embodiment, the nucleotide sequence encoding the COL17A1 protein is shown in SEQ ID NO.8.

[0059] Thirdly, a carrier is provided that carries the polynucleotide described in the second aspect.

[0060] In an optional embodiment, the vector is a plasmid.

[0061] In an optional embodiment, the vector is an expression plasmid.

[0062] Fourthly, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T carries the polynucleotide described in the second aspect, or contains the vector described in the third aspect.

[0063] In an optional embodiment, the polynucleotide described in the second aspect may or may not be integrated into the genome of the recombinant HEK-293T cells.

[0064] In an optional embodiment, the recombinant HEK-293T cells contain a plasmid carrying the polynucleotides described in the second aspect.

[0065] Fifthly, a method for preparing the COL17A1 protein described in the first aspect, or the COL17A1 protein prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the application of the recombinant HEK-293T cells described in the fourth aspect in any one of (i) to (iii):

[0066] (i) Uses for promoting fibroblast adhesion, proliferation and / or migration for purposes other than diagnosis and treatment;

[0067] (ii) Use in the preparation of products for promoting fibroblast adhesion, proliferation and / or migration;

[0068] (iii) Application in the preparation of products for tissue regeneration or wound healing.

[0069] In an optional embodiment, (i) is used in the in vitro promotion of fibroblast adhesion, proliferation and / or migration.

[0070] Sixthly, a method for preparing the COL17A1 protein described in the first aspect, or the COL17A1 protein prepared by the method described in the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cells described in the fourth aspect, are provided for use in the preparation of regenerative medicine products, gene therapy products, skin disease treatment products, or anti-aging products.

[0071] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0072] Example 1

[0073] 1. The target gene was ligated into the pLV-CMV expression vector using seamless cloning, resulting in different signal peptide-linked COL17A1 gene expression plasmids. The plasmid maps are shown below. Figure 1 As shown, the nucleotide sequence encoding the signal peptide is linked to the 5' end of the COL17A1 gene, and the nucleotide sequence of the COL17A1 gene is shown in SEQ ID NO.7. COL17A1 is linked with a 6×His tag.

[0074] The sequences of the signal peptides are as follows:

[0075] Signal peptide A (EDIL3 protein signal peptide):

[0076] Amino acid sequence, SEQ ID NO.1: MKRSVAVWLLVGLSLGVPQFGKG;

[0077] Nucleotide sequence, SEQ ID NO.2:

[0078] atgaagcgctcggtagccgtctggctcttggtcgggctcagcctcggtgtcccccagttcggcaaaggt.

[0079] Signal peptide B (C3 protein signal peptide):

[0080] Amino acid sequence, SEQ ID NO.3: MGPTSGPSLLLLLLTHLPLALG;

[0081] Nucleotide sequence, SEQ ID NO.4:

[0082] atgggacccacctcaggtcccagcctgctgctcctgctactaacccacctcccctggctctgggg.

[0083] Signal peptide C (IGFBP6 protein signal peptide):

[0084] Amino acid sequence, SEQ ID NO.5: MTPHRLLPPLLLLLALLLAASPGGALA;

[0085] Nucleotide sequence, SEQ ID NO.6:

[0086] atgaccccccacaggctgctgccaccgctgctgctgctgctagctctgctgctcgctgccagcccaggaggcgccttggcg.

[0087] Three expression plasmids, each integrating a signal peptide and a type XVII collagen, were obtained and named pA-COL17A1, pB-COL17A1, and pC-COL17A1, respectively. The plasmid maps are shown below. Figure 1 As shown.

[0088] Example 2

[0089] Production and preparation of human type XVII collagen COL17A1 efficiently secreted and expressed by HEK-293T cells:

[0090] HEK-293T cells were seeded and plated one day in advance to ensure 80% confluence before transfection. For transfection, 20 μg of pA-COL17A1, pB-COL17A1, and pC-COL17A1 prepared in Example 1 were incubated with PEI transfection reagent to form transfection complexes. After incubation, the transfection complexes were added to the HEK-293T cell culture supernatant. The HEK-293T cell culture supernatant was collected, and the COL17A1 protein corresponding to the elution peak was eluted using a nickel ion affinity chromatography column. The COL17A1 protein formed a trimer, namely recombinant human type XVII collagen.

[0091] Example 3

[0092] Comparison of expression levels of COL17A1 protein linked by different signal peptides

[0093] The expression plasmids pA-COL17A1, pB-COL17A1, and pC-COL17A1 prepared in Example 1 were transfected into HEK-293T cells. Cell culture supernatant was collected 72 hours after transfection, and the expression level of COL17A1 was compared using Western blotting. The results are as follows: Figure 2 As shown, when the total protein loading amount per well was consistent, among the COL17A1 proteins linked by signal peptides A, B, and C, the COL17A1 protein linked by signal peptide A showed the highest expression level. Therefore, when expressing COL17A1 in HEK-293T cells, using signal peptide A to link COL17A1 yields the maximum expression level.

[0094] Example 4

[0095] Comparison of COL17A1 protein expression linked by signal peptide A in different mammalian cells:

[0096] The expression plasmid pA-COL17A1 constructed in Example 1 was transfected into HEK-293T and CHO cells, respectively, to compare its expression differences in different mammalian cell types. One day before transfection, HEK-293T and CHO cells were seeded into 6-well plates to achieve 80% confluence before transfection. During transfection, 2 μg of the constructed signal peptide A linked to the COL17A1 recombinant expression plasmid was incubated with PEI transfection reagent to form a transfection complex. After incubation, the transfection complex was added to the culture supernatant of HEK-293T and CHO cells, using the same amount of plasmid for both transfections. After transfection, the culture supernatant of HEK-293T and CHO cells was collected after 72 h, and the expression level of COL17A1 was compared using Western blotting. The results are as follows: Figure 3As shown, when the total protein loading amount per well was consistent, the expression level of the recombinant expression plasmid linking signal peptide A to COL17A1 in HEK 293T cells was significantly better than that in CHO cells. Therefore, using the recombinant plasmid linking signal peptide A to COL17A1 expressed in HEK-293T cells can efficiently secrete and express human type XVII collagen COL17A1.

[0097] Example 5

[0098] COL17A1 promotes fibroblast adhesion:

[0099] The COL17A1 protein prepared in Example 2 was dissolved in PBS to a protein solution of 1 mg / ml. For the cell adhesion assay in 96-well plates, 100 μl of COL17A1 protein solution was added to each well of the experimental group, and PBS solution was used for the negative group. The plates were coated overnight at 4°C, then incubated with 2% denaturing BSA for 1 h. The plates were then washed three times with serum-free medium to remove excess gel. Fibroblasts were digested, and 5000 cells were seeded in each well. A blank control (no cells, only medium) was added. The plates were incubated at 37°C for 2 h. After 2 h, the medium was removed from each well, and the cells were gently washed three times with PBS to remove non-adhered cells. 100 μl of medium containing 10% CCK-8 was added, and the plates were incubated at 37°C for another 2 h. The absorbance at 450 nm was measured using a microplate reader, and the cell adhesion rate was calculated. Results are as follows: Figure 4 As shown, the cell adhesion rate of the COL17A1 protein-coated well plate prepared in Example 2 was significantly higher than that of the well plate coated with PBS solution.

[0100] Example 6

[0101] COL17A1 promotes fibroblast proliferation:

[0102] The COL17A1 protein obtained in Example 2 was diluted with DMEM basal medium to the following concentrations: 4 μg / ml, 2 μg / ml, 1 μg / ml, 0.5 μg / ml, 0.25 μg / ml, 0.125 μg / ml, 0.0625 μg / ml, and 0 μg / ml (i.e., without COL17A1 protein). The sample group consisted of the above-mentioned diluted COL17A1, while the blank control group used DMEM basal medium. Each group was configured with three replicates. One day prior to the test, fibroblasts were seeded into 96-well plates at 2000 cells per well, with no cells seeded in the outer wells. PBS was added to prevent the inner medium from drying out. Cells were incubated overnight at 37°C. Each cell group was then incubated with a series of diluted COL17A1 protein concentrations and DMEM basal medium, and cultured for another 48 hours. After 48 hours, the culture medium in each well was removed, the cells were washed three times with PBS, and culture medium containing 10% CCK-8 was added. The cells were then incubated at 37°C for another 2 hours, and the absorbance at 450 nm was measured using a microplate reader. Results are as follows: Figure 5 As shown, fibroblast proliferation activity gradually increases with increasing COL17A1 protein concentration.

[0103] Example 7

[0104] COL17A1 promotes fibroblast migration:

[0105] COL17A1 protein was dissolved in DMEM to a concentration of 1 mg / ml. In 12-well plates, the experimental group was coated with 500 μl of COL17A1 protein solution for 2 hours, while the negative control group was coated with DMEM without COL17A1. After coating each well, horizontal lines were evenly drawn on the back of the 12-well plate using a marker and a ruler. Fibroblasts in the logarithmic growth phase were then digested and counted. 3 x 10T cells were seeded per well. 5 After cell adhesion was achieved, the confluence reached 100%. On the second day after plating, the cells were scratched vertically along the bottom horizontal line of the plate using a 200 μl pipette tip. After scratching, the cells were cleaned three times with PBS, and 1 ml of complete culture medium was added. The cells were then cultured at 37°C, and observed and photographed at 0 h, 6 h, and 24 h. The results are as follows: Figure 6 As shown, the area of ​​the scratch in the well plate coated with COL17A1 protein decreased significantly over time, and the wound healing rate was greater than that of fibroblasts without COL17A1 coated plate.

[0106] The nucleotide sequence of SEQ ID NO.7 is as follows:

[0107]

[0108] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing COL17A1 protein, characterized in that, This includes using HEK-293T cells to express COL17A1 protein, with the EDIL3 protein signal peptide as the signal peptide for COL17A1 protein; The amino acid sequence of the EDIL3 protein signal peptide is shown in SEQ ID NO.1; The nucleotide sequence encoding the EDIL3 protein signal peptide is shown in SEQ ID NO.

2.

2. The preparation method according to claim 1, characterized in that, The preparation method includes expressing a polynucleotide in HEK-293T cells, wherein the polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the EDIL3 protein signal peptide and a sequence encoding the COL17A1 protein.

3. The preparation method according to claim 2, characterized in that, The preparation method includes: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and causing the HEK-293T cells to express COL17A1 protein.

4. The preparation method according to any one of claims 1 to 3, characterized in that, COL17A1 protein is secreted and expressed in HEK-293T cells.

5. The preparation method according to claim 4, characterized in that, The preparation method also includes the formation of type XVII collagen from COL17A1 protein secreted and expressed in HEK-293T cells.

6. A polynucleotide, characterized in that, The polynucleotide contains, from the 5' end to the 3' end, a sequence encoding the EDIL3 protein signal peptide and a sequence encoding the COL17A1 protein, respectively. The amino acid sequence of the EDIL3 protein signal peptide is shown in SEQ ID NO.

1.

7. The polynucleotide according to claim 6, characterized in that, The polynucleotide sequence encoding the EDIL3 protein signal peptide is shown in SEQ ID NO.

2.

8. The polynucleotide according to claim 6, characterized in that, The nucleotide sequence encoding the COL17A1 protein is shown in SEQ ID NO.

7.

9. A carrier, characterized in that, The vector carries the polynucleotide as described in any one of claims 6 to 8.

10. Recombinant HEK-293T cells, characterized in that, The recombinant HEK-293T cells carry the polynucleotides according to any one of claims 6 to 8, or contain the vector according to claim 9.

11. The use of the polynucleotide of any one of claims 6 to 8, or the vector of claim 9, or the recombinant HEK-293T cells of claim 10 in the preparation of products for tissue regeneration or wound healing.

Citation Information

Patent Citations

  • Gene therapy for the regeneration of chondrocytes or cartilage type cells

    CN105636614A

  • Signal peptide and application thereof

    CN116102625A