A method for treating phosphorus-containing sewage

Abstract

The present application relates to the technical field of biotechnology sewage treatment, and particularly relates to a treatment method of phosphorus-containing sewage. The method comprises the following steps: 1) adjusting the pH value of the phosphorus-containing sewage to 7.0-7.5, and supplementing sodium acetate and ammonium salt to the concentrations of 0.1-0.2 g / L and 0.01-0.04 g / L respectively; 2) inoculating polyphosphorus bacteria in the above sewage, and the inoculation concentration is 2-5%; 3) detecting the phosphorus pollutants in the sewage, and discharging the sewage after meeting the sewage discharge standard. The present application improves the level of polyphosphoric acid in the microbial body, which is improved by 87.6% compared with the wild type; after introducing the RcsA gene, the production of the capsule is obviously improved, and the content of phosphorus in the sewage with severe phosphorus pollution is reduced to 8.4 mg / L, which lays a foundation for its use in business.

Description

Technical Field

[0001] This invention relates to the technical field of biotechnology for wastewater treatment, and more particularly to a method for treating phosphorus-containing wastewater. Background Technology

[0002] Eutrophication refers to the phenomenon where water bodies transition from an oligotrophic to an eutrophic state. It occurs when excessive nutrients in lakes, reservoirs, rivers, and even nearshore oceans lead to the proliferation of algae and aquatic plants, resulting in water quality deterioration. The main nutrients are nitrogen and phosphorus. Since phosphorus is a limiting factor for algal growth, controlling phosphorus emissions is more practically significant than controlling nitrogen emissions. Currently, the most widely used phosphorus removal methods both domestically and internationally are physicochemical methods, but these still have various problems, primarily incomplete phosphorus removal and secondary pollution caused by the added chemicals used in phosphorus removal processes. With the discovery of polyphosphate-accumulating microorganisms, the treatment of phosphorus-containing wastewater using microorganisms has become possible, and research on microbial polyphosphate accumulation has become a hot topic.

[0003] In recent years, an increasing number of genera of bacteria have been identified as polyphosphate-accumulating bacteria, and microbial strains with good polyphosphate-accumulating effects have been continuously isolated. At the same time, with further research on the polyphosphate-accumulating mechanism of polyphosphate-accumulating bacteria, in addition to great achievements in obtaining highly efficient polyphosphate-accumulating bacteria, some progress has also been made in the construction of recombinant strains of highly efficient polyphosphate-accumulating bacteria. The main focus is on preparing recombinant strains by overexpressing polyphosphate kinase or introducing polyphosphate kinase encoding genes.

[0004] Currently, microbial phosphorus removal still faces the following problems: polyphosphatase activity is not high enough, and the accumulation level of polyphosphate in bacteria is relatively low; in addition, polyphosphate-accumulating microorganisms have polyphosphate esterases that decompose polyphosphate, and once the polyphosphate in bacteria reaches a certain level, it reaches saturation, and there is a risk that the accumulated polyphosphate will be released again.

[0005] Therefore, those skilled in the art are dedicated to genetically modifying existing microorganisms to increase their levels of polyphosphate accumulation and enhance their ability to remove phosphorus pollutants. Summary of the Invention

[0006] In view of the above-mentioned deficiencies of the prior art, the technical problem to be solved by the present invention is how to improve the ability of polyphosphate-accumulating bacteria to remove phosphorus pollutants in order to treat phosphorus-containing wastewater.

[0007] To achieve the above objectives, the present invention provides a method for treating phosphorus-containing wastewater, comprising the following steps:

[0008] 1) Adjust the pH of the phosphorus-containing wastewater to 7.0-7.5, and supplement sodium acetate and ammonium salt to concentrations of 0.1-0.2 g / L and 0.01-0.04 g / L, respectively;

[0009] 2) Inoculate the above-mentioned wastewater with polyphosphate-accumulating bacteria at a concentration of 2-5%;

[0010] 3) Test the phosphorus pollutants in the wastewater. Once the wastewater meets the discharge standards, it will be discharged.

[0011] Preferably, the polyphosphate-accumulating bacteria are filtered using a 0.45 μm filter membrane before the wastewater is discharged.

[0012] Preferably, the polyphosphate-accumulating bacteria are introduced into an expression vector of PPK enzyme or a variant thereof, which significantly enhances the engineered bacteria's ability to accumulate polyphosphate.

[0013] Preferably, the amino acid sequence of the PPK enzyme is shown in SEQ NO ID: 1.

[0014] Preferably, the mutation sites of the PPK enzyme variant are A257, E351, D379, and A421.

[0015] Preferably, the PPK enzyme variant is one in which negatively charged amino acids at sites A257, E351, D379, and A421 are mutated to positively charged amino acids.

[0016] Preferably, the PPK enzyme variant is A257K, E351R, D379K, or A421H.

[0017] Preferably, the amino acid sequence of the PPK enzyme variant is shown in SEQ NO ID: 3-6.

[0018] Preferably, the polyphosphate-accumulating bacteria also incorporates the RcsA gene.

[0019] Preferably, the RcsA gene is derived from... Klebsiella pneumoniae , Salmonella enterica , Providencia alcalifaciens、Enterobacter hormaechei .

[0020] Preferably, the amino acid sequence of the protein encoded by the RcsA gene is shown in SEQ NO ID: 7-10.

[0021] Preferably, the polyphosphate-accumulating bacteria include eukaryotes and prokaryotes.

[0022] Preferably, the polyphosphate-accumulating bacteria comprises prokaryotic bacteria.

[0023] Preferably, the polyphosphate-accumulating bacteria are E. coli BL21(DE3) .

[0024] In a preferred embodiment of the present invention, the present invention provides a microbial agent for treating phosphorus-containing wastewater, comprising polyphosphate-accumulating bacteria, wherein the polyphosphate-accumulating bacteria are introduced into an expression vector of PPK enzyme or a variant thereof, the amino acid sequence of the PPK enzyme variant being shown in SEQ NO ID: 3-6.

[0025] Preferably, the polyphosphate-accumulating bacteria are also introduced with the RcsA gene, the amino acid sequence of the protein encoded by the RcsA gene being shown in SEQ NO ID: 7-10.

[0026] This invention modifies microorganisms, significantly increasing the level of polyphosphates in the cells by 87.6% compared to the wild type. The introduction of the RcsA gene significantly improves capsule yield and reduces the phosphorus content in heavily phosphorus-contaminated wastewater to 8.4 mg / L, laying the foundation for its commercial use.

[0027] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0028] Figure 1 This is the result of detecting the in vivo polyphosphate level of the PPK enzyme mutant recombinant expression strain;

[0029] Figure 2 This is a bar chart showing the growth rate of capsule weight of WT, E. coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se, E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh after 1 day of culture;

[0030] Figure 3 The results show the phosphorus removal capacity of E. coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se, E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh for heavily phosphorus-contaminated wastewater. Detailed Implementation

[0031] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0032] The enzymes used in this invention embodiment are: Taq DNA polymerase, ScaI restriction endonuclease, and T4 DNA ligase, all purchased from Takara Bio Engineering (Dalian) Co., Ltd.; lysozyme purchased from Tiangen Biotech Co., Ltd.; L-arabinose, ampicillin, and kanamycin purchased from Sangon Biotech (Shanghai) Co., Ltd.; and E. coli BL21(DE3), plasmid pET-30a(+), and plasmid pET-28a(+), purchased from Novagen.

[0033] Example 1 Cloning and Molecular Construction of PPK Gene

[0034] PPK enzyme is Escherichia coli (GenBank: EHC8202420.1) Codon optimization was performed on the encoding nucleotide sequence of the PPK enzyme to obtain the PPK gene clone, the nucleotide sequence of which is shown in SEQ NO ID: 2. Restriction endonuclease sites were added to the forward primer during primer design. Hindi III. Add restriction endonuclease sites to the reverse primer. Bam HI, primers F (5'-3') (CGGGATCCCAAAATGGGCCAGGAAAAACTGT) / R (5'-3') (CCCAAGCTTAAATTATTCCGGCTGTTCCAGG) were designed based on the PPK gene sequence to amplify the target gene PPK using genomic DNA as a template.

[0035] The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 45 sec; 60℃ annealing for 30 sec; 72℃ extension for 2 min; 30 cycles; and a final extension at 72℃ for 10 min. The enzyme used for PCR was Pyrobest. TM DNA polymerase.

[0036] The PCR amplification products were detected by 1% agarose gel electrophoresis, and then the PCR products were ligated into the pET28a vector.

[0037] Example 2 Construction of PPK enzyme mutants and recombinant expression strains

[0038] Based on the amino acid profile, a group of negatively charged amino acids, A257, E351, D379, and A421, that may affect the spatial structure of PPK enzyme were screened. These amino acids were mutated to produce variants A257K, E351R, D379K, and A421H. Site-directed mutagenesis was used to obtain the nucleotide sequences muA257K, muE351R, muD379K, and muA421H. The wt amino acid and its variants were successfully cloned into the plasmid pET-30a(+). During plasmid construction, six His tags were added to the N-terminus of each gene. The successfully constructed recombinant plasmids were transformed into *E. coli* BL21(DE3) / pET-30a(+)-WT, *E. coli* BL21(DE3) / pET-30a(+)-muA257K, and *E. coli* BL21(DE3) / pET-30a(+)-muA257K, respectively. BL21(DE3) / pET-30a(+)-muE351R, E.coli BL21(DE3) / pET-30a(+)-muD379K, E.coli BL21(DE3) / pET-30a(+)-muA421H.

[0039] Example 3: Detection of polyphosphate levels in vivo

[0040] A single colony of the strain constructed in Example 2 was inoculated into 10 ml of LB liquid culture medium and cultured at 37°C for 12 hours. A 1% inoculum was then added to 50 ml of LB liquid culture medium and cultured until the OD600 reached approximately 0.8. IPTG was added, and the culture was continued at 16°C for 16 hours. Cells were washed three times with PBS, centrifuged to collect the cells, resuspended in lysis buffer, and lysed for 10 minutes. After elution, separation, and removal of impurities, the precipitate yielded protein. The obtained protein was then degraded using polyphosphatase PPX1 and incubated at 37°C for 20 minutes. The content of free phosphate was detected using the malachite green colorimetric method. Figure 1 As shown, muA257K and muE351R showed a certain increase in polyphosphate levels compared to the wt type, while muD379K showed a slight decrease in polyphosphate levels compared to the wt type. This mutant failed to improve the accumulation of polyphosphate in the cells. muA421H showed the most significant increase in polyphosphate levels compared to the wt type, increasing the accumulation of polyphosphate to 87.6%, reaching 7.6 polyphosphate / protein (µmol / g).

[0041] In the experiment, the applicant found that after 3 days of culture, the polyphosphate level in the strain constructed in Example 2 no longer accumulated and reached saturation. This greatly limited the ability of the strain to further remove phosphorus pollutants. Polyphosphate is an important component of the capsule of Escherichia coli. If a large amount of polyphosphate can be converted into capsule and stored, the ability of the strain to purify phosphorus pollutants will be significantly enhanced.

[0042] The expression of the bacterial capsule is regulated by genes expressing the EPS gene cluster. The intracellular RcsC-RcsB two-signal transduction system activates the EPS gene cluster. RcsC is a sensor kinase, a transmembrane protein located on the cell membrane that responds to environmental signals. A histidine residue on RcsC is autophosphorylated, and through a series of phosphate relay systems, the phosphoryl group is transferred to the response regulatory protein—RcsB, making it an active transcriptional regulatory protein, which in turn regulates the expression of the EPS gene cluster. The applicant further investigated the regulatory factors that can enhance EPS expression. After screening, RcsA from different species was selected to explore its role in regulating EPS expression and its impact on the ability to purify phosphorus pollutants.

[0043] Example 4: Cloning of the RcsA gene and construction of recombinant strains

[0044] Will Klebsiella pneumoniae , Salmonella enterica , Providence alcalifaciens、Enterobacter hormaechei The RcsA gene clone was inserted into plasmid pET-32a(+), and the resulting plasmids were then introduced into E. coli BL21(DE3) / pET-30a(+)-muA421H in Example 2, denoted as E. coliBL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se, E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa, and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh, respectively. Klebsiella pneumoniae , Salmonella enterica , Providencia alcalifaciens, Enterobacter hormaechei The amino acid sequence of the RcsA protein encoded by the RcsA gene is shown in SEQ NO ID: 7-10.

[0045] E. coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se, E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh were cultured for 1 day as described in Example 3, and the weight of their capsules was measured.

[0046] like Figure 2As shown, after introducing the RcsA gene, the capsule weight of E. coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh showed no significant change after 1 day of culture, while the capsule weight of the E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa group increased by 21.5%.

[0047] Furthermore, to test the purification effect of Example 4 on phosphorus pollutants, 100 mg / L of phosphate was added to the bacterial culture medium, and the recombinant strain prepared in Example 4 was cultured for 3 days. The concentration of phosphate in the culture medium was then measured. Figure 3 As shown, the phosphate concentration in the culture medium treated with E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa decreased to 8.4 mg / L.

[0048] Example 5: Phosphorus-containing wastewater treatment process

[0049] Adjust the pH of the phosphorus-containing wastewater to 7.0-7.5, and supplement sodium acetate and ammonium salt to concentrations of 0.1-0.2 g / L and 0.01-0.04 g / L, respectively;

[0050] The polyphosphate-accumulating bacteria (E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa) prepared in Example 4 were inoculated into the above-mentioned wastewater at an inoculation concentration of 2-5%.

[0051] After testing the phosphorus pollutants in the wastewater and confirming that they meet the discharge standards, the polyphosphate-accumulating bacteria are filtered through a 0.45μm filter membrane before the wastewater is discharged.

[0052] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A phosphorus-containing sewage treatment method, comprising the following steps: 1) adjusting the pH value of the phosphorus-containing sewage to 7.0-7.5, and supplementing sodium acetate and ammonium salt to the concentrations of 0.1-0.2 g / L and 0.01-0.04 g / L, respectively; 2) inoculating the above sewage with polyphosphate-accumulating bacteria at an inoculation concentration of 2-5%; 3) detecting the phosphorus pollutants in the sewage, and discharging the sewage after meeting the discharge standard. The polyphosphate-accumulating bacteria are introduced with an expression vector of a PPK enzyme variant, and the PPK enzyme variant significantly improves the accumulation capacity of the engineered bacteria for polyphosphate. The amino acid sequence of the PPK enzyme is shown in SEQ NO ID: 1, and the PPK enzyme variant is A257K, E351R or A421H. The polyphosphate-accumulating bacteria are further filtered with a 0.45 μm filter membrane before discharging the sewage. The amino acid sequence of the PPK enzyme variant is shown in SEQ NO ID: 3, 4 or 6. Providencia alcalifaciens 2. The method of claim 1, wherein, The amino acid sequence of the protein encoded by the RcsA gene is shown in SEQ NO ID:

9.

3. The method of claim 1, wherein, E.coli BL21(DE3) 4. The method of claim 3, wherein, The said phosphobacteria also introduced RcsA gene, the said RcsA gene is from 7. A bacterial agent for phosphorus-containing sewage treatment, comprising polyphosphate-accumulating bacteria introduced with an expression vector of a PPK enzyme variant, and the amino acid sequence of the PPK enzyme variant is shown in SEQ NO ID: 3, 4 or 6. .

5. The method of claim 4, wherein, The polyphosphate-accumulating bacteria are further introduced with an RcsA gene, and the amino acid sequence of the protein encoded by the RcsA gene is shown in SEQ NO ID:

9.

6. The method of claim 1, wherein, The polyphosphorus bacteria are ​ . ​ 8. The bacterial agent of claim 7, characterized in that, ​

Images