Dual vector system for delivery of Otof gene and use thereof

By delivering the OTOF gene through a dual-vector system, the problem of adeno-associated virus vector packaging limitations was solved, and effective expression of the OTOF protein and restoration of hearing function were achieved, with significant recovery of hearing in some frequency bands.

CN120641570APending Publication Date: 2025-09-12OTOVIA THERAPEUTICS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202580000485.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-03-28
Filing Date
2025-03-25
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

Existing adeno-associated virus vectors cannot effectively deliver large genes larger than 4.5Kb, such as the Otof gene, which limits gene therapy for Otof-related deafness.

Method used

A dual-vector system is used, including a first nucleic acid vector and a second nucleic acid vector, which carry the N-terminal and C-terminal coding sequences of OTOF respectively, and express the OTOF protein in host cells through homologous recombination technology, breaking through the packaging limitations of a single AAV vector.

Benefits of technology

The effective delivery and expression of OTOF genes larger than 4Kb were achieved, hearing function was restored, hearing in some frequency bands was significantly restored, and the limitations of cochlear implants were resolved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BSB0000211045950000181
    Figure BSB0000211045950000181
  • Figure BSB0000211045950000182
    Figure BSB0000211045950000182
  • Figure BSB0000211045950000191
    Figure BSB0000211045950000191
Patent Text Reader

Abstract

The present invention relates to a dual vector system for expressing OTOF protein, comprising a first nucleic acid vector and a second nucleic acid vector wherein the first nucleic acid vector comprises a first nucleotide sequence; the second nucleic acid vector comprises a second nucleotide sequence; the first nucleotide sequence comprises an expression cassette inserted between two first ITR sequences; the second nucleotide sequence comprises an expression cassette inserted between two second ITR sequences; the expression cassette of the first nucleotide sequence comprises a promoter, an N-terminal coding sequence of OTOF, a splicing donor sequence, a sequence subjected to homologous recombination with a second nucleotide sequence and polyA; the expression box of the second nucleotide sequence comprises a promoter, a sequence which is subjected to homologous recombination with the first nucleotide sequence, a shear acceptor sequence, a C-terminal coding sequence of OTOF and polyA. The invention also relates to a packaging carrier system of the adeno-associated virus, a packaging method of the adeno-associated virus and the adeno-associated virus obtained by the method. The dual-vector system for expressing the OTOF protein or the adeno-associated virus can be used for treating autosomal recessive hereditary hearing loss related to OTOF mutation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a two-vector system for delivering large genes exceeding 5 Kb and its use in gene therapy, in particular in the treatment of hearing loss. Background Art

[0002] Deafness is the most common disabling disease in clinical practice, severely impacting normal human life and placing a significant burden on society. According to the WHO, nearly 1.5 billion people worldwide have varying degrees of hearing loss, and 466 million, or 5% of the total population, suffer from disabling hearing loss, including 34 million children. It is estimated that by 2050, 2.5 billion people worldwide will suffer from varying degrees of hearing loss, with 700 million suffering from disabling hearing loss.

[0003] Heredity and environment are the two main contributing factors to deafness. Environmental factors are primarily related to various environmental factors or complications, such as the use of ototoxic drugs, infections during pregnancy, neonatal hypoxia, and radiation exposure. Genetic factors, on the other hand, are primarily due to individual genetic defects in hearing loss, leading to varying degrees of hearing loss. The pathogenic genes are passed on to the next generation through various genetic pathways, can occur at any age, and the effects are permanent. Heredity is a major cause of deafness, accounting for approximately 60% of deafness. Currently, over 120 genes associated with deafness have been identified, involving over 1,500 pathogenic variants. To date, there are no clinically available drugs to treat hereditary deafness.

[0004] Based on the presence of clinical symptoms affecting organs other than the auditory system, hereditary hearing loss can be divided into syndromic hearing loss (SHL) and non-syndromic hearing loss (NSHL). Syndromic hearing loss (SHL) is often accompanied by clinical manifestations in other systems, including the eyes, heart, kidneys, nervous system, skin, and bones, and accounts for 30% of hereditary hearing loss. Among SHL, Pendred syndrome, Usher syndrome (USH), and Waardenburg syndrome (WS) are the most well-known. In preclinical animal models, USH, Pendred syndrome, and Jervell and Lange-Nielsen syndrome (JLNS) have been successfully treated with inner ear gene therapy. There are four types of non-syndromic hearing loss (NSHL): autosomal dominant (DFNA), autosomal recessive (DFNB), X-linked (DFNX), and mitochondrial non-syndromic hearing loss. Approximately 70% of patients with hereditary hearing loss have the non-syndromic type. The most common mode of inheritance for NSHL is autosomal recessive inheritance (75%-80%), followed by autosomal dominant inheritance (20%), X-linked inheritance (<2%), and mitochondrial inheritance (<1%). To date, more than 120 genes have been reported to be associated with NSHL, among which auditory neuropathy spectrum disorder (ANSD) caused by mutations in the Otof gene is a common non-syndromic recessive hereditary hearing loss disorder. More than 1,000 pathogenic mutations in this gene have been reported.

[0005] Each type of deafness is described according to the naming principles of the deafness gene. For example, DFNA1 is the first autosomal dominant deafness type discovered. DFNB9 is the ninth autosomal recessive non-syndromic deafness described, caused by a mutation in the Otof gene. The Otof gene is located on human chromosome 2p23.3, with a total length of 101,496 bp and 48 exons. It encodes otoferlin (also known as "OTOF protein"). The OTOF protein is a calcium ion sensor containing 1,997 amino acids, including 6 C2 domains that bind calcium ions and is mainly involved in Ca 2+Synaptic vesicle fusion and neurotransmitter release in related inner hair cells. The Otof gene has a total of five transcripts, which are expressed in both the inner ear and the brain. In the brain, there are two OTOF transcripts, which terminate in exon 47 or 48; in the cochlea, there is only one transcript, which terminates in exon 48. The OTOF protein encoded by the Otof gene is concentrated in the basolateral part of the inner hair cells of the cochlea and is an important component of the presynaptic membrane structure of the inner hair cells. The OTOF protein triggers membrane fusion at the ribbon synapses of the inner hair cells and plays an important role in the exocytosis of synaptic vesicles related to calcium ions.

[0006] The deafness phenotype caused by OTOF gene mutations is auditory neuropathy (AN), also known as auditory neuropathy spectrum disorder (ANSD). In this disease, except for the inability to release synaptic vesicles from inner hair cells, the survival and function of hair cells are not affected. Clinical manifestations include language comprehension disorders and normal or severely impaired thresholds for auditory brainstem responses. During audiological testing, the auditory brainstem response does not have a clearly differentiated waveform or severe abnormalities, but because hair cells function normally, otoacoustic emissions and cochlear microphonic potentials can be elicited normally.

[0007] Because this mutation does not directly affect the activity of spiral ganglion neurons, cochlear implants are currently the only effective treatment option for hearing aid failure. Although cochlear implants are effective for patients with OTOF gene mutations, with only 300,000 patients worldwide receiving cochlear implants, the audience for cochlear implants is only a small fraction of deaf patients. Cochlear implants have low frequency sensitivity, and difficulties in speech discrimination and perception in noisy environments still cannot meet the normal life needs of patients. In addition, as a prosthetic device that accompanies the patient throughout their life, special care must be taken during use.

[0008] Gene therapy refers to a method of correcting, compensating for, or inhibiting defective genes at the DNA or RNA level, thereby allowing the subject to recover from diseases caused by abnormal nucleic acid sequences or expressions in the body, thereby achieving the purpose of treating the disease. As an emerging treatment strategy, gene therapy has great application prospects in hereditary hearing loss. Currently, most gene therapies require vector delivery, and adeno-associated virus (AAV) is one of the safe and efficient delivery vectors with a packaging capacity of approximately 4.5Kb. However, due to the 6kb length of the coding region of the Otof gene, together with the related regulatory elements, the expression of the Otof gene is limited by the packaging of the AAV vector.

[0009] The use of a dual-vector system (eg, a dual AAV vector system) to deliver large gene sequences (eg, genes larger than 4 kB, such as the Otof gene) can overcome the gene size limitation of a single AAV vector. SUMMARY OF THE INVENTION

[0011] It is an object of the present invention to provide gene therapy for a subject suffering from, for example, DFNB9 hearing loss, thereby preventing and / or restoring hearing in the subject.

[0012] In a first aspect, the present invention provides a two-vector system for delivering large gene sequences (e.g., genes larger than 4 kB; such as OTOF genes), comprising a first nucleic acid vector and a second nucleic acid vector, wherein:

[0013] The first nucleic acid vector comprises a first nucleotide sequence; and the second nucleic acid vector comprises a second nucleotide sequence;

[0014] The first nucleotide sequence comprises an expression cassette inserted between two first ITR sequences;

[0015] The second nucleotide sequence comprises an expression cassette inserted between two second ITR sequences;

[0016] The expression cassette of the first nucleotide sequence comprises a promoter, an N-terminal coding sequence of OTOF, a splice donor (SD) sequence, a sequence for homologous recombination with the second nucleotide sequence, and polyA;

[0017] The expression cassette of the second nucleotide sequence comprises a promoter, a sequence that undergoes homologous recombination with the first nucleotide sequence, a splice acceptor (SA) sequence, a C-terminal coding sequence of OTOF, and polyA; and

[0018] An OTOF cleavage site is provided in the OTOF amino acid sequence, for example, the OTOF amino acid sequence is as shown in SEQ ID NO: 1 or a functional fragment thereof, for example, an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1;

[0019] The N-terminal coding sequence of OTOF is the nucleotide coding sequence from the N-terminus of the OTOF amino acid sequence to the OTOF cleavage site; the C-terminal coding sequence of OTOF is the nucleotide coding sequence from the amino acid after the OTOF cleavage site to the C-terminus of the OTOF amino acid sequence.

[0020] In some embodiments, the OTOF cleavage site is located at the 3' terminal amino acid residue of any one of exons 17-29 in the OTOF amino acid sequence.

[0021] In some embodiments, in the dual-vector system for expressing OTOF protein of the present invention, the promoter of the expression cassette of the first nucleotide sequence or the second nucleotide sequence is selected from CAG promoter, CMV promoter, CBA promoter, UbC promoter, SFFV promoter, EF1α promoter, PGK promoter, or promoters of Myo7A, Myo15, Atoh1, POU4F3, Lhx3, Myo6, α9AchR, α10AchR, OTOF and STRC encoding genes;

[0022] In some embodiments, in the binary vector system for expressing OTOF protein of the present invention, the poly A of the expression cassette of the first nucleotide sequence or the second nucleotide sequence comprises AATAAA (SEQ ID NO: 68) and variants of AATAAA; the variants of AATAAA comprise ATTAAA (SEQ ID NO: 69), AGTAAA (SEQ ID NO: 70), CATAAA (SEQ ID NO: 71), TATAAA (SEQ ID NO: 72), GATAAA (SEQ ID NO: 73), ACTAAA (SEQ ID NO: 74), AATATA (SEQ ID NO: 75), AAGAAA (SEQ ID NO: 76), AATAAT (SEQ ID NO: 77), AAAAAA (SEQ ID NO: 78), AATGAA (SEQ ID NO: 79), AATCAA (SEQ ID NO: 80), AACAAA (SEQ ID NO: 81), AATCAA (SEQ ID NO: 82), AATAAC (SEQ ID NO: 83), AATAGA (SEQ ID NO: 84), AATTAA (SEQ ID NO: 85), NO: 85) or AATAAG (SEQ ID NO: 86); for example, the polyA is a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the poly A signal sequence shown in SEQ ID NO: 62 or SEQ ID NO: 65; and each of the two first ITR sequences and the two second ITR sequences is derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9.

[0023] In some embodiments, in the dual-vector system for expressing OTOF protein of the present invention, the expression cassette of the first nucleotide sequence or the second nucleotide sequence further comprises an expression regulatory element and / or a tag element, for example, the expression regulatory element is a woodchuck hepatitis posttranscriptional regulatory element (WPRE) or a variant thereof, preferably a WPRE truncated variant, for example, a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with the nucleotide sequence shown in SEQ ID NO: 61, for example, the nucleotide sequence shown in SEQ ID NO: 64; for example, the tag element is HA.

[0024] In some embodiments, in the binary vector system for expressing an OTOF protein of the present invention, the sequence that undergoes homologous recombination with the first nucleotide sequence and the sequence that undergoes homologous recombination with the second nucleotide sequence are intron sequences, for example, intron sequences that do not naturally exist in the genomic sequence of the gene encoding the OTOF protein.

[0025] In some embodiments, in the dual-vector system for expressing OTOF protein of the present invention, the sequence that undergoes homologous recombination with the first nucleotide sequence and the sequence that undergoes homologous recombination with the second nucleotide sequence are intron sequences, for example, the intron sequence is the recombination-causing AK sequence of F1 phage, such as the sequence shown in SEQ ID NO: 6.

[0026] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the first nucleotide sequence is inserted into a plasmid comprising two first ITR sequences, and the second nucleotide sequence is inserted into a plasmid comprising two second ITR sequences, for example, the plasmid comprising two first ITR sequences and the plasmid comprising two second ITR sequences are the same or different, for example, the plasmid is pAAV, pAAV-CMV, pX601, pX551 or pAAV-MCS plasmid.

[0027] In some embodiments, in the binary vector system for expressing the OTOF protein of the present invention, the OTOF N-terminus and the OTOF C-terminus cleaved by the OTOF cleavage site are as shown in Table 1A.

[0028] In some specific embodiments, in the binary vector system for expressing the OTOF protein of the present invention, the OTOF cleavage site is located between the amino acid residue encoded by exon 20 and the amino acid residue encoded by exon 21;

[0029] The OTOF cleavage site is located between the amino acid residues encoded by exon 21 and the amino acid residues encoded by exon 22;

[0030] The OTOF cleavage site is located between the amino acid residues encoded by exon 22 and the amino acid residues encoded by exon 23;

[0031] The OTOF cleavage site is located between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24; or

[0032] The OTOF cleavage site is located between the amino acid residues encoded by exon 29 and the amino acid residues encoded by exon 30.

[0033] In some preferred embodiments, in the dual-vector system for expressing the OTOF protein of the present invention, the OTOF N-terminal coding sequence is SEQ ID NO: 11 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 37, and the OTOF C-terminal coding sequence is SEQ ID NO: 24 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 50;

[0034] The OTOF N-terminal coding sequence is SEQ ID NO: 12 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 38, and the OTOF C-terminal coding sequence is SEQ ID NO: 25 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 51;

[0035] The OTOF N-terminal coding sequence is SEQ ID NO: 13 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 39, and the OTOF C-terminal coding sequence is SEQ ID NO: 26 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 52;

[0036] The OTOF N-terminal coding sequence is SEQ ID NO: 14 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 40, and the OTOF C-terminal coding sequence is SEQ ID NO: 27 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 53; or

[0037] The OTOF N-terminal coding sequence is SEQ ID NO: 20 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 46, and the OTOF C-terminal coding sequence is SEQ ID NO: 33 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 59.

[0038] In some embodiments, in the dual-vector system for expressing OTOF protein of the present invention, pAAV-CMV plasmid is used as a vector.

[0039] In some embodiments, in the dual-vector system for expressing OTOF protein of the present invention, the splice donor (SD) sequence consists essentially of the sequence shown in SEQ ID NO: 4; the splice acceptor (SA) sequence consists essentially of the sequence shown in SEQ ID NO: 5.

[0040] In some embodiments, in the dual-vector system for expressing OTOF protein of the present invention, the expression cassette of the first nucleotide sequence and the expression cassette of the second nucleotide sequence each comprise a combination of a WPRE nucleotide sequence and an SV40 polyadenylation sequence at the N-terminus of the 3'ITR sequence, for example, a nucleotide sequence shown in SEQ ID NO: 60 or a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 60; or a combination of a WPRE3 nucleotide sequence and an SV40 late polyadenylation sequence, for example, a nucleotide sequence shown in SEQ ID NO: 63 or a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 63.

[0041] In the second aspect, the present invention provides an adeno-associated virus packaging vector system, which comprises the dual-vector system for expressing the OTOF protein described in the first aspect of the present invention, a vector carrying the AAV rep and cap genes, and a helper virus vector, which are packaged into an AAV vector. Preferably, the amino acid sequence of the OTOF protein is as shown in SEQ ID NO: 1.

[0042] In some embodiments, in the adeno-associated virus packaging vector system of the present invention, the vector carrying AAV rep and cap genes is selected from AAV1, AAV2, AAV5, AAV8, AAV9, Anc80, PHP.eB, AAV-DJ and AAVrh.10 vectors; and the helper virus vector is a pHelper plasmid.

[0043] In a third aspect, the present invention provides a method for packaging an adeno-associated virus, wherein the adeno-associated virus packaging vector system described in the second aspect of the present invention is transferred into a host cell for packaging.

[0044] In some embodiments, the host cell is selected from Hela-S3 cells, HEK-293 cells, HEK-293T cells, HEK-293FT cells, A549 cells, and Sf9 cells.

[0045] In a fourth aspect, the present invention provides a dual adeno-associated virus vector, which is obtained by the packaging method according to the second aspect of the present invention.

[0046] In the fifth aspect, the present invention provides the use of the dual vector system for expressing OTOF protein described in the first aspect of the present invention or the dual adeno-associated virus vector described in the fourth aspect of the present invention for preparing a drug or preparation for treating deafness diseases or hearing loss or hearing dysfunction.

[0047] In the sixth aspect, the present invention provides a medicine or preparation for treating deafness, hearing loss or hearing dysfunction, which is prepared by the dual-vector system for expressing OTOF protein described in the first aspect of the present invention or the adeno-associated virus described in the fourth aspect of the present invention, wherein the adeno-associated virus is obtained by transferring the packaging vector system of the adeno-associated virus into a host cell for packaging, and the packaging vector system of the adeno-associated virus includes a dual-vector system for expressing OTOF protein, a vector carrying AAVrep and cap genes, and a helper virus vector.

[0048] In some embodiments, the drug or formulation of the present invention further comprises a neutral salt buffer, an acidic salt buffer, an alkaline salt buffer, glucose, mannose, mannitol, proteins, polypeptides, amino acids, antibiotics, chelating agents, adjuvants, preservatives, nanoparticles, liposomes and positive lipid particles.

[0049] In some embodiments, the drug or preparation of the present invention is administered by injection through the round window, oval window, semicircular canal, posterior semicircular canal, or common canal of the cochlea; and a single or multiple administration throughout life, with a total dose of 1×10 9 -1×10 13 Viral genome. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The figure shows a schematic diagram of the dual-vector-mediated OTOF protein expression using inverted terminal repeats (ITRs), CMV promoter, splice donor SD signal sequence, splice acceptor SA signal sequence, and HD sequence for homologous recombination splicing, which relies on the trans-splicing mechanism for homologous recombination. Figure 1 In the figure, HD represents the homeodomain, for example, its sequence contains a short AK recombination-inducing sequence from f1 phage, 5'cDNA-otof and 3'cDNA-erlin represent the nucleotide sequence encoding the OTOF N-terminus (also represented as "5'Otof NT" in the text) and the nucleotide sequence encoding the OTOF C-terminus (also represented as "3'Otof CT" in the text) after the full-length OTOF protein is cleaved into the OTOF N-terminus and OTOF C-terminus, respectively.

[0051] Figure 2 The vector backbone elements in the binary vector system are exemplified, for example, the sequence thereof can be shown as SEQ ID NO: 7, wherein the 5'ITR sequence is located at 1 bp-141 bp, the CMV promoter sequence is located at 169 bp-752 bp, the Kozak sequence is located at 792 bp-797 bp, the EGFP sequence is located at 801 bp-1517 bp, the WPRE sequence is located at 1536 bp-2124 bp, the SV40 PolyA sequence is located at 2131 bp-2252 bp, the 3'ITR sequence is located at 2290 bp-2430 bp, the f1 Ori sequence is located at 2505 bp-2960 bp, the kana resistance sequence is located at 3242 bp-4156 bp, and the Ori sequence is located at 4327 bp-4515 bp.

[0052] Figure 3 The plasmid map of the first nucleic acid vector in the dual-vector system constructed after the full-length OTOF protein is cut into the OTOF N-terminus and the OTOF C-terminus between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24 is illustrated, comprising the coding nucleotide sequence of 5'Otof NT, SD sequence and AK sequence.

[0053] Figure 4 The plasmid map of the second nucleic acid vector in the dual-vector system constructed after the full-length OTOF protein is split into the OTOF N-terminus and the OTOF C-terminus between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24 is illustrated. The second nucleic acid vector contains the AK sequence, SA sequence and the coding nucleotide sequence of 3'Otof CT, wherein an HA tag is connected to the C-terminus of the OTOF C-terminal protein for verifying the in vitro expression of the OTOF protein.

[0054] Figure 5The plasmid map of the second nucleic acid vector in the dual-vector system constructed after the full-length OTOF protein was split into the OTOF N-terminus and the OTOF C-terminus between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24 is illustrated. The second nucleic acid vector contains the AK sequence, SA sequence and the coding nucleotide sequence of 3'Otof CT, wherein the HA tag is not connected to the C-terminus of the OTOF C-terminal protein for in vivo injection therapy experiments in mice.

[0055] Figure 6 The Western blot results show that HEK-293T cells co-transfected with a plasmid vector encoding the N-terminal part of the OTOF protein (Otof-NT) and a plasmid vector encoding the C-terminal part of the OTOF protein (Otof-CT) resulted in the expression of full-length Otof and full-length OTOF proteins with different cleavage sites. Figure 617N+18C” after co-transfection of the OTOF full-length protein between the amino acid residues encoded by exon 17 and the amino acid residues encoded by exon 18; Lane 2: Co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after co-transfection of the OTOF full-length protein between the amino acid residues encoded by exon 18 and the amino acid residues encoded by exon 19 (also referred to as “18N+19C” in the text); Lane 3: Co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after co-transfection of the OTOF full-length protein between the amino acid residues encoded by exon 19 and the amino acid residues encoded by exon 18 (also referred to as “18N+19C” in the text); Lane 4: Co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after co-transfection of the OTOF full-length protein between the amino acid residues encoded by exon 18 and the amino acid residues encoded by exon 19 (also referred to as “18N+19C” in the text); Lane 5: Lane 4: co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after the OTOF full-length protein was cleaved between the amino acid residue encoded by exon 20 and the amino acid residue encoded by exon 21 (also referred to as "20N+21C" in the text); Lane 5: co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after the OTOF full-length protein was cleaved between the amino acid residue encoded by exon 21 and the amino acid residue encoded by exon 22 (also referred to as "20N+21C" in the text). Lane 6: co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleaving the OTOF full-length protein between the amino acid residues encoded by exon 22 and the amino acid residues encoded by exon 23 (also referred to as "22N+23C" in the text); Lane 7: co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleaving the OTOF full-length protein between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24 (also referred to as "23N+24C" in the text); Lane 8: co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleaving the OTOF full-length protein between the amino acid residues encoded by exon 24 and the amino acid residues encoded by exon 25 (also referred to as "23N+24C" in the text); Lane 9: co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleaving the OTOF full-length protein between the amino acid residues encoded by exon 24 and the amino acid residues encoded by exon 25 Lane 9: Co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleavage of the OTOF full-length protein between the amino acid residues encoded by exon 25 and the amino acid residues encoded by exon 26 (also referred to as "25N+26C" in the text); Lane 10: Co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleavage of the OTOF full-length protein between the amino acid residues encoded by exon 26 and the amino acid residues encoded by exon 27 (also referred to as "26N+27C" in the text);Lane 11: Co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleaving the full-length OTOF protein between the amino acid residues encoded by exon 27 and the amino acid residues encoded by exon 28 (hereinafter referred to as "27N+28C"); Lane 12: Co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleaving the full-length OTOF protein between the amino acid residues encoded by exon 28 and the amino acid residues encoded by exon 29 (hereinafter referred to as "28N+29C"); Lane 13: Co-transfection of the Otof-NT plasmid vector and the Otof-CT plasmid vector after cleaving the full-length OTOF protein between the amino acid residues encoded by exon 29 and the amino acid residues encoded by exon 30 (hereinafter referred to as "29N+30C").

[0056] Figure 7 The results of the auditory brainstem response (ABR) of the Otof knockout mouse model (Otof KO mouse) treated in Example 3 show that the ABR threshold is lowered and the hearing of some frequency bands is significantly restored in the Otof knockout mouse model treated. Figure 7 In the “20N+21C” correspondence Figure 6 Lane 4 shows the results of double AAV virus after plasmid packaging; "23N+24C" corresponds to Figure 6 Lane 7 shows the results of double AAV virus after plasmid packaging; "WT" indicates wild-type mice; "KO" indicates Otof gene knockout mice.

[0057] Figure 8 It was shown that the C57BL / 6 mice with Otof gene point mutation were induced by the cleavage site exon23 / 24 ( Figure 8 Shown as "23N+24C") and the cleavage site exon20 / 21 ( Figure 8 Five days after the injection of the double AAV virus preparation (shown as "20N+21C") constructed into the posterior semicircular canal, the ABR threshold recovery was observed by audiometry. Detailed Description of the Invention

[0059] Unless otherwise defined hereinafter, all technical and scientific terms used in this specification have the same meaning as those of ordinary skill in the art to which the present invention pertains. All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety. In addition, the materials, methods and examples described herein are merely illustrative and are not intended to be restrictive. Other features, objects and advantages of the present invention will become apparent from this specification and the accompanying drawings and from the appended claims.

[0060] definition

[0061] As used herein, the term "about" when used in conjunction with a numerical value is intended to encompass numerical values ​​within a range having a lower limit that is 5% less than the specified numerical value and an upper limit that is 5% greater than the specified numerical value. The term is also intended to encompass values ​​within ±1%, ±0.5%, or ±0.1% of the specified number.

[0062] As used herein, the term "comprising" or "including" means including the recited elements, integers, steps, or groups of elements, integers, or steps, but does not exclude any other elements, integers, or steps, or other groups of elements, integers, or steps. As used herein, unless otherwise indicated, the term "comprising" or "including" also encompasses the situation consisting of the recited elements, integers, or steps. For example, when referring to a polynucleotide "comprising" a particular sequence, it is intended to encompass a polynucleotide consisting of that particular sequence.

[0063] Herein, the expression "and / or," when used in conjunction with two or more items, is intended to mean any one of the associated listed items, or any multiple or all possible combinations of the associated listed items.

[0064] In this article, "hearing loss" refers to hearing below the normal hearing threshold level determined by audiometry, including mild, moderate, severe and profound hearing loss, and deafness. Hearing loss can be described by a percentage of hearing loss, for example, 30%, 60%, 80% or even 100% hearing loss, or by a grading description of hearing loss. The hearing loss can be hearing loss caused by or associated with a gene defect, such as congenital deafness and pre-lingual deafness caused by genetic factors, or hearing loss associated with genetic factors, induced by environmental factors (for example, aging, noise, drugs or infection-induced). Hearing loss can be asymptomatic (that is, there is no associated visible outer ear or other organ abnormality) or symptomatic. In some embodiments, hearing loss is sensorineural hearing loss.

[0065] In this article, "hearing loss-related genes" refer to genes whose mutations can cause hearing loss or susceptibility to hearing loss by changing the ability of the inner ear to function normally. In this article, such genes are also referred to as "hearing loss genes". More than 100 genes have been identified as being associated with hearing loss (see Hereditary Hearing LossHomepage, https: / / hereditaryhearingloss.org / , which lists the gene locations and identification data of currently known single-gene asymptomatic hearing loss). In the case of causing susceptibility to hearing loss, individuals carrying the hearing loss gene mutations may show greater susceptibility to hearing loss due to environmental factors such as aging, noise, drugs or infections relative to healthy individuals.

[0066] The "Otof gene" encodes otoferlin (also called "OTOF protein"). Other members of the same family of proteins include dysferlin and myoferlin, which are homologous to the spermatogenesis factor (FER-1) of nematodes. It can be inferred that the OTOF protein may be related to vesicle membrane fusion. The OTOF protein is expressed in trace amounts in the spiral ganglion cells and inner and outer hair cells in the cochlea of ​​late mouse embryos and newly born mice. In adult mice, it is only expressed in the inner hair cells, mainly concentrated in the base of the inner hair cells. The base of the inner capillary is distributed with many ribbon-like synapses that can continuously release large amounts of neurotransmitters. Previous studies have shown that the OTOF protein is a calcium ion receptor for inner hair cell exocytosis and an important component of the afferent nerve synapse. The C2 domain of the OTOF protein can bind to Ca 2+ Accompanied by Ca 2+ OTOF is a phospholipid-dependent protein that binds to phospholipids and proteins and plays an important role in cell membrane transport and signal transduction. It can bind to cytoplasmic phospholipase A2, synaptotagmin I, Ras-related GTP-binding protein, etc. and participate in the release of neurotransmitters. Therefore, it can be inferred that OTOF protein is related to calcium ion-related synaptic vesicle fusion and neurotransmitter release. - / - There were no obvious abnormalities in the ribbon synapse structure of mice and Ca 2+ OTOF can also be secreted, but complete hearing loss is accompanied by abnormal synaptic vesicle release, indicating that OTOF protein is an important component mediating synaptic vesicle release. Because neurotransmitters have a nourishing effect on postsynapses, lack of nutrition can lead to postsynaptic degeneration, which may explain the progressive hearing loss in human cases.

[0067] The Otof gene is expressed in the cochlea, vestibule, and brain tissues. It has five transcripts, two of which are expressed in the brain. The encoded proteins are divided into long and short forms, terminating at exon 47 and exon 48, respectively. The short form of OTOF protein has three C2 domains and one carboxyl transmembrane domain, and this form only exists in humans; the long form of OTOF protein has six C2 domains and one transmembrane domain, and is expressed in humans and mice, but only the transcript terminating at exon 48 exists in the human cochlea. In some embodiments, the transcript variant 5 sequence of the human Otof gene (NM_001287489.1) is modified for gene therapy in the cochlea. In one embodiment, the nucleotide sequence of the transcript variant 5 of the Otof gene is shown in SEQ ID NO: 2, and the amino acid sequence of the encoded OTOF isoform 5 is shown in SEQ ID NO: 1. Previous studies have found that within the six C2 domains of the OTOF protein, C2A-F, different domains have different mutation rates, with the C2F domain having the highest mutation frequency. It is currently believed that the differences in mutation rates are due to different configurations of the different C2 domains or to the different substances they bind to during the development of hearing function.

[0068] As used herein, "cochlear inner hair cells" refer to isolated or in vitro cochlear inner hair cells, cell lines, or cell populations derived from a mammal, or inner hair cells in the cochlea of ​​a mammal.

[0069] As used herein, "cochlear outer hair cells" refer to cochlear outer hair cells, cell lines, or cell populations isolated from or in vitro of a mammal, or outer hair cells in the cochlea of ​​a mammal.

[0070] As used herein, an "isolated" nucleic acid refers to a nucleic acid molecule that has been artificially synthesized or separated from at least some components of its natural environment. For example, an isolated nucleic acid can be part of a larger nucleic acid, or part of a vector or composition of matter, or can be contained within a cell and still be "isolated" provided that the larger nucleic acid, vector, composition of matter, or specific cell is not the natural environment of the nucleic acid.

[0071] As used herein, the term "operably linked," also referred to as "effectively linked" or "functionally linked," means that two or more polynucleotide (e.g., DNA) segments are in a relationship that allows them to function in the intended manner. For example, a promoter sequence is operably linked to a coding sequence if it stimulates or regulates the transcription of the coding sequence in a suitable host cell or other expression system. Generally, promoters that are operably linked to a transcribable sequence are contiguous with the transcribable sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences (e.g., enhancers) do not need to be physically adjacent to or in close proximity to the coding sequence whose transcription they enhance.

[0072] As used herein, the term "adeno-associated virus (AAV)" is named after its discovery in adenovirus products. AAV is a member of the Parvovirus family, which includes multiple serotypes and has a single-stranded DNA genome.

[0073] AAV is a dependent virus that requires other viruses such as adenovirus, herpes simplex virus, human papillomavirus, or auxiliary factors to provide auxiliary functional proteins for replication.

[0074] The first AAV virus isolated was serotype 2 (AAV2). The AAV2 genome is approximately 4.7 kb long, flanked by 145-bp inverted terminal repeats (ITRs) at either end, forming a palindromic hairpin structure. The genome also contains two large open reading frames (ORFs), encoding the rep and cap genes, respectively.

[0075] ITRs are cis-acting elements of the AAV vector genome, playing a crucial role in AAV virus integration, rescue, replication, and genome packaging. The ITR sequence contains the Rep protein binding site (RBS) and the terminal resolution site (TRs), which are recognized by the Rep protein and produce a nick at the TRs. The ITR sequence also forms a unique "T"-shaped secondary structure, playing a crucial role in the AAV virus life cycle.

[0076] The rest of the AAV2 genome can be divided into two functional regions, the rep gene region and the cap gene region.

[0077] The rep gene region encodes four Rep proteins: Rep78, Rep68, Rep52, and Rep40. Rep proteins play an important role in the replication, integration, rescue, and packaging of AAV viruses. Rep78 and Rep68 specifically bind to the terminal melting sites trs and GAGY repeat motifs in the ITR, initiating the replication of the AAV genome from single-stranded to double-stranded. The trs and GAGC repeat motifs and / or GAGY repeat motifs in the ITR are the center of AAV genome replication. Therefore, although the ITR sequences are different in various serotypes of AAV viruses, they can all form a hairpin structure and contain Rep binding sites. There is a p19 promoter at position 19 on the AAV2 genome map, which initiates the expression of Rep52 and Rep40, respectively. Rep52 and Rep40 have ATP-dependent DNA helicase activity but do not have the function of binding to DNA.

[0078] The cap gene encodes the AAV capsid proteins VP1, VP2, and VP3. VP3 has the smallest molecular weight but is the most abundant. In mature AAV particles, the ratio of VP1, VP2, and VP3 is approximately 1:1:10. VP1 is essential for the formation of infectious AAV; VP2 facilitates VP3 entry into the cell nucleus; and VP3 is the primary protein in AAV particles.

[0079] As used herein, the term "AAV vector" refers to an efficient exogenous gene transfer tool, i.e., an AAV vector, that has been transformed from wild-type AAV virus as people gain a better understanding of the AAV virus life cycle and its related molecular biological mechanisms. The modified AAV vector genome only contains the ITR sequence of the AAV virus and the exogenous sequence to be transferred. The Rep and Cap proteins required for AAV virus packaging are provided in trans by other exogenous plasmids, thereby reducing the possible harm caused by packaging the rep and cap genes into the AAV vector. Furthermore, the AAV virus itself is not pathogenic, which makes the AAV vector recognized as one of the safest viral vectors.

[0080] There are many AAV virus serotypes, and different serotypes have different tissue infection tropisms. Therefore, the use of AAV vectors can transport exogenous genes to specific organs and tissues.

[0081] The existing technology has a relatively mature packaging system for AAV vectors, which facilitates the large-scale production of AAV vectors.

[0082] The term "vector genome (vg)" refers to the nucleic acid sequence that is packaged within the rAAV capsid to form the rAAV vector.

[0083] As used herein, "individual" and "subject" are used interchangeably to refer to mammals. Examples of mammals include, but are not limited to, humans, non-human primates (e.g., cynomolgus monkeys, rhesus monkeys), rodents, and other mammals, such as cattle, pigs, horses, and dogs. As used herein, mammals include individuals at all stages of development, including embryonic and fetal stages.

[0084] As used herein, the term "treatment" refers to clinical intervention intended to alter the natural course of a disease in the individual being treated. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, ameliorating or palliating the disease state, and alleviating or improving prognosis. The term "treatment" also encompasses modification or improvement of at least one physical parameter, including physical parameters that may not be discernible by the patient.

[0085] As used herein, the term "prevention" refers to preventing or delaying the onset or development or progression of a disease or condition. As used herein, "prevention" generally refers to hospital intervention performed before at least one symptom of a disease occurs.

[0086] Various aspects of the present invention are described below.

[0087] II. Dual Vector System

[0088] The present invention provides a dual vector system comprising a first nucleic acid vector and a second nucleic acid vector, wherein:

[0089] The first nucleic acid vector comprises a first nucleotide sequence; and the second nucleic acid vector comprises a second nucleotide sequence;

[0090] The first nucleotide sequence comprises an expression cassette inserted between two first ITR sequences;

[0091] The second nucleotide sequence comprises an expression cassette inserted between two second ITR sequences;

[0092] The expression cassette of the first nucleotide sequence comprises a promoter, an N-terminal coding sequence of OTOF, a splice donor (SD) sequence, a sequence for homologous recombination with the second nucleotide sequence, and polyA;

[0093] The expression cassette of the second nucleotide sequence comprises a promoter, a sequence that undergoes homologous recombination with the first nucleotide sequence, a splice acceptor (SA) sequence, a C-terminal coding sequence of OTOF, and polyA; and

[0094] An OTOF cleavage site is provided in the OTOF amino acid sequence, for example, the OTOF amino acid sequence is as shown in SEQ ID NO: 1 or a functional fragment thereof, for example, an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1;

[0095] The N-terminal coding sequence of OTOF is the nucleotide coding sequence from the N-terminus of the OTOF amino acid sequence to the OTOF cleavage site; the C-terminal coding sequence of OTOF is the nucleotide coding sequence from the amino acid after the OTOF cleavage site to the C-terminus of the OTOF amino acid sequence.

[0096] Homologous recombination sequences as well as splice donor and acceptor sequences

[0097] In the dual vector system of the present invention, the sequence in which the first nucleotide sequence and the second nucleotide sequence undergo homologous recombination can be an intron sequence, for example, an intron sequence that does not naturally occur in the genomic sequence of the gene encoding the OTOF protein. In some specific embodiments, the intron is a synthetic alkaline phosphatase (AP) intron.

[0098] In some embodiments, the intron sequence used in the dual vector system of the present invention may comprise a splice donor sequence and a splice acceptor sequence. For example, the dual vector system may comprise one or more AP intron spliceosomal recognition sites, such as one or more AP splice acceptor (APSA) domains or AP splice donor (APSD) domains. In some exemplary embodiments, these vectors comprise both an APSA and an APSD. In some embodiments, the first vector comprises an APSA and the second vector comprises an APSD. In some embodiments, the first vector comprises an APSD and the second vector comprises an APSA.

[0099] In some embodiments, the intron sequence is a recombination-inducing AK sequence of F1 phage, such as the sequence shown in SEQ ID NO: 6, thereby reconstructing the expression cassette of the full-length OTOF protein by mediating homologous recombination through the AK sequence.

[0100] Splice acceptor sequence and splice donor sequence can be selected by those skilled in the art from known splice acceptor sequence and splice donor sequence.Spliceosomal introns are usually located in the sequence of protein-coding genes of eukaryotic cells.In introns, splice donor site (located at the 5' end of the intron) and splice acceptor site (located at the 3' end of the intron) are required for splicing.The splice donor site is located at the 5' end of the intron in a larger, less highly conserved region and comprises an almost constant sequence GU.The splice acceptor site at the 3' end of the intron terminates the intron with an almost constant AG sequence.Upstream of AG (5' direction), there is a pyrimidine-rich (C and U) region or a polypyrimidine sequence.

[0101] In some embodiments, the splice donor (SD) sequence in the binary vector system consists essentially of the sequence shown in SEQ ID NO:4; and the splice acceptor (SA) sequence consists essentially of the sequence shown in SEQ ID NO:5.

[0102] OTOF protein

[0103] In some embodiments, the OTOF protein comprises or consists of the amino acid sequence of SEQ ID NO: 1.

[0104] In some embodiments, a cleavage site is set on the amino acid sequence of the OTOF protein to divide the OTOF protein into the N-terminal portion of the OTOF protein (also referred to herein as the "N-terminus of OTOF") and the C-terminal portion of the OTOF protein (also referred to herein as the "C-terminus of OTOF"). The N-terminus of OTOF is the sequence from the N-terminus of the OTOF amino acid sequence to the cleavage site, and the C-terminus of OTOF is the sequence from the amino acid residue immediately adjacent to the cleavage site to the C-terminus of the OTOF amino acid sequence. There are multiple options for the cleavage site of OTOF, for example, the OTOF cleavage site is located at the 3' terminal amino acid residue of any exon 1-47 in the OTOF amino acid sequence.

[0105] In some preferred embodiments, in the dual-vector system for expressing the OTOF protein of the present invention, the OTOF N-terminal coding sequence is SEQ ID NO: 11 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 37, and the OTOF C-terminal coding sequence is SEQ ID NO: 24 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 50;

[0106] The OTOF N-terminal coding sequence is SEQ ID NO: 12 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 38, and the OTOF C-terminal coding sequence is SEQ ID NO: 25 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 51;

[0107] The OTOF N-terminal coding sequence is SEQ ID NO: 13 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 39, and the OTOF C-terminal coding sequence is SEQ ID NO: 26 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 52;

[0108] The OTOF N-terminal coding sequence is SEQ ID NO: 14 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 40, and the OTOF C-terminal coding sequence is SEQ ID NO: 27 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 53; or

[0109] The OTOF N-terminal coding sequence is SEQ ID NO: 20 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 46, and the OTOF C-terminal coding sequence is SEQ ID NO: 33 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 59.

[0110] vector plasmid

[0111] The vector plasmid of the present invention can be any plasmid that can replicate in a host cell and express a corresponding polypeptide.

[0112] In some embodiments, the vector plasmid comprises two ITR sequences, namely a 5' inverted terminal repeat (5'ITR) sequence and a 3' inverted terminal repeat (3'ITR) sequence.

[0113] In some embodiments, in the dual-vector system for expressing OTOF protein of the present invention, the first nucleotide sequence is inserted into a plasmid comprising two first ITR sequences, and the second nucleotide sequence is inserted into a plasmid comprising two second ITR sequences, for example, the plasmid comprising two first ITR sequences and the plasmid comprising two second ITR sequences are the same or different, for example, the plasmid is pAAV, pAAV-CMV, pX601, pX551 or pAAV-MCS plasmid.

[0114] Dual vector system

[0115] The present invention provides a dual vector system comprising a first nucleic acid vector and a second nucleic acid vector, wherein:

[0116] The first nucleic acid vector comprises, in 5'-3' direction: a 5' inverted terminal repeat (5'ITR) sequence, a promoter, an N-terminal coding sequence of OTOF, a splice donor (SD) sequence, a sequence for homologous recombination with the second nucleotide sequence, polyA, and a 3' inverted terminal repeat (3'ITR) sequence;

[0117] The second nucleic acid vector comprises, in 5'-3' direction: a 5'ITR sequence, a promoter, a sequence for homologous recombination with the first nucleotide sequence, a splicing acceptor (SA) sequence, a C-terminal coding sequence of OTOF, polyA and a 3'ITR sequence, and

[0118] Optionally, after the first nucleic acid vector and the second nucleic acid vector are introduced into a host cell, the OTOF protein N-terminal coding sequence and the OTOF protein C-terminal coding sequence are operably linked after transcription, and the OTOF protein is produced through translation.

[0119] In some embodiments, the nucleotide sequences of the ITRs in the dual vector system are derived from the same AAV serotype or different AAV serotypes, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 serotypes. In some embodiments, the 5'-ITR and 3'-ITR of the first nucleic acid vector and the 5'-ITR and 3'-ITR of the second nucleic acid vector are derived from the same AAV serotype. In some embodiments, the 5'-ITR and 3'-ITR of the first nucleic acid vector and the 5'-ITR and 3'-ITR of the second nucleic acid vector are derived from different AAV serotypes.

[0120] In some embodiments, a tissue-specific promoter is used in a two-vector system, for example, a promoter that mediates expression in the ear, such as the synapsin promoter or the GFAP promoter.

[0121] In some embodiments, any one of the following promoters is used in the binary vector system: cytomegalovirus (CMV) promoter, SV40 promoter, Rous sarcoma virus (RSV) promoter, CAG promoter, chimeric CMV / chicken beta actin (CBA) promoter, truncated CBA (smCBA) promoter, UbC promoter, SFFV promoter, EF1α promoter, PGK promoter, or promoters of Myo7A, Myo15, Atoh1, POU4F3, Lhx3, Myo6, α9AchR, α10AchR, OTOF and STRC encoding genes. In some embodiments, the promoter is a CMV promoter.

[0122] The dual vector system of the present invention may also include one or more additional regulatory sequences that can function before or after transcription. The regulatory sequences may be part of the native transgenic locus or may be heterologous regulatory sequences. A portion of the 5'UTR or 3'UTR of the native transgenic transcript may be included in the dual vector system of the present invention.

[0123] The regulatory sequence may be any sequence that promotes transgene expression, i.e., serves to increase transcript expression, improve nuclear export of mRNA, or enhance its stability. Such regulatory sequences include, for example, enhancer elements, post-transcriptional regulatory elements, and polyadenylation sequences.

[0124] Enhancers are cis-regulatory elements that affect the transcription of genes on the same molecule of DNA. Enhancers can be located upstream, downstream, within introns, or even relatively far from the genes they regulate.

[0125] The preferred post-transcriptional regulatory element used in the dual vector system of the present invention is the woodchuck hepatitis post-transcriptional regulatory element (WPRE) or a variant thereof. Compared with an AAV vector without WPRE or a variant thereof, an AAV vector containing WPRE or a variant thereof increases the expression of OTOF protein.

[0126] In one embodiment, the dual vector system of the present invention comprises a WPRE nucleotide sequence as set forth in SEQ ID NO: 61. In another embodiment, the dual vector system of the present invention comprises a post-transcriptional regulatory element having a nucleotide sequence that is at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the WPRE nucleotide sequence as set forth in SEQ ID NO: 61, wherein the nucleotide sequence substantially retains the functional activity of the post-transcriptional regulatory element as set forth in SEQ ID NO: 61, for example, a truncated variant of WPRE. Reducing the size of the AAV genome enables increased flexibility in introducing other regulatory elements into the vector in addition to transgenes. In one embodiment, the truncated variant of WPRE has the WPRE3 nucleotide sequence as set forth in SEQ ID NO: 64.

[0127] In one embodiment, the binary vector system of the present invention comprises a polyadenylation sequence, e.g., a bovine growth hormone polyadenylation sequence, an SV40 polyadenylation sequence, and / or an SV40 late polyadenylation sequence. In one embodiment, the binary vector system of the present invention comprises an SV40 polyadenylation sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence set forth in SEQ ID NO: 62. In one embodiment, the binary vector system of the present invention comprises an SV40 late polyadenylation sequence that is at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence set forth in SEQ ID NO: 65.

[0128] In some embodiments, the two-vector system of the present invention comprises a combination of a WPRE nucleotide sequence and an SV40 polyadenylation sequence. For example, the two-vector system of the present invention has the nucleotide sequence set forth in SEQ ID NO: 60, or a nucleotide sequence that is at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 60. The combination of the WPRE nucleotide sequence and the SV40 polyadenylation sequence allows for high-level expression of transgenes.

[0129] In some embodiments, the dual-vector system of the present invention comprises a combination of a WPRE3 nucleotide sequence and an SV40 late polyadenylation sequence. For example, the dual-vector system of the present invention has the nucleotide sequence set forth in SEQ ID NO: 63, or a nucleotide sequence that is at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 63. The combination of the WPRE3 nucleotide sequence and the SV40 late polyadenylation sequence (also referred to as "W3SL") can efficiently express larger exogenous genes while occupying less AAV packaging capacity.

[0130] The present invention uses the dual-vector system to deliver the OTOF encoding gene into two parts and deliver them to inner ear cells, inner hair cells, or outer hair cells. The transcribed OTOF N-terminal mRNA and OTOF C-terminal mRNA undergo trans-splicing to form full-length OTOF mRNA, which is then translated to express the full-length OTOF protein. The present invention demonstrates that the dual-vector system for expressing the OTOF protein can effectively transduce the targeted inner ear cells, inner hair cells, or outer hair cells, producing the OTOF protein in these cells and permanently restoring hearing loss caused by OTOF gene knockout.

[0131] In a preferred embodiment, the dual vector system of the present invention allows for the expression of homologous polypeptides having an amino acid sequence that is at least 70% identical and / or similar to SEQ ID NO: 1. More preferably, the homologous sequence has at least 75%, even more preferably at least 80%, or at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, at least 99% identity and / or similarity to SEQ ID NO: 1. When the homologous polypeptide is much shorter than SEQ ID NO: 1, local alignment may be considered.

[0132] In another embodiment, the dual vector system of the present invention can allow for the expression of functional fragments of an OTOF protein polypeptide. The term "functional fragment" herein refers to any fragment that retains at least one biological function of an OTOF protein polypeptide of interest.

[0133] The full-length OTOF protein can be obtained by transforming host cells using the dual vector system of the present invention. In some embodiments, the host cells are selected from Hela-S3 cells, HEK-293 cells, HEK-293T cells, HEK-293FT cells, A549 cells and Sf9 cells.

[0134] III. Uses of the Dual Vector System

[0135] The dual-vector system of the present invention is used to administer to patients suffering from DFNB9-induced deafness. "Patient suffering from DFNB9-induced deafness" refers to a patient, particularly a human patient, who is believed to have (or has been diagnosed with) a mutation in a gene encoding an OTOF protein that triggers abnormal expression, abnormal function, or both of the OTOF protein.

[0136] In some embodiments, the dual vector system of the present invention is a dual AAV vector system. In some embodiments, the first AAV vector and the second AAV vector in the dual AAV vector system are vectors each having a capsid of the same or different AAV origin, for example, the first AAV vector and the second AAV vector in the dual AAV vector system are vectors each having an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-Anc80 capsid or an AAV vector with a chimeric capsid, in particular an AAV vector with an AAV-Anc80 capsid. Preferably, the synthetic adeno-associated virus vector Anc80L65 is used, which has been shown to have the highest transduction efficiency of inner ear hair cells reported to date (Suzuki et al., Sci. Rep. 7: 45524 (2017)).

[0137] The dual AAV vector system, after administration to a subject, treats OTOF mutation-associated autosomal recessive deafness 9 (DFNB9) disease by increasing the expression of wild-type OTOF protein or providing wild-type OTOF protein to the subject.

[0138] After administration to a subject, the dual-vector system of the present invention can trigger the expression of the full-length OTOF protein polypeptide, or a functional fragment thereof, in inner ear cells, inner hair cells, or outer hair cells.

[0139] The patients to whom the dual vector system of the present invention is administered are preferably newborn human infants, usually less than 6 months old, or even less than 3 months old (if they were diagnosed with DFNB9 deafness in childhood). These human infants are more preferably between 3 months and 1 year old.

[0140] The two-vector system of the present invention can also be administered to, for example, infants (2-6 years), children (6-12 years), adolescents (12-18 years), or adults (18 years and older).

[0141] As used herein, the term "treating" is intended to mean administering a therapeutically effective amount of the dual vector system of the present invention to a patient suffering from DFNB9 deafness to partially or completely restore the patient's hearing. Such restoration can be assessed by testing auditory brainstem responses (ABRs) using electrophysiological equipment. "Treatment of hearing loss induced by OTOF mutations" is specifically intended to refer to complete restoration of hearing function. The term "preventing" refers to reducing or delaying hearing loss within the auditory frequency range. Example

[0142] The technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the various reaction reagents involved in the embodiments can be purchased through commercial channels.

[0143] Example 1 Screening of OTOF Full-Length Protein Cleavage Sites and Expression in HEK-293T Cells

[0144] The dual-vector system of this embodiment is as follows Figure 3 and Figure 4 or Figure 5 As shown, wherein the first nucleic acid vector ( Figure 3 ) comprises, in 5'-3' direction: a 5' inverted terminal repeat (5'ITR) sequence, a CMV promoter sequence, a cDNA sequence containing the N-terminal portion (5'OtofNT) encoding the OTOF protein, a splice donor (SD) sequence, a splicing sequence HD for homologous recombination with a second nucleotide sequence (e.g., an AK sequence, which is a recombination-initiating sequence from f1 phage) and a 3' inverted terminal repeat (3'ITR) sequence; a second nucleic acid vector ( Figure 4 or Figure 5 ) comprises, in the 5'-3' direction, a 5'ITR sequence, a CMV promoter sequence, a splicing sequence HD (e.g., an AK sequence) that undergoes homologous recombination with the first nucleotide sequence, a splice acceptor (SA) sequence, a cDNA sequence encoding the C-terminus of the OTOF protein (3'Otof CT), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence (SEQ ID NO: 61), an SV40 PolyA sequence (SEQ ID NO: 62), and a 3'ITR sequence. Both the first and second nucleic acid vectors further comprise an Ori sequence and a resistance sequence. Figure 1The figure shows a schematic diagram of the dual-vector-mediated OTOF protein expression using inverted terminal repeats (ITR), CMV promoter, splice donor SD signal sequence, splice acceptor SA signal sequence, and HD sequence for homologous recombination splicing, which relies on the trans-splicing mechanism for homologous recombination.

[0145] The first nucleic acid vector and the second nucleic acid vector in the dual vector system are Figure 2 The pAAV-CMV-EGFP-WPRE-SV40 plasmid backbone was used for transformation.

[0146] Specifically, the EGFP reporter gene sequence in the pAAV-CMV-EGFP-WPRE-SV40 plasmid was replaced with a target sequence comprising a nucleotide sequence encoding 5'Otof NT, an SD sequence, and an AK sequence using EcoRI and EcoRV double enzyme digestion to obtain a first nucleic acid vector pAAV-CMV-Otof-N-SD-AK. The EGFP reporter gene sequence in the pAAV-CMV-EGFP-WPRE-SV40 plasmid was replaced with a target sequence comprising an AK sequence, an SA sequence, and a nucleotide sequence encoding 3'Otof CT using EcoRI and EcoRV double enzyme digestion to obtain a second nucleic acid vector pAAV-CMV-AK-SA-Otof-C-WPRE-SV40. The target sequence synthesis and vector construction were both commissioned to Nanjing KingScript Biotechnology Co., Ltd.

[0147] The use of dual-vector AAV delivery for OTOF mutation deafness recovery is an important method for the treatment of OTOF mutation deafness. However, the efficiency of using dual-vector AAV to deliver the Otof gene is a difficult problem, in which sequence recombination in the dual vector is an important step. In order to obtain a dual-vector AAV with improved trans-splicing and recombination efficiency, the OTOF protein was divided into 13 groups as shown in Table 1A, and 13 groups of 5'Otof NT (also referred to as "N-Otof" in Table 1B) and 3'Otof CT (also referred to as "C-Otof" in Table 1B) were obtained respectively. In addition, the coding sequence of the OTOF protein was codon optimized to obtain the sequence shown in SEQ ID NO: 3.

[0148] Table 1A. OTOF N-terminus and OTOF C-terminus of the full-length OTOF protein (SEQ ID NO: 1) cleaved by the cleavage site

[0149]

[0150] Table 1B. Nucleotide sequences encoding the cleaved OTOF N-terminus and OTOF C-terminus

[0151]

[0152]

[0153] Among them, the codon-optimized N-Otof sequences of groups 1-13 are shown in SEQ ID NOs: 34-46, respectively, and inserted into Figure 2 The vector backbone elements shown in the figure are used to obtain the first nucleic acid vector; the codon-optimized C-Otof sequences of groups 1-13 are shown in SEQ ID NOs: 47-59, respectively, and inserted into Figure 2 The vector backbone elements shown are combined to obtain a second nucleic acid vector.

[0154] The obtained first nucleic acid vector pAAV-CMV-Otof-N-SD-AK and the second nucleic acid vector pAAV-CMV-AK-SA-Otof-C-WPRE-SV40 were co-transfected into HEK-293T cells (obtained from the Chinese Academy of Sciences Cell Bank, SCSP-502) at the same molar ratio. The expression of full-length OTOF was analyzed by Western blotting 48 hours after transfection. The specific experimental method is as follows.

[0155] Cell transfection: Seed HEK-293T cells (human embryonic kidney 293T cells, hereinafter referred to as "293T cells") to 70-90% density and prepare for transfection. Prepare tube A: 125 μL serum-free DMEM medium + 8 μL Lipofectamine 3000 reagent (Invitrogen, catalog number: L3000015) and mix thoroughly. Prepare tube B: 125 μL serum-free DMEM medium + 2 μg of the first nucleic acid vector pAAV-CMV-Otof-N-SD-AK + 2 μg of the second nucleic acid vector pAAV-CMV-AK-SA-Otof-C-WPRE-SV40 + 8 μL P3000 reagent (Invitrogen, catalog number: L3000015) and mix thoroughly. Add the mixture in tube B to tube A, mix gently and thoroughly, and let it stand at room temperature for 10-15 minutes. Tube A contains a mixture of culture medium and Lipofectamine 3000 transfection reagent, while Tube B contains a mixture of culture medium, nucleic acid carrier DNA, and transfection enhancer P3000. The resulting DNA-liposome complex was added to 293T cells for transfection and incubated at 37°C in 95% air and 5% CO2. Cells were harvested by centrifugation 48 hours after transfection.

[0156] After transfection, the cell pellet, harvested by centrifugation, was thoroughly resuspended in an appropriate amount of RIPA lysis buffer (Thermo Fisher Scientific, Catalog No. 89900) supplemented with 1% protease inhibitor cocktail (Thermo Fisher Scientific, Catalog No. 87786) and 1% PMSF. Lyse on ice for 30 minutes, vortexing every 10 minutes to thoroughly resuspend the cell pellet in the lysis buffer. Centrifuge at 12,000 rpm for 15 minutes, collect the supernatant (do not aspirate the pellet), add 5X loading buffer to the sample in proportion, boil at 75°C for 15 minutes, cool on ice, and after centrifugation, collect the supernatant for Western blot analysis.

[0157] Western blotting for OTOF protein expression: Wash the glass plates and secure them flat on a rack, clamping them with the concave surface facing inward. Position the plates symmetrically, front and back. Prepare separating gel and seal with isopropanol. After 0.5 hours, discard the isopropanol and place on its side with a pump to dry. Prepare stacking gel, adding until overflowing, and insert a comb. After 45 minutes, remove the gel plate and attach it to the clamps in the electrophoresis tank. Add running buffer from the center of the tank until it overflows to 1 / 2 of the tank volume. Carefully remove the comb. Load the sample, perform electrophoresis at a constant voltage of 100V for 1 hour, and transfer the membrane at a constant current of 300mA on ice for 90 minutes.

[0158] After transfer, remove the PVDF membrane and incubate it with blocking buffer (5% skim milk powder in TBST buffer) at room temperature for 1 hour. Add the primary antibodies (HA-Tag Mouse mAb, Cell Signaling Technology (CST), catalog number: 6E2; β-Actin Mouse mAb, Cell Signaling, catalog number: 3700S) to the blocked PVDF membrane and incubate overnight at 4°C. Use the HA antibody as the primary antibody to detect full-length OTOF protein expression, and the β-actin antibody as the primary antibody to detect β-actin levels, an internal control protein, in Western blotting. β-actin protein levels generally do not change, so it can be used to check whether the sample loading amount is consistent during Western blotting.

[0159] The next day, the incubated PVDF membrane was removed, rinsed three times with 1X TBST for 5 minutes each time, incubated with the secondary antibody (HRP-conjugated Affinipure Goat Anti-Mouse IgG (H+L), Proteintech, catalog number: SA00001-1) at room temperature for 1 hour, rinsed three times with 1X TBST for 5 minutes each time; then, chemiluminescent reagent (ECL) was added for development in a dark room.

[0160] Western blot analysis results were as follows Figure 6 As shown. Figure 6 Lane NC: control (293T cells not transfected with dual vector plasmids); Lanes 1-13: corresponding to the cells transfected with dual vector plasmids of groups 1-13 in Table 1B. Figure 6 The Western blotting results showed that the dual-vector plasmid systems constructed using the various cleavage sites of the full-length OTOF sequence were able to express the full-length OTOF protein after transfection into cells, and the expression levels of the full-length OTOF protein were significantly increased after the dual-vector plasmid systems of groups 4-7 and 13 were transfected into cells and recombined in the cells.

[0161] Example 2. Preparation of adeno-associated virus

[0162] In this example, paired adeno-associated viruses were prepared for infection of mice.

[0163] Specifically, two plasmids (a first nucleic acid vector plasmid and a second nucleic acid vector plasmid) corresponding to the 4th group of cleavage sites of the full-length OTOF protein constructed in Example 1 and two plasmids (a first nucleic acid vector plasmid and a second nucleic acid vector plasmid) corresponding to the 7th group of cleavage sites were used to prepare four adeno-associated viruses (AAV) in HEK-293T cells, respectively, and paired into two pairs of double AAV viruses. The specific method is as follows. Virus packaging: prepare 10 plates of 150mm flat dishes of HEK-293T cells: the cell density is 80%-90% confluence. Prepare tube A: 4880μL serum-free culture medium DMEM + 120μL PEI transfection reagent, mix thoroughly. Prepare tube B: 4958 μL serum-free DMEM medium + pAnc80L65 plasmid (GenBank: KT235804.1, providing Anc80L65 capsid protein) (Addgene plasmid #68837) 15 μL + pHelper plasmid (GenBank: AF369965.1) 15 μL + the first nucleic acid vector pAAV-CMV-Otof-N-SD-AK or the second nucleic acid vector pAAV-CMV-AK-SA-Otof-C-WPRE-SV40 poly (A) constructed in Example 1 12 μL, and mix thoroughly. Add the liquid in tube A to tube B, add dropwise and mix gently, let stand at room temperature for 20-25 minutes, add the mixture to the prepared HEK-293T cells, and add 1 ml of DNA-liposome complex per plate (can be prepared in batches). After 12 hours, the medium was changed and after 48 hours, the supernatant was collected into a sterile bottle and stored at 4°C. Fresh medium was added and cultured for another 48 hours before the cells and supernatant were collected into the sterile bottle mentioned above.

[0164] AAV purification: After collecting the supernatant and cells, cells were lysed using a hot-cold-hot cycle. Cells were alternately placed in dry ice-cold ethanol and a 37°C water bath three times, followed by centrifugation at 1167g for 15 minutes at 4°C. Genomic and plasmid DNA was then removed, and the supernatant was transferred to a 50mL centrifuge tube. DNase and RNase were added to final concentrations of 10 U / mL and 10 mg / mL, respectively, and incubated at 37°C for 30 minutes. The supernatant was centrifuged at 13490 rpm for 20 minutes at 4°C. The supernatant from the previous centrifugation was filtered using a sterile 50mL syringe and a 0.22μm filter. A gradient of iodixanol was then prepared: 8mL of 15% (v / v) iodixanol, 5.5mL of 25% (v / v) iodixanol, 5mL of 40% (v / v) iodixanol, and 4.5mL of 60% (v / v) iodixanol. During this step, iodixanol is irritating to the eyes, skin, and respiratory tract; personal protective equipment is required and the procedure must be performed in a fume hood. Carefully drop the supernatant obtained above onto the surface of 15% iodixanol and ultracentrifuge using a fixed-angle titanium rotor at 301580 g for 1 hour 40 minutes at 12°C, using maximum acceleration and deceleration. The purified AAV virus is located between the 40% and 60% iodixanol interfaces. Carefully insert and aspirate with a blunt stainless steel needle to obtain the N-terminal AAV virus and the C-terminal AAV virus corresponding to each cleavage site.

[0165] AAV titer determination: AAV titer was determined using qPCR. The titer was expressed as GC / mL, where GC represents the genomic particle concentration. The purified virus titer was verified to be above 10e+12 GC / mL. qPCR primers were designed to target the ITR sequence. The primer sequences were: upstream primer fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT-3' (SEQ ID NO: 66); downstream primer rev ITR primer, 5'-CGGCCTCAGTGAGCGA-3' (SEQ ID NO: 67).

[0166] Titer calculation formula: Titer = 1000000*power(10 x )

[0167] The formula for calculating x is: x = (38.71-y) / 3.54

[0168] Where y is the CT value, that is, the threshold cycle (Ct) in qPCR. The CT value can be derived after qPCR is completed. Substitute the CT value into x = (38.71-y) / 3.54 to calculate the x value.

[0169] For example, the CT value of the qPCR result is 13.925=y. Substituting it into the above formula, x=(38.71-13.925) / 3.54=7, thus, the virus titer value is =1000000*power(10 7 ), that is, 1.00E+13.

[0170] Example 3: Restoration of deafness in Otof gene knockout mice by dual-vector AAV delivery

[0171] 3.1 Construction of Otof gene knockout mouse model

[0172] Suzhou Saiye Biotechnology Co., Ltd. was commissioned to develop a C57BL / 6 mouse model with an Otof(Q939*) point mutation. Homozygous C57BL / 6 mice with this point mutation experience complete hearing loss. The Otof(Q939*) point mutation represents a deletion of the amino acid residue Q at position 939 of the OTOF protein.

[0173] 3.2 Administration of AAV Virus in Otof Knockout Mice

[0174] C57BL / 6 mice with the Otof gene point mutation prepared in Example 3.1 were injected into the posterior semicircular canal (PSCC) at P27 (i.e., 27 days after birth). Each ear was injected with 2 μl of a mixture of N-terminal AAV virus and C-terminal AAV virus corresponding to each cleavage site prepared in Example 2 (N-terminal virus corresponding to each cleavage site: C-terminal virus = 1:1, N-terminal virus titer of 8.18e12 GC / ml, C-terminal virus titer of 8.18e12 GC / ml). Audiometry was performed 5 days later. Wild-type C57BL / 6 mice were used as controls for auditory function analysis.

[0175] The auditory response threshold, latency, and inter-wave duration are detected through ABR. Short sounds (Click), especially short sounds of different frequencies (4KHz, 8KHz, 12KHz, 16KHz, 24KHz, 32KHz), are used as stimuli to detect the hearing thresholds of mice to different frequencies, analyze the hearing sensitivity of mice, and judge whether the mice have normal auditory function from hair cells to cerebral cortex as a whole.

[0176] The higher the ABR threshold, the more severe the hearing loss of the OTOF gene mutant mice. Conversely, the lower the ABR threshold, the better the effect of gene therapy. The audiological test results showed that the OTOF gene cut site exon23 / 24 (i.e., the cut site is between exon 23 and exon 24, Figure 723N+24C) and the OTOF gene split site exon20 / 21 (i.e., the split site is between exon 20 and exon 21, Figure 7 ) significantly reduced the ABR threshold, and the OTOF gene split site exon23 / 24 made the ABR threshold even lower ( Figure 7 ).

[0177] Figure 8 This is the original waveform of the 8kHz ABR audiometry data. The "SPL" in the vertical axis "dB SPL" is the abbreviation of "Sound Pressure Levels", which represents the intensity of the stimulus sound. The minimum sound intensity produced by the induced waveform is the ABR threshold. Figure 8 As shown, the ABR threshold of WT mice was 30dB, that of KO mice was greater than 90dB, that of KO mice injected with the dual AAV vector "20N+21C" was 55dB, and that of KO mice injected with the dual AAV vector "23N+24C" was 30dB. This experimental result also shows that both the OTOF gene cleavage site exon23 / 24 and the OTOF gene cleavage site exon20 / 21 significantly reduce the ABR threshold, and that the OTOF gene cleavage site exon23 / 24 makes the ABR threshold even lower.

[0178] Example sequence:

[0179] Amino acid sequence of OTOF isoform 5:

[0180]

[0181] Nucleotide sequence of Otof gene transcript variant 5 encoding OTOF isoform 5:

[0182]

[0183] Codon-optimized sequence encoding OTOF isoform 5:

[0184]

[0185] Nucleotide sequence encoding splice donor SD:

[0186] GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGT TTCT(SEQ ID NO:4)

[0187] Nucleotide sequence encoding the splice acceptor SA:

[0188] GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG(SEQ ID NO:5)

[0189] Splicing AK nucleotide sequence for homologous recombination:

[0190] GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAAT (SEQ ID NO: 6)

[0191] Instructions attached Figure 2 The nucleotide sequence of the vector pAAV-CMV-EGFP is shown:

[0192]

[0193] The nucleotide sequence of the wild-type N-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 17 and the amino acid residues encoded by exon 18 is shown in SEQ ID NO: 8

[0194]

[0195] The nucleotide sequence of the wild-type N-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 18 and the amino acid residues encoded by exon 19 is shown in SEQ ID NO: 9

[0196]

[0197] The nucleotide sequence of the wild-type N-Otof after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 19 and the amino acid residues encoded by exon 20 is shown in SEQ ID NO: 10

[0198]

[0199] The nucleotide sequence of the wild-type N-Otof after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 20 and the amino acid residues encoded by exon 21 is shown in SEQ ID NO: 11

[0200]

[0201] The nucleotide sequence of the wild-type N-Otof after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 21 and the amino acid residues encoded by exon 22 is shown in SEQ ID NO: 12

[0202]

[0203] The nucleotide sequence of the wild-type N-Otof after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 22 and the amino acid residues encoded by exon 23 is shown in SEQ ID NO: 13

[0204]

[0205] The nucleotide sequence of the wild-type N-Otof after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24 is shown in SEQ ID NO: 14

[0206]

[0207] The nucleotide sequence of the wild-type N-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 24 and the amino acid residues encoded by exon 25 is shown in SEQ ID NO: 15

[0208]

[0209] The nucleotide sequence of the wild-type N-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 25 and the amino acid residues encoded by exon 26 is shown in SEQ ID NO: 16

[0210]

[0211] The nucleotide sequence of the wild-type N-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 26 and the amino acid residues encoded by exon 27 is shown in SEQ ID NO: 17

[0212]

[0213] The nucleotide sequence of the wild-type N-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 27 and the amino acid residues encoded by exon 28 is shown in SEQ ID NO: 18

[0214]

[0215] The nucleotide sequence of the wild-type N-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 28 and the amino acid residues encoded by exon 29 is shown in SEQ ID NO: 19

[0216]

[0217] The nucleotide sequence of the wild-type N-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 29 and the amino acid residues encoded by exon 30 is shown in SEQ ID NO: 20

[0218]

[0219] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 17 and the amino acid residues encoded by exon 18 is shown in SEQ ID NO: 21

[0220]

[0221] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 18 and the amino acid residues encoded by exon 19 is shown in SEQ ID NO: 22

[0222]

[0223] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 19 and the amino acid residues encoded by exon 20 is shown in SEQ ID NO: 23

[0224]

[0225] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 20 and the amino acid residues encoded by exon 21 is shown in SEQ ID NO: 24

[0226]

[0227] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 21 and the amino acid residues encoded by exon 22 is shown in SEQ ID NO: 25

[0228]

[0229] The nucleotide sequence of the wild-type C-Otof after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 22 and the amino acid residues encoded by exon 23 is shown in SEQ ID NO: 26

[0230]

[0231] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24 is shown in SEQ ID NO: 27

[0232]

[0233] The nucleotide sequence of the wild-type C-Otof after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 24 and the amino acid residues encoded by exon 25 is as follows:

[0234]

[0235] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 25 and the amino acid residues encoded by exon 26 is shown in SEQ ID NO: 29

[0236]

[0237] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 26 and the amino acid residues encoded by exon 27 is shown in SEQ ID NO: 30

[0238]

[0239] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 27 and the amino acid residues encoded by exon 28 is shown in SEQ ID NO: 31

[0240]

[0241] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 28 and the amino acid residues encoded by exon 29 is shown in SEQ ID NO: 32

[0242]

[0243] The nucleotide sequence of the wild-type C-Otof after cleavage of the full-length OTOF protein between the amino acid residues encoded by exon 29 and the amino acid residues encoded by exon 30 is shown in SEQ ID NO: 33

[0244]

[0245] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 17 and the amino acid residues encoded by exon 18 is shown in SEQ ID NO: 34

[0246]

[0247] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 18 and the amino acid residues encoded by exon 19 is shown in SEQ ID NO: 35

[0248]

[0249] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 19 and the amino acid residues encoded by exon 20 is shown in SEQ ID NO: 36

[0250]

[0251] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 20 and the amino acid residues encoded by exon 21 is shown in SEQ ID NO: 37

[0252]

[0253] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 21 and the amino acid residues encoded by exon 22 is shown in SEQ ID NO: 38

[0254]

[0255] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 22 and the amino acid residues encoded by exon 23 is shown in SEQ ID NO: 39

[0256]

[0257] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24 is shown in SEQ ID NO: 40

[0258]

[0259] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 24 and the amino acid residues encoded by exon 25 is shown in SEQ ID NO: 41.

[0260]

[0261] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 25 and the amino acid residues encoded by exon 26 is shown in SEQ ID NO: 42

[0262]

[0263] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 26 and the amino acid residues encoded by exon 27 is shown in SEQ ID NO: 43.

[0264]

[0265] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 27 and the amino acid residues encoded by exon 28 is shown in SEQ ID NO: 44

[0266]

[0267] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 28 and the amino acid residues encoded by exon 29 is shown in SEQ ID NO: 45

[0268]

[0269] The nucleotide sequence of N-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 29 and the amino acid residues encoded by exon 30 is shown in SEQ ID NO: 46

[0270]

[0271] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 17 and the amino acid residues encoded by exon 18 is shown in SEQ ID NO: 47

[0272]

[0273] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 18 and the amino acid residues encoded by exon 19 is shown in SEQ ID NO: 48

[0274]

[0275] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 19 and the amino acid residues encoded by exon 20 is shown in SEQ ID NO: 49

[0276]

[0277] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 20 and the amino acid residues encoded by exon 21 is shown in SEQ ID NO: 50

[0278]

[0279] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 21 and the amino acid residues encoded by exon 22 is shown in SEQ ID NO: 51

[0280]

[0281] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 22 and the amino acid residues encoded by exon 23 is shown in SEQ ID NO: 52

[0282]

[0283] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 23 and the amino acid residues encoded by exon 24 is shown in SEQ ID NO: 53

[0284]

[0285] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 24 and the amino acid residues encoded by exon 25 is shown in SEQ ID NO: 54

[0286]

[0287] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 25 and the amino acid residues encoded by exon 26 is shown in SEQ ID NO: 55

[0288]

[0289] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 26 and the amino acid residues encoded by exon 27 is shown in SEQ ID NO: 56

[0290]

[0291] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 27 and the amino acid residues encoded by exon 28 is shown in SEQ ID NO: 57

[0292]

[0293] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is cleaved between the amino acid residues encoded by exon 28 and the amino acid residues encoded by exon 29 is shown in SEQ ID NO: 58

[0294]

[0295] The nucleotide sequence of C-Otof after codon optimization after the full-length OTOF protein is split between the amino acid residues encoded by exon 29 and the amino acid residues encoded by exon 30 is shown in SEQ ID NO: 59

[0296]

[0297] Nucleotide sequence of WPRE + SV40 poly(A) signal (717 bp): SEQ ID NO: 60

[0298] AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGACTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCAGATCTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA

[0299] Nucleotide sequence of WPRE (589 bp): SEQ ID NO: 61

[0300] AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGACTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC

[0301] Nucleotide sequence of the SV40 poly(A) signal (122 bp): SEQ ID NO:62

[0302] AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA

[0303] Nucleotide sequence of WPRE3 - SV40 late poly(A) (432 bp): SEQ ID NO:63

[0304] GATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATCTAGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCGG

[0305] Nucleotide sequence of WPRE3: SEQ ID NO:64

[0306] GATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTT

[0307] Nucleotide sequence of SV40 late poly(A) signal: SEQ ID NO:65

[0308] TATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATCTAGCTTTATTTGTGAAATTTGGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCGG

[0309] Design of qPCR primers on ITR sequences

[0310] Upstream primer: 5'-GGAACCCCTAGTGATGGAGTT-3' (SEQ ID NO: 66)

[0311] Downstream primer: 5'-CGGCCTCAGTGAGCGA-3' (SEQ ID NO: 67)

[0312] Sequences in polyA:

[0313] AATAAA (SEQ ID NO: 68), ATTAAA (SEQ ID NO: 69), AGTAAA (SEQ ID NO: 70), CATAAA (SEQ ID NO: 71), TATAAA (SEQ ID NO: 72), GATAAA (SEQ ID NO: 73), ACTAAA (SEQ ID NO: 74), AATATA (SEQ ID NO: 75), AAGAAA (SEQ ID NO: 76), AATAAT (SEQ ID NO: 77), AAAAAA (SEQ ID NO: 78), AATGAA (SEQ ID NO: 79), AATCAA (SEQ ID NO: 80), AACAAA (SEQ ID NO: 81), AATCAA (SEQ ID NO: 82), AATAAC (SEQ ID NO: 83), AATAGA (SEQ ID NO: 84), AATTAA (SEQ IDNO:85) or AATAAG (SEQ ID NO:86)

[0314] While the exemplary embodiments of the present invention have been described above, it should be understood by those skilled in the art that these disclosures are merely exemplary and that various other substitutions, adaptations, and modifications may be made within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments listed herein.

Claims

1. A dual vector system for expressing an OTOF protein, comprising a first nucleic acid vector and a second nucleic acid vector, wherein The first nucleic acid vector comprises a first nucleotide sequence; and the second nucleic acid vector comprises a second nucleotide sequence; The first nucleotide sequence comprises an expression cassette inserted between two first ITR sequences; The second nucleotide sequence comprises an expression cassette inserted between two second ITR sequences; The expression cassette of the first nucleotide sequence comprises a promoter, an N-terminal coding sequence of OTOF, a splice donor (SD) sequence, a sequence for homologous recombination with the second nucleotide sequence, and polyA; The expression cassette of the second nucleotide sequence comprises a promoter, a sequence that undergoes homologous recombination with the first nucleotide sequence, a splice acceptor (SA) sequence, a C-terminal coding sequence of OTOF, and polyA; and An OTOF cleavage site is provided in the OTOF amino acid sequence, for example, the OTOF amino acid sequence is as shown in SEQ ID NO: 1 or a functional fragment thereof, for example, an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 1; The N-terminal coding sequence of OTOF is the nucleotide coding sequence from the N-terminus of the OTOF amino acid sequence to the OTOF cleavage site; the C-terminal coding sequence of OTOF is the nucleotide coding sequence from the amino acid after the OTOF cleavage site to the C-terminus of the OTOF amino acid sequence.

2. The dual vector system for expressing OTOF protein according to claim 1, wherein: The OTOF cleavage site is located at the 3' terminal amino acid residue of any one of exons 17-29 encoded in the OTOF amino acid sequence.

3. The dual vector system for expressing OTOF protein according to claim 1, wherein: The promoter of the expression cassette of the first nucleotide sequence or the second nucleotide sequence is selected from the group consisting of a CAG promoter, a CMV promoter, a CBA promoter, a UbC promoter, a SFFV promoter, an EF1α promoter, a PGK promoter, or promoters of genes encoding Myo7A, Myo15, Atoh1, POU4F3, Lhx3, Myo6, α9AchR, α10AchR, OTOF, and STRC; The polyA of the expression cassette of the first nucleotide sequence or the second nucleotide sequence comprises AATAAA (SEQ ID NO: 68) and a variant of AATAAA; the variant of AATAAA comprises ATTAAA (SEQ ID NO: 69), AGTAAA (SEQ ID NO: 70), CATAAA (SEQ ID NO: 71), TATAAA (SEQ ID NO: 72), GATAAA (SEQ ID NO: 73), ACTAAA (SEQ ID NO: 74), AATATA (SEQ ID NO: 75), AAGAAA (SEQ ID NO: 76), AATAAT (SEQ ID NO: 77), AAAAAA (SEQ ID NO: 78), AATGAA (SEQ ID NO: 79), AATGAA (SEQ ID NO: 80), AACAAA (SEQ ID NO: 81), AATCAA (SEQ ID NO: 82), AATAAC (SEQ ID NO: 83), AATAGA (SEQ ID NO: 84), AATTAA (SEQ ID NO: 85) or AATAAG (SEQ ID NO: 86); for example, the polyA is the same as SEQ a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the poly A signal sequence shown in SEQ ID NO:62 or SEQ ID NO:65; and Each of the two first ITR sequences and the two second ITR sequences is derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9.

4. The dual vector system for expressing OTOF protein according to claim 1, wherein: The expression cassette of the first nucleotide sequence or the second nucleotide sequence further comprises an expression control element and / or a tag element, for example, the expression control element is a woodchuck hepatitis posttranscriptional regulatory element (WPRE) or a variant thereof, preferably a WPRE truncated variant, for example, a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with the nucleotide sequence shown in SEQ ID NO: 61, for example, the nucleotide sequence shown in SEQ ID NO: 64; for example, the tag element is HA.

5. The dual vector system for expressing OTOF protein according to claim 1, wherein: The sequence that undergoes homologous recombination with the first nucleotide sequence and the sequence that undergoes homologous recombination with the second nucleotide sequence are intron sequences, For example, an intron sequence that does not naturally occur in the genomic sequence of a gene encoding an OTOF protein, For example, the intron sequence is the recombination-inducing AK sequence of F1 phage, such as the sequence shown in SEQ ID NO:

6.

6. The dual vector system for expressing OTOF protein according to claim 1, wherein: The first nucleotide sequence is inserted into a plasmid comprising two first ITR sequences, and the second nucleotide sequence is inserted into a plasmid comprising two second ITR sequences, for example, the plasmid comprising two first ITR sequences and the plasmid comprising two second ITR sequences are the same or different, for example, the plasmid is pAAV, pAAV-CMV, pX601, pX551 or pAAV-MCS plasmid.

7. The dual vector system for expressing OTOF protein according to any one of claims 1 to 6, wherein: The OTOF N-terminus and OTOF C-terminus cleaved by the OTOF cleavage site are shown in Table 1A ; Preferably, the OTOF N-terminal coding sequence is SEQ ID NO: 11 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 37, and the OTOF C-terminal coding sequence is SEQ ID NO: 24 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 50; The OTOF N-terminal coding sequence is SEQ ID NO: 12 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 38, and the OTOF C-terminal coding sequence is SEQ ID NO: 25 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 51; The OTOF N-terminal coding sequence is SEQ ID NO: 13 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 39, and the OTOF C-terminal coding sequence is SEQ ID NO: 26 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 52; The OTOF N-terminal coding sequence is SEQ ID NO: 14 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 40, and the OTOF C-terminal coding sequence is SEQ ID NO: 27 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 53; or The OTOF N-terminal coding sequence is SEQ ID NO: 20 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 46, and the OTOF C-terminal coding sequence is SEQ ID NO: 33 or a sequence having at least 90% sequence identity thereto, for example, an optimized sequence, such as the nucleic acid sequence shown in SEQ ID NO: 59; For example, pAAV-CMV plasmid is used as a vector.

8. The dual vector system for expressing OTOF protein according to any one of claims 1 to 7, wherein: The splice donor (SD) sequence essentially consists of the sequence shown in SEQ ID NO: 4; the splice acceptor (SA) sequence essentially consists of the sequence shown in SEQ ID NO:

5.

9. The dual vector system for expressing OTOF protein according to any one of claims 1 to 8, wherein the expression cassette of the first nucleotide sequence and the expression cassette of the second nucleotide sequence each comprise a combination of a WPRE nucleotide sequence and an SV40 polyadenylation sequence at the N-terminus of the 3'ITR sequence, for example, a nucleotide sequence as shown in SEQ ID NO: 60 or a nucleotide sequence that is at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 60; or a combination of a WPRE3 nucleotide sequence and an SV40 late polyadenylation sequence, for example, a nucleotide sequence as shown in SEQ ID NO: 63 or a nucleotide sequence that is at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:

63.

10. Adeno-associated virus packaging vector system, wherein: The packaging vector system comprises a dual-vector system for expressing the OTOF protein according to any one of claims 1-9, a vector carrying the AAV rep and cap genes, and a helper virus vector, which is packaged into an AAV vector. Preferably, the amino acid sequence of the OTOF protein is as shown in SEQ ID NO:

1.

11. The adeno-associated virus packaging vector system according to claim 10, wherein: The vector carrying AAV rep and cap genes is selected from AAV1, AAV2, AAV5, AAV8, AAV9, Anc80, PHP.eB, AAV-DJ and AAVrh.10 vectors; the helper virus vector is pHelper plasmid.

12. A method for packaging an adeno-associated virus, wherein: The adeno-associated virus packaging vector system according to claim 10 or 11 is transferred into host cells for packaging.

13. The method for packaging adeno-associated virus according to claim 12, wherein: The host cell is selected from Hela-S3 cells, HEK-293 cells, HEK-293T cells, HEK-293FT cells, A549 cells and Sf9 cells.

14. An adeno-associated virus obtained by the packaging method according to claim 12 or 13.

15. Use of the dual vector system for expressing OTOF protein according to any one of claims 1 to 9 or the adeno-associated virus according to claim 14 for preparing a medicament or preparation for treating deafness, hearing loss or hearing dysfunction.

16. A medicine or preparation for treating deafness, hearing loss or hearing dysfunction, prepared by the dual vector system for expressing OTOF protein according to any one of claims 1 to 9 or the adeno-associated virus according to claim 14, wherein: The adeno-associated virus is obtained by transferring the adeno-associated virus packaging vector system into a host cell for packaging. The adeno-associated virus packaging vector system includes a dual-vector system for expressing the OTOF protein, a vector carrying the AAVrep and cap genes, and a helper virus vector.

17. The drug or preparation according to claim 16, wherein The drug or preparation further comprises a neutral salt buffer, an acidic salt buffer, an alkaline salt buffer, glucose, mannose, mannitol, proteins, polypeptides, amino acids, antibiotics, chelating agents, adjuvants, preservatives, nanoparticles, liposomes and positive lipid particles.

18. The drug or preparation according to claim 16 or 17, wherein Injection through the round window, oval window, semicircular canal, posterior semicircular canal, and common canal of the cochlea; and single or multiple administration throughout life, with a total dose of 1×10 9 -1×10 13 Viral genome.