Method for traceless gene editing of gram-negative bacteria, vector and application thereof
By designing specific plasmid vectors and electroporation technology, combined with a dual screening system of sacB and galk genes, the problem of low gene editing efficiency of the CS strain of Bordetella pertussis was solved, efficient and scarless gene editing was achieved, the counter-screening efficiency was improved, and the amount of reagents used was reduced.
Patent Information
- Application Number
- CN202511147429.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-09-16
AI Technical Summary
Existing technologies make it difficult to efficiently perform gene editing on the CS strain of Bordetella pertussis, especially due to the low counter-screening efficiency, and the commonly used screening mechanism is not effective in this strain, resulting in low gene editing efficiency.
The plasmid vector structure is designed as p15A ori-plasmid transfer origin oriT-sacB promoter-sacB-resistance gene-galk promoter-galk-lac promoter-upstream homology arm-target gene-downstream homology arm. Combined with electroporation technology and specific culture medium screening conditions, forward and reverse screening are achieved to improve the efficiency of gene editing.
The gene editing efficiency of the CS strain of Bordetella pertussis was significantly improved, and the counter-screening efficiency was increased from less than 10% and 40% to more than 95%, reducing the amount of counter-screening reagents used, providing an efficient and scarless gene editing method suitable for non-model pathogens.
Smart Images

Figure CN120648718A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbial genetic engineering, and specifically relates to a method, a vector and use thereof for scarless gene editing of Gram-negative bacteria. Background Art
[0002] Homologous recombination is a common genetic modification technique. It relies on the bacterial recombination system itself, introducing engineered DNA containing homologous sequences (homologous arms) to the target gene into pathogenic bacteria. These homologous sequences can exchange with the target gene on the bacterial chromosome, thereby knocking out, replacing, or inserting new gene fragments. The efficiency of genetic recombination can be effectively improved through two recombination steps: resistance (forward) screening and reverse screening of genes.
[0003] The most frequently used anti-screening genes in Gram-negative bacteria are rpsL, sacB, I-SceI and galk These anti-screening genes are commonly used in genetic research and engineering modifications of Escherichia coli, Pseudomonas aeruginosa, and Bacillus subtilis. However, for non-model pathogenic bacteria such as Bordetella pertussis (B. pertussis), gene editing methods are relatively scarce, genome editing methods are not mature, and there are few related literature reports.
[0004] First, the metabolic mechanism of B. pertussis is somewhat different from that of common model bacteria, based on the counter-screening mechanism of growth metabolism, e.g. sacB and galk , which may not necessarily lead to efficient screening. Even the screening mechanisms employed by the CS and Tohama strains of B. pertussis may differ. Secondly, the protein expression regulation mechanisms of B. pertussis differ from those of common model engineered bacteria. Exogenous genes introduced via plasmids may not be correctly expressed in B. pertussis, or their expression levels may be difficult to control to an appropriate level for effective screening.
[0005] In 2012, Wasin et al. introduced exogenous DNA sequences by conjugative transfer and used restriction endonucleases for the first time. I-SceI The Tohama strain of pertussis (BAA-589) from Europe and America was screened by chloramphenicol screening mechanism and the gene-edited strain was successfully screened (Chinese patent CN104024400B). I-SceI The restriction endonuclease activity of gene expression is very strong, on the one hand, the lack of control conditions leads to I-SceI Leaky expression will lead to the first recombination of the strain being greatly inhibited. On the other hand, I-SceI The high pressure of genes makes bacteria prone toI-SceI In 2024, Wu Mei et al. from Shanghai Yuguan Company investigated the Tohama strain of pertussis (BAA-589) in Europe and America. sacB Genes and I–SceI After the gene failed, the foreign DNA sequence was finally introduced by electroporation, and the galk The gene was used as a counter-screening gene, and a culture medium containing 1%-3% 2-deoxy-D-galactose (DOG) was used to screen out the recombinant strain of B. pertussis (China CN117947054 A). The objects of the above scarless gene editing were all the Tohama pertussis strain.
[0006] However, the CS strain used in the production of pertussis vaccine in China has differences in growth metabolism, expression regulation, and key molecular gene sequences compared with the Tohama strain. How to improve the efficiency of counter-screening and achieve efficient and scarless gene editing of the CS strain of pertussis remains to be studied. Summary of the Invention
[0007] In order to solve the above-mentioned problems existing in the prior art, the object of the present invention is to provide a method, vector and use thereof for scarless gene editing of Gram-negative bacteria.
[0008] In order to achieve the above object, the present invention adopts the following technical solutions: The present invention provides a vector for scarless gene editing of Gram-negative bacteria, wherein the structure of the vector is plasmid replication origin p15A ori-plasmid transfer origin oriT- sacB Promoter- sacB -Resistance genes- galk Promoter- galk -lac promoter-upstream (5') homology arm-target gene-downstream (3') homology arm, wherein the direction of the resistance gene and the plasmid replication origin p15A ori is opposite to that of other genes on the plasmid.
[0009] Furthermore, the Gram-negative bacteria are non-model pathogenic bacteria.
[0010] Furthermore, the non-model pathogenic bacteria is Bordetella pertussis.
[0011] Furthermore, the Bordetella pertussis is a CS strain.
[0012] Furthermore, the nucleotide sequence of the target gene is a functional gene sequence or none, and the resistance gene is a gentamicin resistance gene GmR .
[0013] In the present invention, when the target nucleotide sequence is a functional gene sequence, the above-mentioned vector is used to knock in the functional gene; when the target nucleotide sequence is absent, the above-mentioned vector is used to knock out the gene.
[0014] Furthermore, the nucleotide sequence of the vector is shown as SEQ ID No. 5 or SEQ ID No. 7.
[0015] The present invention also provides a method for scarless gene editing of Gram-negative bacteria, comprising the following steps: 1) Introducing the above vector into competent cells of Gram-negative bacteria; 2) performing positive screening using a culture medium containing an antibiotic to obtain a primary recombinant strain; the antibiotic is the antibiotic corresponding to the resistance gene; 3) Reverse screening was performed using a culture medium containing 10%-25% sucrose and 0.05%-1.5% 2-deoxy-D-galactose to obtain a secondary recombinant strain.
[0016] Furthermore, the introduction method in step 1) is electroporation, and the electroporation parameters are set to: an electric shock cup electrode spacing of 0.1-5 mm, a capacitance of 15-35 μF, a resistance of 100-300 Ω, a voltage of 2000-3000 V, and an electroporation time of no more than 5.5 ms.
[0017] Furthermore, the electroporation parameters in step 1) are set as the distance between the electrodes of the shock cup is 1 mm, the capacitance is 25 μF, the resistance is 200 Ω, the voltage is 2500 V, and the electroporation time is no more than 5 ms.
[0018] Furthermore, in step 2), the culture medium is Bordet-Gengo solid culture medium, and the forward screening conditions are 30-40° C. for 1-15 days.
[0019] Furthermore, the forward screening conditions in step 2) are 35-37° C. for 5-7 days.
[0020] Furthermore, in step 3), the culture medium is a Bordet-Gengo solid culture medium containing 15% sucrose and 0.1% 2-deoxy-D-galactose, and the reverse screening conditions are 30-40° C. for 1-15 days.
[0021] Furthermore, the reverse screening conditions in step 3) are 30-40° C. for 5-7 days.
[0022] The present invention also provides use of the above-mentioned vector in preparing recombinant Gram-negative bacteria for scarless gene editing.
[0023] The present invention has achieved the following beneficial effects: The present invention provides a method for efficient and scarless gene editing of Bordetella pertussis, which overcomes the technical problem of low gene editing efficiency of non-model bacteria - Bordetella pertussis, and provides a new paradigm for the study of Bordetella pertussis gene editing methods. sacB Genes and galk When genes are combined, the double reverse screening system is more effective than using them alone. sacB Gene or galk The present invention also provides a plasmid vector for scarless gene editing of the genome of Bordetella pertussis or other non-model pathogens, the plasmid vector also contains an antibiotic positive screening gene expression cassette and sacB and galk The reverse screening gene expression cassette can adopt different screening modes or combinations according to the physiological characteristics of non-model bacteria to achieve scarless gene editing. This invention provides a new gene editing method for non-model bacteria and has good application prospects.
[0024] Definitions of terms used in the present invention: Unless otherwise stated, the initial definitions provided for the terms in this document apply to the terms throughout the specification; for terms not specifically defined herein, they should be given the meaning that a person skilled in the art would give them based on the disclosure and context.
[0025] The term "scarless gene editing" refers to the modification of a target gene without the introduction of additional DNA sequences. This modification is typically performed through homologous recombination: using upstream and downstream homologous arms at specific sites on either side of the target gene to be edited, forward screening is used to introduce the target gene nucleotide sequence and the screening gene nucleotide sequence into the genome. Reverse screening is then used to obtain a secondary recombinant strain that has deleted the screening gene nucleotide sequence but retained the target gene nucleotide sequence. Scarless editing allows for the stacking of multiple genetic modifications. In contrast, when scarring gene editing is performed using non-scarless methods, for example, resistance replacement methods, resistance genes are introduced simultaneously with successful modification.
[0026] The term "homologous arms" refers to flanking sequences upstream and / or downstream of the specific site where the target gene is to be inserted or replaced, or sequences that have at least 95% sequence identity with the flanking sequences. The length of the homology arms can generally be several hundred bp, or even more than 1000 bp.
[0027] The term "positive screening" refers to identifying integration of exogenous sequences into the B. pertussis genome by positively screening for the presence and / or expression of genes.
[0028] The term "counter-screening" refers to identifying deletion of a screening nucleotide sequence from the B. pertussis genome by the absence and / or non-expression of a counter-screening gene.
[0029] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.
[0030] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 Schematic diagram of the structure of pJZ-G-UD plasmid and pJZ-G-mS1 plasmid.
[0032] Figure 2 for sacB The genes were used for counter-screening of scarless gene editing in CS strains.
[0033] Figure 3 CS strain / UP-sacB + -galk + Sucrose tolerance test of strains.
[0034] Figure 4 for sacB Counter-screening experiment and strain genetic level detection.
[0035] Figure 5 CS strain / UP-sacB + -galk + Tolerance test of strains to DOG.
[0036] Figure 6 for galk Gene counter-screening experiment and strain gene level detection.
[0037] Figure 7 CS strain / UP-sacB + -galk + Sucrose / DOG tolerance test of strains.
[0038] Figure 8 for sacB / galk Gene counter-screening experiment and strain gene level detection. DETAILED DESCRIPTION
[0039] The raw materials and equipment used in the present invention are all known products and are obtained by purchasing commercially available products.
[0040] The following experiments, where no temperature is specified, are reactions conducted at room temperature, which is 25±5°C.
[0041] Example 1. Construction of plasmids pJZ-G-UD and pJZ-G-mS1 By gene synthesis and enzyme ligation, the gentamicin resistance gene and sacB Insertion of gene into suicide plasmid (with promoter) galk Sequence, so that the plasmid has gentamicin resistance, sacB and galk gene function, named pJZ-G; sacB The nucleotide sequence information of the gene is shown in SEQ ID No. 2; galk The nucleotide sequence information of the gene is shown in SEQ ID No. 1, and the nucleotide sequence information of the gentamicin resistance gene is shown in SEQ ID No. 3.
[0042] The upstream (5') homology arm (950 bp) - downstream (3') homology arm (1650 bp) sequence of the target gene to be edited, the pertussis toxin S1 subunit, was integrated into the plasmid pJZ-G multiple cloning region by gene synthesis and enzyme ligation to obtain the plasmid pJZ-G-UD; the nucleotide sequence information of the 5' homology arm (950 bp) - 3' homology arm (1650 bp) is shown in SEQ ID No. 4.
[0043] The plasmid pJZ-G-UD contains ori-p15A, oriT, gentamicin resistance gene ( GmR )、 sacB and galk The anti-screening gene, in which p15A ori is the origin of plasmid replication, oriT is the origin of plasmid transfer, and the multiple cloning site region contains 5' homology arms and 3' homology arms, and its structure is as follows Figure 1 Its nucleotide sequence information is shown in SEQ ID No.5.
[0044] Plasmid pJZ-G-UD was used to knock out the target gene to be edited, the S1 subunit.
[0045] The target gene (mS1) nucleotide sequence was inserted between the upstream (5') homology arm (950bp) and the downstream (3') homology arm (1650bp) in the multicloning region of the plasmid pJZ-G-UD by gene synthesis and enzyme ligation to obtain the plasmid pJZ-G-mS1; theoretically, the mS1 gene can be any target gene that can be introduced; in this embodiment, the mS1 nucleotide sequence specifically refers to the sequence after mutation of two specific sites of the target gene to be edited - the pertussis toxin S1 subunit; the nucleotide sequence information of 5' homology arm (950bp)-mS1-3' homology arm (1650bp) is shown in SEQ ID No.6. The plasmid pJZ-G-mS1 contains ori-p15A, gentamicin resistance gene ( GmR )、 sacB and galk The anti-screening gene, the multiple cloning site region contains 5' homology arm-mS1-3' homology arm, and its structure is as follows Figure 1 Its nucleotide sequence information is shown in SEQ ID No.7.
[0046] Plasmids pJZ-G-UD and pJZ-G-mS1 were used to achieve point mutations in the S1 subunit by knocking out the target gene to be edited and knocking in the target gene, respectively.
[0047] Example 2: Positive screening of gentamicin resistance gene for scarless gene editing of CS strain 2.1 Preparation of competent cells Wild-type Bordetella pertussis CS strain stored at -80°C was taken out of the refrigerator, quickly thawed in a 37°C water bath, and inoculated into 5 mL of SSM medium in a biosafety cabinet. The culture was incubated at 36 ± 1°C and 250 × rpm for 24 hours. The recovered bacterial solution was inoculated into 50 mL of SSM medium, and the final concentration of the bacteria after inoculation was adjusted to about 200 million CFU / mL. The culture was carried out at 36±1℃ and 250×rpm for 22-24 hours. The OD 550 = around 3.0; In a biosafety cabinet, collect the bacterial suspension in a 50 mL sterile centrifuge tube and centrifuge at 4°C, 4000 × g for 15 min to collect the bacteria. Resuspend the cells in 25 mL of ice-cold sterile double-distilled water and wash them by repeated gentle pipetting with a pipette. Centrifuge at 4000 × g for 15 minutes at 4°C to collect the cells again. Resuspend the cells in 10 mL of 10% (v / v) glycerol pre-cooled in an ice-water bath. Use a pipette and a sterile pipette to quickly and gently disperse the cells. Place the cells in ice water for 10 minutes and then centrifuge at 4°C, 4000 × g for 15 minutes to collect the cells. Repeat this step twice. Quickly resuspend and mix the cells with 1 mL of 10% (V / V) glycerol pre-cooled in an ice water bath, then aliquot 100 μL per tube and store at -80°C for later use or directly transfer to an ice water bath pre-cooled electroporation cuvette for electroporation.
[0048] 2.2 Electroporation and plate screening 1 Take out 100 μL of competent cells prepared in step 2.1 from the -80°C freezer and place on ice to thaw. At the same time, place the electroporation cuvette (1 mm spacing) and the plasmid pJZ-G-UD prepared in Example 1 on ice to pre-cool for 5 minutes. In a biosafety cabinet, add 1 μg of plasmid pJZ-G-UD to 100 μL of competent cells, mix well, and transfer to an electroporation cuvette. Operate in an ice-water bath throughout the process. Set the parameters to 2500V, 25μF, and 200Ω. Ensure that the bacterial and plasmid mixture is at the bottom of the electroporation cup. Wipe off the condensed water outside the electroporation tank, insert the electroporation cup, and start the electric pulse. After the electroporation, remove the sample pool as soon as possible, immediately add 1 mL of SSM medium preheated at 37°C, transfer to a sterile centrifuge tube, and resuscitate on a constant temperature shaker at 36±1°C and 250× rpm for 12 h. The bacterial solution was spread on a carbon-coated BG resistance plate containing 50 ppm gentamicin, cultured at 36±1°C for 5-7 days, and strains with positive gentamicin resistance were screened.
[0049] 2.3 Genetic level detection of recombinant strains Use a sterile pipette tip to pick up the single colony grown on the gentamicin resistance screening plate and streak it on a new gentamicin resistance BG plate, and dip the remaining bacteria on the pipette tip into 20uL sterile water as a PCR verification template; use plasmids sacB Primers and internal primers of the target gene to be edited, the pertussis toxin S1 subunit gene, were used to verify whether the first step of homologous recombination between the plasmid and the bacterial genome had occurred. Furthermore, primers specific for integration of the up-end homologous arm and the down-end homologous arm were used to verify whether the plasmid was integrated through single crossover of the upstream homologous arm or the downstream homologous arm. The primers used for PCR verification are listed in Table 1.
[0050] Table 1: Knockout recombination verification primer list A total of 4 single clones were picked out on the gentamicin resistance screening plate, and their PCR verification results were as follows: Figure 2 (Lane 1-4) shows that the primers Text Sacb s and Text Sacb as are in 1 # -4 # A 951 bp fragment was cloned from each strain (sacB gene sequence); Primers Text S1wb s, Text S1wb as can simultaneously clone the sequence fragments between the upstream and downstream homologous recombination arms and the sequence fragments of the upstream and downstream homologous recombination arms with the target gene; Primers Text up s, Text up as for 1 # -4 # The strain amplified a 1150bp fragment, while the primers Text down s and Text down as amplified a 2660bp fragment. # -4 # The strain underwent the first homologous recombination and the recombinant strain of Bordetella pertussis obtained by the first homologous recombination was named UP-sacB + -galk + The template for lane 5 is water, the template for lane 6 is the pJZ-G-UD plasmid, the template for lane 7 is the pJZ-G-mS1 plasmid, and the template for lane 8 is the wild-type pertussis strain.
[0051] Example 3 sacB Genes for counter-screening of scarless gene editing in CS strains 3.1 CS strain / UP-sacB + -galk + Sucrose tolerance test of strains use sacB During gene screening, a medium containing sucrose is required, so we tested the wild-type pertussis CS strain (hereinafter referred to as WT) and the strain constructed based on the CS strain. UP-sacB + -galk + The sensitivity of the bacteria to sucrose in the culture medium was tested. The above two strains were inoculated into SSM liquid medium for amplification, and then the OD of the two strains was adjusted to about 1 with SSM medium, and then the OD of the two strains was adjusted to 1 at 10 and 10 respectively. 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 Dilution multiple. UP-sacB + -galk + Bacteria were spotted onto carbon-based solid culture plates containing 0%, 5%, 10%, 15%, 20%, 25%, and 30% sucrose in a gradient pattern. After spotting, the plates were placed in a biosafety cabinet to dry and then incubated in an inverted manner at 36 ± 1°C for 5–7 days.
[0052] The results are as follows Figure 3 It was shown that when there was no sucrose in the culture medium, WT and UP-sacB + -galk + Both bacteria grew well, and the single colonies were large and dense. With the increase of sucrose concentration in the culture medium, when the sucrose concentration was 10-20%, the single colonies of the two colonies gradually became smaller and slightly sparse due to osmotic pressure, but there was no significant difference between the two. When the sucrose concentration reached 25%, the WT and UP-sacB + - galk + Bacterial growth was inhibited and UP-sacB + -galk + When the sucrose concentration reached 30%, the WT and UP-sacB + -galk + Bacteria cannot grow.
[0053] The above results show that: 1) The CS strain of pertussis is more tolerant to sucrose than the Tohama strain of pertussis. When the sucrose concentration in the patent (CN117947054 A) was increased to 10%, the Tohama strain of pertussis (BAA-589) did not grow at all. However, the present invention discovered for the first time that the growth of the CS strain of pertussis began to be significantly inhibited only when the sucrose concentration was above 25%, and the CS strain did not grow at all at a sucrose concentration of 30%. This shows that there are differences in physiological metabolic characteristics between the CS strain and the Tohama strain; 2) The CS strain of pertussis was integrated into the genome of the CS strain of Bordetella pertussis through the positive screening mechanism. sacB The gene can be expressed normally and shows a more obvious lethal effect than the wild type under the condition of 25% sucrose concentration.
[0054] 3.2 sacB Gene counter-screening experiment and strain gene level detection Considering that when the sucrose concentration is above 10%, the strain single clone gradually becomes smaller and the growth becomes sparse, so UP-sacB + -galk + The bacteria were streaked onto carbon-based solid culture plates containing 10%, 15%, 20%, or 25% sucrose, and cultured inverted at 36±1°C for 5–7 days. 10–20 single clones were selected from each plate and verified by PCR.
[0055] The results are as follows Figure 4 It was found that these selected monoclonal clones could be amplified using primers Text Sacbs and Text Sacb as.sacB Gene sequence fragments, which shows that under the current conditions, sacB The lethal pressure from the gene was insufficient to allow a second homologous recombination, or the efficiency of homologous recombination was very low (<10%), resulting in no secondary recombinant strains being selected. The reverse screening gene remained in the recombinant genome. In the PCR results for 10%, 15%, and 20% sucrose, the template in lane 21 was water, the template in lane 22 was the pJZ-G-UD plasmid, the template in lane 23 was the pJZ-G-mS1 plasmid, and the template in lane 24 was the wild-type pertussis strain. In the PCR results for 25% sucrose, the template in lane 9 was water, the template in lane 10 was the pJZ-G-UD plasmid, the template in lane 11 was the pJZ-G-mS1 plasmid, and the template in lane 12 was the wild-type pertussis strain.
[0056] Example 4 galk Genes for counter-screening of scarless gene editing in CS strains 4.1 CS strain / UP-sacB + -galk + Strain tolerance test to DOG use galk During gene screening, a culture medium containing DOG is required. Therefore, the present invention tests the wild-type pertussis CS strain (hereinafter referred to as WT) and the strain constructed based on the CS strain. UP-sacB + -galk + The sensitivity of the bacteria to DOG in the culture medium was tested. The above two strains were inoculated into SSM liquid culture medium for amplification, and then the OD of the two strains was adjusted to about 1 with SSM culture medium, and then the OD of the two strains was adjusted to 1 at 10 and 10, respectively. 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 Dilution multiple. UP-sacB + -galk + Bacteria were spotted onto carbon-based solid culture plates containing 0%, 0.5%, 1.0%, and 1.5% DOG in a gradient pattern, with two replicates for each sample. After spotting, the plates were placed in a biosafety cabinet to dry and then incubated inverted at 36 ± 1°C for 5–7 days.
[0057] The results are as follows Figure 5 As shown, when the carbon solid medium did not contain DOG, WT and UP-sacB + -galk +The bacteria can grow normally; with the increase of DOG concentration, WT bacteria grow normally at 0.5% DOG concentration. UP-sacB + -galk + When the DOG concentration increased to 1.0%, the growth of the WT strain was significantly inhibited, while UP-sacB + -galk + When the DOG concentration was increased to 1.5%, the wild-type strain also did not grow at all.
[0058] The above results indicate that: 1) The CS strain of pertussis is more sensitive to the lethality of DOG than the Tohama strain of pertussis. The wild-type Tohama strain of pertussis (BAA-589) in the patent (CN117947054 A) can tolerate at least 4% concentration of DOG. galk In the presence of the gene, the recombinant strain can be reverse-selected under conditions of 1-3% DOG concentration. However, the present invention discovered for the first time that the pertussis CS strain was completely unable to grow under conditions of 1.5% DOG concentration and the recombinant strain was completely unable to grow under conditions of 1.0% DOG concentration. Combined with the results of Example 3.1, it further proves that the CS strain and the Tohama strain have different physiological and metabolic characteristics; 2) The gene is integrated into the genome of the Bordetella pertussis CS strain through the positive selection mechanism. galk The gene is expressed normally and exhibits a significant lethal effect compared to the wild type at a DOG concentration of at least 0.5%. 3) DOG at certain concentrations is also physiologically toxic to the wild-type CS pertussis strain itself. When using DOG for recombinant screening of the CS pertussis strain, the DOG concentration must be strictly controlled.
[0059] 4.2 galk Gene counter-screening experiment and strain gene level detection Referring to the results of 4.1, 0.5% DOG is preferred as the reverse screening condition. up-sacB + [[ID= + The bacteria were spread on a carbon-based solid culture plate containing 0.5% DOG and incubated at 36±1°C for 5 to 7 days. A total of 14 single clones were selected, and their PCR verification results were as follows: As shown in lanes 1-14, primers Text Sacb s and Text Sacb as did not amplify bands, indicating that the strain A second recombination occurred under the action of the gene, and the sequences of the non-upstream and downstream homologous arms of the introduced sequence in the genome, including the sacB gene, were successfully lost. # , 3 #, 4 # , 6 # , 7 # , 8 # , 10 # and 13 # 1850 bp was amplified, primers Text S1wb s, Text S1wb as for lane 1 # , 3 # , 4 # , 6 # , 7 # , 8 # , 10 # and 13 # 319 bp was amplified, indicating that they underwent a second homologous recombination and knocked out the target gene to be edited on the strain genome at the downstream homology arm end, successfully achieving scarless editing of the target gene. # , 5 # , 9 # 1150 bp was amplified, indicating that the second recombination occurred upstream and the strain returned to the wild type; while lane 11 # , 12 # and 14 # The presence of both 1150 bp and 319 bp indicates an impure strain, with secondary recombination occurring in both upstream and downstream strains. The secondary recombination rate reached 100%. The PCR templates for lanes 1-14 are single colonies grown on DOG carbon-coated plates, the template for lane 15 is water, the template for lane 16 is the pJZ-G-UD plasmid, the template for lane 17 is the pJZ-G-mS1 plasmid, and the template for lane 18 is the wild-type pertussis strain.
[0060] Example 5 Genes and Counter-screening of scarless gene editing in CS strains by co-operation of genes 5.1 CS strain / + + Sucrose / DOG tolerance test of strains According to the results of different strains' tolerance to sucrose and DOG in Examples 3.1 and 4.1, the growth of the strains was inhibited to varying degrees under high concentrations of sucrose and DOG. So, can the combined action of sucrose and DOG further reduce the amount of screening reagents and improve the efficiency of reverse screening? The present invention tested the wild-type pertussis CS strain (hereinafter referred to as WT) and the strain constructed based on the CS strain. + +The sensitivity of the bacteria to low concentrations of sucrose and DOG in the culture medium. Because DOG is expensive and the CS strain of pertussis is more sensitive to DOG, the present invention fixed the sucrose concentration at 15% and focused on the effect of low concentrations of DOG on the strain. The bacteria were prepared as in Example 4.1 and spotted on carbon powder solid culture plates containing 0% DOG + 0% sucrose, 0% DOG + 15% sucrose, 0.05% DOG + 0% sucrose, 0.05% DOG + 15% sucrose, 0.1% DOG + 0% sucrose, and 0.1% DOG + 15% sucrose according to different dilution gradients, with two replicates for each sample. After spotting, the plates were placed in a biosafety cabinet to dry and then inverted and cultured at 36±1°C for 5 to 7 days.
[0061] The results are as follows As shown, when the carbon solid medium does not contain sucrose and DOG, the WT and + + The growth of both bacteria was inhibited by adding 15% sucrose to the culture medium. + + In the absence of 15% sucrose, the growth of the two strains was better than that of the addition of 15% sucrose, regardless of the presence or absence of low-concentration DOG. Adding 0.05% DOG to the culture medium could inhibit the growth of the two strains to a certain extent. + + The growth of bacteria was inhibited, and the addition of 15% sucrose further enhanced the lethal effect. Therefore, under the combined action of 15% sucrose and DOG, even at very low DOG concentrations, + + The bacteria were significantly inhibited.
[0062] 5.2 Gene counter-screening experiment and strain gene level detection Referring to the results of 5.1, 15% sucrose and 0.1% DOG are preferred as the reverse screening conditions. + + The bacteria were spread on carbon powder solid culture plates containing 0.1% DOG and 0.1% DOG + 15% sucrose (the results of the reverse screening of 15% sucrose alone are shown in Example 3.2), and after inverted culture at 36±1°C for 5-7 days, 20 single clones were picked out. The PCR results of the single clone strains on the 0.1% DOG plate are shown in Lanes 1-20; 0.1% DOG + 15% sucrose plate monoclonal strain PCR results are shown in Lanes 21-40. The PCR templates for lanes 1-20 are single clones grown on 0.1% DOG carbon powder solid plates, the PCR templates for lanes 21-40 are single clones grown on 15% sucrose + 0.1% DOG carbon powder solid plates, the template for lane 41 is water, the template for lane 42 is the pJZ-G-UD plasmid, the template for lane 43 is the pJZ-G-mS1 plasmid, and the template for lane 44 is the wild-type pertussis strain; Text S1wb s, Text S1wb as For most clones among 1-20 single clones, 1129bp and 319bp were amplified simultaneously, indicating that bacteria with and without secondary recombination may exist at the same time. # , 4 # , 5 # and 6 # 319bp was amplified alone, indicating that 0.1% concentration of DOG alone allowed + + The efficiency of the second homologous recombination in bacteria is not high enough, with a recombination rate of about 20%; the same primers only amplified 1129bp and 319bp in lane 29#, indicating that bacteria that have undergone secondary recombination and those that have not may exist at the same time.
[0063] Only 1129 bp were amplified for 21#, 24#, 31#, and 40#, indicating that secondary recombination also occurred. However, this secondary recombination also occurred in the upstream homology arm, and the bacteria returned to the wild-type state. The other monoclonal strains all underwent secondary recombination, and this occurred in the downstream homology arm, ultimately removing the selection gene and knocking out the target gene in the strain genome, successfully achieving scarless editing of the target gene.
[0064] The above results show that under the combined action of 15% sucrose and 0.1% DOG, + + The homologous recombination rate of the bacteria was significantly improved, with the secondary homologous recombination rate increasing from 20% under 0.1% DOG alone and less than 10% under 15% sucrose alone to over 95%. Combining the experimental results of 3.2 and 4.2, the dual screening system effectively reduced the single DOG concentration while maintaining a high recombination rate. Compared with patent CN117947054 A, the DOG concentration was reduced by more than 10 times.
[0065] In summary, the present invention provides a method for efficient and scarless gene editing of Bordetella pertussis, which overcomes the technical problem of low gene editing efficiency of non-model bacteria - Bordetella pertussis, and provides a new paradigm for the study of Bordetella pertussis gene editing methods. Genes and When genes are combined, the double reverse screening system is more effective than using them alone. Genes and The present invention provides a plasmid vector for scarless gene editing of the genome of Bordetella pertussis or other non-model pathogens, the plasmid vector also contains an antibiotic positive screening gene expression cassette and and The reverse screening gene expression cassette can adopt different screening modes or combinations according to the physiological characteristics of non-model bacteria to achieve scarless gene editing. This invention provides a new gene editing method for non-model bacteria and has good application prospects.
[0066] The nucleotide sequences involved in the specific embodiments of the present invention are as follows: The nucleotide sequence of the gene (SEQ ID No. 1): The nucleotide sequence of the gene (SEQ ID No. 2): Nucleotide sequence of the gentamicin resistance gene (SEQ ID No. 3): ATGTTACGCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAAGTATGGGCATCATTCGCACATGTAGGCTCGGCCCTGACCAAGTCAAATCCATGCGGGCTGCTCTTG ATCTTTTCGGTCGTGAGTTCGGAGACGTAGCCACCTACTCCCAACATCAGCCGGACTCCGATTACCTCGGGAACTTGCTCCGTAGTAAGACATTCATCGCGCTTGCTGCCTTCGACCAAGAAGCGGTTGTTGGC GCTCTCGCGGCTTACGTTCTGCCCAAGTTTGAGCAGCCGCGTAGTGAGATCTATATCTATGATCTCGCAGTCTCCGGCGAGCACCGGAGGCAGGGCATTGCCACCGCGCTCATCAATCTCCTCAAGCATGAGG CCAACGCGCTTGGTGCTTATGTGATCTACGTGCAAGCAGATTACGGTGACGATCCCGCAGTGGCCTCTATACAAAGTTGGGCATACGGGAAGAAGTGATGCACTTTGATATCGACCCAAGTACCGCCACCTAA 5' homology arm (950 bp) - 3' homology arm (1650 bp) nucleotide sequence information (SEQ ID No. 4): Plasmid pJZ-G-UD nucleotide sequence information (SEQ ID No. 5): 5' homology arm (950 bp) - mS1 - 3' homology arm (1650 bp) nucleotide sequence information (SEQ ID No. 6): Plasmid pJZ-G-mS1 nucleotide sequence information (SEQ ID No. 7):
Claims
1. A vector for scarless gene editing of Gram-negative bacteria, characterized in that: The structure of the vector is plasmid replication origin p15A ori- plasmid transfer origin oriT- sacB Promoter- sacB -Resistance genes- galk Promoter- galk -lac promoter-upstream (5') homology arm-target gene-downstream (3') homology arm, wherein the direction of the resistance gene and the plasmid replication origin p15A ori is opposite to that of other genes on the plasmid.
2. The carrier according to claim 1, characterized in that The Gram-negative bacteria are non-model pathogenic bacteria.
3. The carrier according to claim 2, characterized in that The non-model pathogenic bacteria is Bordetella pertussis.
4. The carrier according to any one of claims 1 to 3, characterized in that The nucleotide sequence of the target gene is a functional gene sequence or none, and the resistance gene is a gentamicin resistance gene GmR .
5. A method for scarless gene editing of Gram-negative bacteria, characterized in that: The method comprises the following steps: 1) introducing the vector according to any one of claims 1 to 4 into competent cells of Gram-negative bacteria; 2) performing positive screening using a culture medium containing an antibiotic to obtain a primary recombinant strain; the antibiotic is the antibiotic corresponding to the resistance gene; 3) Reverse screening was performed using a culture medium containing 10% to 25% sucrose and 0.05% to 1.5% 2-deoxy-D-galactose to obtain a secondary recombinant strain.
6. The method according to claim 5, characterized in that Step 1) The introduction method is electroporation, and the electroporation parameters are set as: an electric shock cup electrode spacing of 0.1-5 mm, a capacitance of 15-35 μF, a resistance of 100-300 Ω, a voltage of 2000-3000 V, and an electroporation time of no more than 5.5 ms.
7. The method according to claim 6, characterized in that Step 1) The electroporation parameters are set as follows: the distance between the electrodes of the shock cup is 1 mm, the capacitance is 25 μF, the resistance is 200 Ω, the voltage is 2500 V, and the electroporation time is no more than 5 ms.
8. The method according to claim 5, characterized in that Step 2) The culture medium is Bordet-Gengo solid medium, and the forward screening conditions are 30-40° C. for 1-15 days.
9. The method according to claim 5, characterized in that: Step 3) The culture medium is a Bordet-Gengo solid medium containing 15% sucrose and 0.1% 2-deoxy-D-galactose, and the reverse screening conditions are 30-40° C. for 1-15 days.
10. Use of the vector according to any one of claims 1 to 4 in preparing recombinant Gram-negative bacteria for scarless gene editing.
Citation Information
Patent Citations
Modified Bordetella pertussis strain
CN104024400B
Chimeric virus, and preparation method and application thereof
CN103205460A
Myxococcus flavus large-fragment knockout plasmid and knockout method thereof
CN114032248A
Seamless gene editing method for bordetella pertussis
CN117947054A
Efficient traceless gene knockout vector for pichia pastoris and application of efficient traceless gene knockout vector
CN118374535A
Cited By
Attenuated bordetella pertussis recombinant strain as well as construction method and application thereof
CN120624499A
A recombinant attenuated bordetella pertussis strain and its construction method and application
CN120624499B
High-efficiency traceless gene editing method for bordetella pertussis, vector and application thereof
CN121538244A
A method, vector and application thereof for high-efficiency scarless gene editing of bordetella pertussis
CN121538244B