A cytoplasm-specific gene delivery system for expressing PPM1K and a preparation method and application thereof

By constructing a recombinant AAV vector that specifically expresses PPM1K in the cytoplasm, the lack of regulation of PPM1K cytoplasmic expression in existing technologies has been addressed, enabling precise regulation of Desmin phosphorylation, restoring cardiomyocyte function, and providing a precise treatment strategy for heart failure.

CN120661636BActive Publication Date: 2026-06-26INST OF LAB ANIMAL SCI CHINESE ACAD OF MEDICAL SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF LAB ANIMAL SCI CHINESE ACAD OF MEDICAL SCI
Filing Date
2025-06-12
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing technologies cannot precisely regulate Desmin phosphorylation levels by specifically modulating the cytoplasmic expression of PPM1K, resulting in a lack of precision and long-term efficacy in treatment strategies for heart failure and related diseases.

Method used

A recombinant AAV vector expressing PPM1K in cytoplasm was constructed. By adding a detectable tag to the C-terminus, the virus was packaged and purified using HEK293T cells to prepare a recombinant adeno-associated virus expressing PPM1K in cytoplasm. The AAV9 serotype was selected to achieve precise targeting and long-term expression in cardiomyocytes.

Benefits of technology

It achieves precise regulation of Desmin phosphorylation in cardiomyocytes, restores cardiac contractile function, inhibits myocardial remodeling, and improves metabolism, providing a revolutionary treatment strategy for heart failure and related diseases, with significant scientific value and clinical translational potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120661636B_ABST
    Figure CN120661636B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of cytoplasm-specific expression PPM1K gene delivery system and its preparation method and application, belong to gene delivery system preparation technical field.The gene delivery system is preferably adeno-associated virus (AAV), and its preparation method specifically includes the following steps: PPM1K gene or its functional variant is inserted into vector, detectable label is added at C-terminal, and recombination plasmid is formed;Recombinant plasmid is transformed into competent e. coli and is amplified, after plasmid is screened, recombination AAV plasmid is obtained;Recombinant AAV plasmid, auxiliary plasmid and capsid plasmid are co-transfected into packaging cell using transfection reagent, after transfection, cell and culture supernatant are collected, freeze-thaw buffer is added repeatedly freeze-thaw, and cell lysate is obtained;After centrifugation of cell lysate, supernatant is taken, and purified filtration is carried out.The present application realizes the cell compartment specificity expression of treatment gene by vector design, and shows significant treatment effect and safety advantage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene delivery system preparation technology, specifically, it relates to a gene delivery system for cytoplasmic specific expression of PPM1K, its preparation method and application. Background Technology

[0002] Heart failure (HF) is the end-stage of many cardiovascular diseases, characterized by reduced myocardial contractility, myocardial remodeling, and metabolic disorders. Despite significant advancements in drug therapy, medical devices, and surgery, the incidence, mortality, and readmission rates of HF remain high, posing a major global public health challenge. Current treatments still face significant challenges in disease correction, end-stage management, and personalized precision medicine, necessitating breakthrough therapies to fill clinical gaps.

[0003] Current drug treatments mainly include diuretics, angiotensin-converting enzyme inhibitors, beta-blockers, and aldosterone antagonists, whose mechanisms of action are limited to hemodynamic regulation, neuroendocrine inhibition, and correction of metabolic disorders. However, these treatments can only relieve symptoms and slow disease progression, but cannot reverse cardiomyocyte damage and fibrotic remodeling. For example, while neuroendocrine antagonists can improve prognosis, they lack direct intervention in core pathological processes such as abnormal phosphorylation of cardiomyocyte skeletal proteins. In addition, long-term use can easily cause side effects such as renal impairment and electrolyte disturbances, and individualized medication regimens are limited by the heterogeneity of patient pathological subtypes, making precise treatment difficult.

[0004] Gene therapy, as an emerging field, has shown potential in regulating cardiomyocyte function, but it still faces multiple obstacles: traditional gene delivery vectors, such as certain adenovirus vectors, suffer from high immunogenicity and poor targeting; gene transfection efficiency is low and expression is transient, making it difficult to maintain long-term therapeutic effects; existing strategies lack the ability to precisely regulate key pathological mechanisms such as abnormal phosphorylation of cardiomyocyte skeletal proteins. While existing AAV gene therapy has shown advantages in some aspects, it also has limitations, such as tissue targeting differences among different serotypes, potential immunogenicity, and insufficient precise control over the expression of specific intracellular compartments. Currently, there are no publicly reported methods to precisely regulate Desmin phosphorylation levels by specifically modulating the cytoplasmic expression of PPM1K, and to use this as a mature technical solution for the treatment of heart failure and related diseases. This invention addresses this gap by providing an innovative solution.

[0005] To address the aforementioned technical bottlenecks, this invention proposes a gene delivery system for cytoplasmic expression of PPM1K, its preparation method, and its application. By precisely regulating the phosphorylation level of Desmin in cardiomyocytes, it improves cardiac contractile function. Summary of the Invention

[0006] The purpose of this invention is to provide a gene delivery system for cytoplasmic expression of PPM1K, its preparation method, and its application in cardiovascular or muscle-related diseases, especially in heart failure drugs, thereby solving the problems existing in the prior art.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] A method for preparing recombinant AAV with cytoplasmic specific expression of PPM1K, specifically including the following steps:

[0009] S1. Gene expression design and vector construction: Using molecular cloning technology, the PPM1K gene or a functional mutant of the PPM1K gene is inserted into an AAV vector or other viral / non-viral vectors, and a detectable tag is added to the C-terminus to form a recombinant plasmid; the recombinant plasmid is transformed into competent E. coli and amplified, and after screening and extracting the plasmid, recombinant AAV or other viral / non-viral vector plasmids are obtained.

[0010] S2. Virus Packaging and Amplification: The recombinant AAV plasmid, helper plasmid, and capsid plasmid were co-transfected into the packaging cells using transfection reagents. After transfection, the cells and culture supernatant were collected, and the cells were repeatedly frozen and thawed with freeze-thaw buffer to obtain cell lysate. The cell lysate was centrifuged, and the supernatant was collected, purified, and filtered to obtain purified virus.

[0011] S3. The purified virus is preserved to obtain a recombinant adeno-associated virus that specifically expresses PPM1K in the cytoplasm.

[0012] Furthermore, a method for preparing a gene delivery system that specifically expresses PPM1K in the cytoplasm includes the following steps:

[0013] S1. Gene expression design and vector construction:

[0014] The PPM1K gene or its functional variants are inserted into an AAV vector using methods including but not limited to enzyme digestion and linking or other suitable molecular cloning techniques. A detectable tag is added to the C-terminus to form a recombinant plasmid. The recombinant plasmid is then transformed into competent Escherichia coli and amplified. After screening and extracting the plasmid, the recombinant AAV plasmid is obtained.

[0015] S2, Virus Packaging and Amplification:

[0016] HEK293T cells or other suitable packaging cells were co-transfected with recombinant AAV plasmid, helper plasmid and capsid plasmid using transfection reagent. After transfection, cells and culture supernatant were collected, and freeze-thawed repeatedly with freeze-thaw buffer to obtain cell lysate. After centrifugation of cell lysate, the supernatant was collected and purified by equivalent purification techniques including but not limited to ultrafiltration, chromatography or combinations thereof to obtain purified virus.

[0017] In the preparation process of step S2 above, the purification method described herein can be selected or combined by those skilled in the art based on actual production scale, cost control and purity requirements. Other known virus purification techniques can be used, such as density gradient centrifugation (e.g., cesium chloride density gradient centrifugation, iodixanol density gradient centrifugation), various types of chromatography techniques (e.g., ion exchange chromatography, affinity chromatography, molecular sieve chromatography, hydrophobic interaction chromatography, etc.) to purify the virus.

[0018] S3. The purified virus is stored at -80℃ to obtain a recombinant AAV that specifically expresses PPM1K in the cytoplasm.

[0019] During the above preparation process, it should be noted that: the present invention preferably achieves cytoplasmic-specific expression by deleting amino acids 2-87 from the N-terminus of PPM1K. However, those skilled in the art will understand that other modifications, such as introducing specific point mutations, partial sequence substitutions, or fusing cytoplasmic retention signals to the PPM1K protein, can achieve the purpose of the present invention as long as they can prevent PPM1K from entering the mitochondria and make it mainly localized in the cytoplasm while retaining its catalytic activity. These are equivalent substitution schemes that those skilled in the art can anticipate based on the teachings of the present invention.

[0020] Further, in step S1, the PPM1K gene functional mutant is a sequence modified to achieve cytoplasmic-specific expression and retain PPM1K catalytic activity, or a mitochondrial-targeting sequence deletion mutant with at least 80% sequence homology and retaining function.

[0021] Further, in step S1, the AAV vector is a recombinant adeno-associated virus vector containing an operable promoter in mammalian cells, a PPM1K target gene expression cassette, and a polyadenylation signal.

[0022] Preferably, in step S1, the AAV vector is a recombinant adeno-associated virus vector containing the CMV promoter PPM1K target gene expression cassette and the SV40PolyA polyadenylation signal.

[0023] It should be noted that the expression of the PPM1K gene described in this invention can be driven by a constitutive promoter (such as CMV), or tissue-specific promoters (such as myocardial-specific promoters cTnT, αMHC, etc.) or inducible promoters can be considered to further improve the specificity and controllability of expression. Future optimizations may also be made to other elements of the vector, such as codon optimization to improve expression efficiency, or modification of the ITR sequence to improve vector performance.

[0024] Furthermore, the AAV vector is an AAV vector that can effectively express PPM1K and target cardiomyocytes.

[0025] Furthermore, the AAV vector is a vector backbone corresponding to AAV serotypes such as AAV1, AAV2, AAV5, AAV6, AAV8, and AAVrh10.

[0026] Preferably, the AAV vector is pAV-CTNT-P2A-GFP.

[0027] Further, in step S1, the detectable tag is at least one of the following: HA tag, FLAG tag, and Myc tag.

[0028] Preferably, in step S1, the detectable tag is an HA tag. If an HA tag is used, its peptide tag amino acid sequence is preferably YPYDVPDYA or a derivative thereof, or other epitope tags such as FLAG (DYKDDDDK) or Myc (EQKLISEEDL) amino acid sequences, or nucleic acid sequences that can encode these amino acid sequences.

[0029] Furthermore, in step S1, competent Escherichia coli Stbl3 strain.

[0030] Furthermore, in step S1, the enzyme digestion and linking method specifically involves double digestion with AsiSI and MluI restriction endonucleases.

[0031] Furthermore, in step S1, the specific operations for screening and extracting plasmids are as follows:

[0032] The transformed bacterial culture was spread on LB solid medium containing ampicillin or other appropriate antibiotics and incubated overnight at 37°C. Single colonies were selected for PCR identification, and plasmids were extracted from positive clones. The extracted plasmids were used to verify whether the size of the inserted fragment matched the expected band, and finally, sequencing primers were used for verification.

[0033] Furthermore, the sequence of the forward primer in the sequencing primer is GCAGAAGTTGGTCGTGAGGCA (SEQ ID NO:1) or its functional equivalent, or a sequence with at least 80% sequence homology, and the sequence of the reverse primer is TCGCCGGACACGCTGAACT (SEQ ID NO:2) or its functional equivalent, or a sequence with at least 80% sequence homology.

[0034] Furthermore, in step S2, the helper plasmid is a plasmid containing the AAV Rep and Cap genes.

[0035] Furthermore, in step S2, the helper plasmid is a helper plasmid that can provide the trans-acting factors required for AAV replication and packaging, and can correspond to different AAV serotypes.

[0036] The AAV serotypes include, but are not limited to, AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, and AAVrh10.

[0037] In the above technical solutions, it should be noted that the present invention preferably uses the AAV9 serotype because it has good natural affinity for cardiomyocytes. However, other AAV serotypes (such as AAV1, AAV2, AAV5, AAV6, AAV8, AAVrh10, etc.) or genetically engineered AAV serotypes with specific tissue or cell targeting may also be applicable to the present invention. In addition, other types of viral vectors (such as lentiviral vectors, adenovirus vectors, etc., whose safety and immunogenicity need to be considered) or non-viral delivery systems (such as liposomes, polymer nanoparticles, exosomes, direct mRNA delivery technology, etc.) can also be considered for delivering the modified PPM1K gene or its functional variants to achieve cytoplasmic-specific expression in target cells.

[0038] Preferably, in step S2, the auxiliary plasmid is pAAV-RC and / or pAAV2 / 9-RC.

[0039] Furthermore, in step S2, the capsid plasmid is a plasmid containing an adenovirus helper gene.

[0040] Preferably, in step S2, the capsid plasmid is Adv-Helper.

[0041] Furthermore, in step S2, the specific operation of co-transfection is as follows:

[0042] The recombinant AAV plasmid, helper plasmid, capsid plasmid, and transfection reagent were added to Opti-MEM medium, incubated at room temperature for 5 minutes, mixed, and allowed to stand for 15 minutes before being added dropwise to cell culture dishes. After 6 hours of transfection, the medium was replaced with complete medium containing 10% FBS, and transfection was continued for 72 hours.

[0043] Furthermore, the ratio of the recombinant AAV plasmid, helper plasmid, and capsid plasmid is sufficient to effectively produce high-titer viruses.

[0044] Preferably, the ratio of the recombinant AAV plasmid, the helper plasmid, and the capsid plasmid is (1-2):(1-2):1.

[0045] Furthermore, in step S2, the total mass ratio of the recombinant AAV plasmid, helper plasmid, and capsid plasmid to the transfection reagent is sufficient to achieve efficient transfection.

[0046] Furthermore, in step S2, the total mass ratio of the recombinant AAV plasmid, helper plasmid, and capsid plasmid to the transfection reagent is 1:(1-5).

[0047] Furthermore, the HEK293T cells are passaged ≤20 times and the cell density is 70-80%.

[0048] Furthermore, the culture medium used for the HEK293T cells was obtained by adding 10 wt% FBS and 1 wt% penicillin-streptomycin mixture to DMEM medium, and the culture conditions were 37°C and 5% CO2.

[0049] Furthermore, the freeze-thaw cycle is 3-4 times.

[0050] Furthermore, the freeze-thaw temperatures are -80°C and 37°C.

[0051] Furthermore, the components of the freeze-thaw buffer include 10 mM Tris-HCl, 150 mM NaCl, and 1 mM MgCl2 at pH 8.0.

[0052] Furthermore, the centrifugation temperature is 0-4℃, the centrifugation rate is 10000-12000rpm, and the centrifugation time is 8-10 minutes.

[0053] The gene delivery system prepared by the above-mentioned method for cytoplasmic-specific expression of PPM1K is applied in diseases related to PPM1K dysfunction or abnormal Desmin phosphorylation.

[0054] The gene delivery system prepared by the above-mentioned method for cytoplasmic-specific expression of PPM1K can be used to prepare a gene delivery system for the treatment or prevention of cardiovascular diseases or skeletal muscle diseases and other diseases related to PPM1K dysfunction or abnormal Desmin phosphorylation.

[0055] It should be noted that, given the potential role of PPM1K and Desmin phosphorylation in other cardiovascular diseases (such as various types of cardiomyopathy, including dilated cardiomyopathy, hypertrophic cardiomyopathy, arrhythmic cardiomyopathy, etc.; myocardial fibrosis; ischemic heart disease, etc.) and certain skeletal muscle diseases (such as muscular dystrophy, myasthenia gravis, etc., where Desmin, as an important skeletal protein, may also be abnormally phosphorylated), the treatment strategies described in this invention may also be applicable to the treatment or prevention of these related diseases.

[0056] Furthermore, the cardiovascular diseases include, but are not limited to, heart failure, cardiomyopathy, and skeletal muscle diseases.

[0057] The application of the gene delivery system prepared by the above-mentioned method for cytoplasmic PPM1K-specific expression gene delivery system in adeno-associated virus particles.

[0058] Furthermore, the titer of the adeno-associated virus particles is preferably at least 1 × 10⁻⁶. 12vg / mL.

[0059] The gene delivery system prepared by the above-mentioned method for cytoplasmic-specific expression of PPM1K is used in drugs related to PPM1K dysfunction or abnormal Desmin phosphorylation.

[0060] Furthermore, the specific method of using the drug includes administering a therapeutically effective amount of the gene delivery system prepared as described in the foregoing technical solution, or a drug composition containing the gene delivery system, to a mammal.

[0061] Furthermore, the application is performed separately.

[0062] Furthermore, the application specifically refers to: being administered in combination with other heart failure treatment drugs or gene therapy agents.

[0063] Furthermore, the other heart failure treatment drugs or gene therapy agents include, but are not limited to, beta-blockers, angiotensin-converting enzyme inhibitors, angiotensin II receptor antagonists, diuretics, aldosterone receptor antagonists, enkephalinase inhibitors, and SGLT2 inhibitors.

[0064] The beneficial effects of this invention are:

[0065] The technical solution of this invention utilizes a gene delivery system that constructs a cytoplasmic-specific PPM1K overexpression pathway, preferably adeno-associated virus (AAV), to directly target the core pathological link in heart failure (abnormal Desmin phosphorylation). This system demonstrates significant advantages in restoring cardiac contractile function, inhibiting myocardial remodeling, and improving metabolism. Its precise targeting, long-term safety, and broad applicability provide a revolutionary treatment strategy for heart failure and related diseases, possessing significant scientific value and clinical translational potential.

[0066] Specifically, by deleting the mitochondrial targeting sequence of PPM1K (N-terminal 2-87aa): Ppm1k2-87aa Del-AAV9, or by employing other equivalent modifications to achieve cytoplasmic-specific expression of PPM1K, such as point mutations, partial sequence substitutions, or the addition of cytoplasmic retention signals, the protein function is restricted to the cytoplasm while preserving its core catalytic activity. This avoids metabolic interference that may be caused by traditional mitochondrial localization and precisely regulates the core pathological step of Desmin phosphorylation, enhancing therapeutic specificity and achieving long-term stable expression of PPM1K in cardiomyocytes, avoiding systemic off-target effects. The resulting gene delivery vector, especially adeno-associated virus, directly inhibits the abnormal phosphorylation of the cardiomyocyte cytoskeletal protein Desmin through its cytoplasmic-specific expression of PPM1K, restoring Desmin's function in maintaining cytoskeletal integrity and mechanotransmission, thereby enhancing myocardial contractility and significantly improving cardiac function indicators. Attached Figure Description

[0067] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0068] Figure 1 and Figure 2 The figure shows the test results of the expression level of PPM1K in the cytoplasm of mouse cardiomyocytes by the adeno-associated virus with cytoplasmic specific expression of PPM1K prepared in this invention.

[0069] Figure 3 This figure shows the effect of the cytoplasm-specific PPM1K adeno-associated virus prepared in this invention on the heart failure model. Detailed Implementation

[0070] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0071] It should be understood that the present invention is not limited to the specific structures, operating steps, or materials shown, and modifications and variations can be made by those skilled in the art based on the teachings of the present invention. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0072] Example 1

[0073] A method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K includes the following steps:

[0074] S1. Gene expression design and vector construction:

[0075] The PPM1K gene was inserted into the AAV vector using an enzyme digestion and ligation method, and an HA tag was added to the C-terminus to form a recombinant plasmid. The recombinant plasmid was transformed into competent E. coli and amplified. After plasmid extraction, specifically: the transformed bacterial culture was plated on LB solid medium containing ampicillin and incubated overnight at 37°C. Single colonies were selected for PCR identification, and plasmids were extracted from positive clones. The extracted plasmid was double-digested with AsiSI and MluI to verify whether the size of the inserted fragment met the expected band. The expected band was vector (~4.5kb) + inserted fragment (~1.2kb). Finally, sequencing primers were used for verification. The sequence of the forward primer was GCAGAAGTTGGTCGTGAGGCA (SEQ ID NO:1), and the sequence of the reverse primer was TCGCCGGACACGCTGAACT (SEQ ID NO:2), resulting in the recombinant AAV plasmid.

[0076] In this embodiment, the enzyme digestion and linking method specifically involves double digestion with AsiSI and MluI restriction endonucleases; in this embodiment, the AAV vector is pAV-CTNT-P2A-GFP, which contains a CMV promoter and an SV40 PolyA signal.

[0077] In this embodiment, the sequence of the PPM1K gene is shown in SEQ ID NO:3, and the protein it encodes has amino acids 2-87 deleted from the N-terminus to achieve cytoplasmic-specific expression. Those skilled in the art will understand that the PPM1K gene can refer to the coding sequence containing the amino acid sequence shown in SEQ ID NO:3, or a variant sequence that has at least 80% sequence homology with it, retains the catalytic activity of PPM1K, and can achieve cytoplasmic-specific expression. The HA tag added to the C-terminus is used for detection, and its amino acid sequence is YPYDVPDYA.

[0078] S2, Virus Packaging and Amplification:

[0079] HEK293T cells were co-transfected with recombinant AAV plasmid, helper plasmid, and capsid plasmid using transfection reagents. The specific procedures for co-transfection were as follows:

[0080] The recombinant AAV plasmid, helper plasmid, capsid plasmid, and transfection reagent were added to Opti-MEM medium, incubated at room temperature for 5 minutes, mixed, and allowed to stand for 15 minutes before being added dropwise to cell culture dishes. After 6 hours of transfection, the medium was replaced with complete medium containing 10% FBS, and transfection was continued for 72 hours. The ratio of recombinant AAV plasmid, helper plasmid, and capsid plasmid was 1:1:1, and the total mass of recombinant AAV plasmid, helper plasmid, and capsid plasmid was 1:3 to the mass of transfection reagent.

[0081] After transfection, cells and culture supernatant were collected, and freeze-thaw buffer was added for repeated freezing and thawing at -80℃ / 37℃ for 3 times to obtain cell lysis buffer. The freeze-thaw buffer consisted of 10mM Tris-HCl, 150mM NaCl, and 1mM MgCl2 at pH 8.0.

[0082] After centrifuging the cell lysate, the supernatant was collected at a temperature of 4°C, a centrifugation rate of 12,000 rpm, and a centrifugation time of 10 minutes. The supernatant was then purified by ultrafiltration through a 100 kDa ultrafiltration tube to obtain purified virus.

[0083] In this embodiment, the helper plasmid is pAAV-RC; the capsid plasmid is Adv-Helper; the HEK293T cells used are passaged ≤20 times, the cell density is 70%, and the culture medium is based on DMEM medium with the addition of a mixture of 10wt% FBS and 1wt% penicillin and streptomycin. The culture conditions are 37℃ and 5% CO2.

[0084] S3. The purified virus was stored at -80℃ to obtain a cytoplasm-specific PPM1K adeno-associated virus, with a titer of 3.64 × 10⁻⁶. 13vg / mL, and its specific sequence is: GCGATCGCCACCATGCCCAAAATTAGCCTGGAGAACGTGGGCTGTGCCTCTCTCATTGGCAAACGGAAAGAAAACGAAGATCGATTTGGGTTTGCACAGCTGACAGAAGAGGTGCTATACTTCGCAGTCTATGATGGACATGGGGGCCCTGCAGCCGCTGACTTCTGTCACACACACATGGAGAAATGTGTTATGGATTTGCTTCCTCGGGAGAAAGACTTGGAAACTGTCCTGACCTTGGCCTTTCTAGAAATAGATAAAGCCTTCGCGAGTTATGCCCACCTGTCTGCAGATGCAAGCCTCCTGACCTCTGGGACTACTGCAACAGTAGCCCTGTTGAGAGATGGTGTTGAACTGGTGGTAGCCAGTGTTGGAGACAGCCGGGCTCTTTTGTGTAGAAAAGGAAAACCCATGAAGCTGACCACTGACCATACCCCAGAAAGAAAAGATGAGAAAGAAAGGATCAAGAAATTCGGTGGGTTTGTAGCTTGGAATAGTTTGGGACAGCCCCATGTAAATGGCAGACTTGCAATGACAAGGAGTATCGGAGATTTGGATCTTAAAGCCAGTGGGGTAATTGCAGAACCTGAGACAACAAGGATTAAGCTCTACCATGCTGACGACAGTTTCCTGGTCCTTACCACAGATGGGATTAACTTCATGGTGAATAGTCAAGAGATCTGCGACTTTGTCAACCAGTGCCACGATCCTAAAGAAGCAGCTCATTCGGTGACTGAGCAGGCAATACAGTACGGTACCGAAGACAACAGCACTGCAGTAGTGGTGCCCTTTGGTGCTTGGGGAAAATACAAGAACTCTGAAATTACCTTCTCATTCAGCAGAAGCTTTGCCTCCAGTGGGAGATGGGCCTACCCATACGATGTTCCAGATTACGCTACGCGT(SEQ ID NO:3).

[0085] Experimental Example 1

[0086] Normal mice that have not undergone any gene editing or surgical intervention, of the C57BL / 6J strain, 8 weeks old, are designated as the WT group.

[0087] Experimental Example 2

[0088] The aortic arch ligation-induced heart failure model mouse strain was the C57BL / 6J mouse, 8 weeks old, designated as the TAC group.

[0089] Experimental Example 3

[0090] Mice with a heart failure model induced by aortic arch ligation (C57BL / 6J mice, 8 weeks old) were injected via tail vein with the virus prepared in Example 1, at a dose of 1×10⁻⁶. 12 vg / each, recorded as TAC-Del2-89 AAV9 group.

[0091] The expression level of PPM1K in the cytoplasm of cardiomyocytes in mice in the TAC group and TAC-Del2-89 AAV9 group was tested and compared with that in the sham control group (sham group, without aortic arch ligation).

[0092] Three days after TAC surgery, mice in each group were injected with Ppm1k 2-87aa Del-AAV9 via the tail vein at a dose of 1×10⁻⁶. 12 vg / mouse. After the experiment, hearts were taken from three groups of mice: Sham, TAC, and TAC&Ppm1k 2-87aa Del-AAV9. Cardiomyocytes were isolated from these three groups using the Langendorff ex vivo heart perfusion method, and cytoplasmic components were extracted. Western blotting was used to detect the expression level of PPM1K in the cytoplasm of these three groups of mouse cardiomyocytes. The test results are as follows: Figure 1 and 2 As shown.

[0093] exist Figure 1 and Figure 2 The results showed that the level of PPM1K in the cytoplasm of cardiomyocytes in the TAC & Ppm1k 2-87aa Del-AAV9 group was significantly higher than that in the TAC group, but not significantly different from that in the Sham group. These results suggest that Ppm1k 2-87aa Del-AAV9 specifically increases the level of PPM1K in the cytoplasm of cardiomyocytes in TAC mice.

[0094] The effects of the virus prepared in Example 1 on the heart failure model were then verified. EF% (ejection fraction), FS% (fractional shortening), and stroke volume were measured in mice in the WT group, TAC group, and TAC-Del2-89 AAV9 group. Specific test results are as follows: Figure 3 As shown.

[0095] Depend on Figure 3 The results showed that the EF%, FS%, and stroke volume of mice in the TAC-Del2-89 AAV9 group were significantly higher than those in the TAC group, while there was no significant difference compared to the WT group. This indicates that cardiac function was restored in TAC mice after adenovirus treatment.

[0096] In the description of this specification, the references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0097] The above description is merely an example and illustration of the concept of the present invention. Those skilled in the art can make various modifications or additions to the specific embodiments described or use similar methods to replace them, as long as they do not deviate from the concept of the invention or exceed the scope defined in the claims, they should all fall within the protection scope of the present invention.

Claims

1. A method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K, characterized in that, Specifically, the following steps are included: S1. Gene expression design and vector construction: The PPM1K gene is inserted into the AAV vector using enzyme digestion and linking or other suitable molecular cloning techniques. A detectable tag is added to the C-terminus to form a recombinant plasmid. The recombinant plasmid is transformed into competent E. coli and amplified. After screening and extracting the plasmid, the recombinant AAV plasmid is obtained. The sequence of the PPM1K gene is shown in SEQ ID NO:3; S2. Virus Packaging and Amplification: The recombinant AAV plasmid, helper plasmid, and capsid plasmid were co-transfected into the packaging cells using transfection reagents. After transfection, the cells and culture supernatant were collected, and the cells were repeatedly frozen and thawed with freeze-thaw buffer to obtain cell lysate. The cell lysate was centrifuged, and the supernatant was collected, purified, and filtered to obtain purified virus. S3. The purified virus is preserved to obtain a recombinant adeno-associated virus that specifically expresses PPM1K in the cytoplasm.

2. The method for preparing a gene delivery system for cytoplasmic specific expression of PPM1K according to claim 1, characterized in that, In step S1, the enzyme digestion and linking method specifically involves double digestion with AsiSI and MluI restriction endonucleases.

3. The method for preparing a gene delivery system for cytoplasmic specific expression of PPM1K according to claim 1, characterized in that, In step S1, the specific operations for screening and extracting plasmids are as follows: The transformed bacterial culture was spread on LB solid medium containing ampicillin and incubated overnight at 37°C. Single colonies were selected for PCR identification, and plasmids were extracted from positive clones. The extracted plasmids were used to verify whether the size of the inserted fragment matched the expected band, and finally, sequencing primers were used for verification.

4. The method for preparing a gene delivery system for cytoplasmic specific expression of PPM1K according to claim 3, characterized in that, The sequence of the forward primer in the sequencing primer is SEQ ID NO:1 or its functional equivalent, and the sequence of the reverse primer is SEQ ID NO:2 or its functional equivalent.

5. The method for preparing a gene delivery system for cytoplasmic specific expression of PPM1K according to claim 1, characterized in that, In step S2, the helper plasmid is a plasmid containing the AAV Rep and Cap genes.

6. The method for preparing a gene delivery system for cytoplasmic specific expression of PPM1K according to claim 1, characterized in that, In step S2, the capsid plasmid is a plasmid containing an adenovirus helper gene.

7. The method for preparing a gene delivery system for cytoplasmic specific expression of PPM1K according to claim 1, characterized in that, The recombinant AAV plasmid, helper plasmid, and capsid plasmid are in a ratio of 1-2:1-2:

1.

8. The method for preparing a gene delivery system for cytoplasmic specific expression of PPM1K according to claim 1, characterized in that, The total mass ratio of the recombinant AAV plasmid, helper plasmid, and capsid plasmid to the transfection reagent is 1:1-5.

9. A gene delivery system for cytoplasmic-specific expression of PPM1K, prepared by the method for preparing a gene delivery system for cytoplasmic-specific expression of PPM1K as described in any one of claims 1-8.

10. A gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 9, characterized in that, The gene delivery system is a recombinant AAV containing the following components: The PPM1K gene, its operable promoter in mammalian cells, and polyadenylation signaling.

11. The gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 10, characterized in that, The promoter that is operable in mammalian cells is the CMV promoter.

12. The gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 10, characterized in that, The polyadenylation signal is the SV40 PolyA signal.

13. The gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 9, characterized in that, The gene delivery system also includes a detectable tag.

14. The gene delivery system for cytoplasmic-specific expression of PPM1K according to claim 13, characterized in that, The detectable tag is at least one of the following: HA tag, FLAG tag, or Myc tag.

15. A recombinant adeno-associated virus particle, characterized in that... A gene delivery system comprising the method described in any one of claims 1-8.

16. A recombinant adeno-associated virus particle according to claim 15, wherein the titer of the virus particle is at least 1 × 10⁻⁶. 12 vg / mL.