SNP (Single Nucleotide Polymorphism) molecular marker for identifying cotton boll-shaped character and application of SNP molecular marker

By developing SNP molecular markers for identifying cotton boll shape traits and utilizing whole genome resequencing and PCR technology, the problem of coordinated regulation of cotton boll morphology and fiber development was solved, enabling early prediction and screening of high-yield and high-quality cotton, which is suitable for rapid automated screening.

CN120683304APending Publication Date: 2025-09-23SHIHEZI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510924343.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-04
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively analyze the coordinated regulatory mechanism of cotton boll morphology and fiber development, resulting in a negative correlation between cotton yield and fiber quality. In addition, cotton fiber quality traits are easily affected by low temperature and biological stress, making it difficult to achieve coordinated improvement of high yield and high quality.

Method used

By developing SNP molecular markers for identifying cotton boll shape traits, using whole genome resequencing technology to discover and verify three significantly associated SNP sites, and designing specific primers for PCR amplification and genotyping detection, early prediction and screening of cotton boll shape traits can be achieved.

Benefits of technology

It realizes the early prediction and screening of cotton boll shape traits, improves the synergistic improvement of cotton yield and fiber quality, and is suitable for rapid, high-throughput automated screening without being restricted by environment and season.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683304A_ABST
    Figure CN120683304A_ABST
Patent Text Reader

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) molecular marker for identifying cotton boll-shaped characters and application of the SNP molecular marker, and relates to the technical field of plant genetic engineering, and the nucleotide sequence of the SNP molecular marker is one or a combination of more of SEQ ID NO.1-6. The SNP molecular marker provided by the invention can be used for early prediction of cotton boll-shaped traits, screening and identification of cotton boll-shaped resources and genetic improvement of the cotton boll-shaped traits and has a wide application prospect, the detection result is expressed in a DNA form, detection can be performed in each tissue and development stage of cotton, the SNP molecular marker is not limited by environment and seasons, and the SNP molecular marker can be applied to early prediction of the cotton boll-shaped traits. The method does not have the influence of the problem of expression or not, does not need to analyze the length of a fragment, only needs SNP variation analysis, and is suitable for rapid, high-throughput and automatic screening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a SNP molecular marker for identifying cotton boll shape traits and an application thereof. Background Art

[0002] cotton( Gossypium spp.) is the world's most important natural textile fiber raw material. Its fiber yield and quality directly affect the market competitiveness and sustainable development of the textile industry chain. Currently, the global cotton industry faces dual challenges. First, due to the constraints of arable land resources and the impact of food security strategies, the contradiction between grain and cotton land is becoming increasingly prominent. It is urgent to ensure the total cotton output by shortening the reproductive cycle or increasing the yield level. Second, cotton fiber quality traits (such as micronaire value and breaking strength) are significantly affected by low temperature stress and biotic stress (such as pests and diseases) in the late reproductive growth period, resulting in fiber quality indicators failing to meet high-quality cotton standards. At the same time, there is a significant negative correlation between cotton fiber yield and quality.

[0003] In this context, the research value of cotton bolls' phenotypic characteristics (including geometric morphology, spatial distribution pattern and developmental dynamics) as the morphological carrier of cotton yield structure and fiber development is becoming increasingly prominent. In-depth analysis of the coordinated regulatory mechanism of cotton boll morphology construction and fiber development may provide new theoretical basis and technical path for breaking through the current production bottleneck and achieving coordinated improvement of yield and fiber quality.

[0004] From a yield perspective, the spatial distribution of bolls on the plant (lateral uniformity and longitudinal concentration) is crucial. Boll weight and boll number are key components of cotton yield. A compact plant shape and evenly distributed bolls can significantly increase planting density. Combined with an appropriate fruiting node position and plant height (for example, the ideal fruiting node for machine-harvested cotton in Xinjiang is ≥18 cm and plant height ≤80 cm), boll number per unit area can increase by over 15%. Furthermore, boll shell cracking characteristics and boll opening concentration directly determine the clean yield of mechanized harvesting. Evenly distributed bolls can reduce mechanical collision losses and effectively reduce trash content to ≤5%. Regarding fiber quality, boll morphology, particularly boll shell thickness, profoundly influences fiber cell development by regulating the internal microenvironment (such as humidity and temperature). Research has shown that varieties with thicker boll shells maintain a more stable internal environment, resulting in fiber length increases of 1.5-2.2 mm. Boll shape is also significantly correlated with fiber quality. Therefore, in-depth analysis of the genetic regulatory network of cotton boll shape traits and its interaction mechanism with environmental factors not only provides theoretical support for the selection of varieties with high picking rate and high density planting adaptability, but also opens up new paths for molecular design breeding for the targeted improvement of fiber quality (such as length and strength) and enhanced environmental adaptability (such as drought resistance). It is the core strategy for achieving the goals of high-yield, high-quality, high-efficiency and sustainable development of cotton.

[0005] Whole genome resequencing is the process of sequencing the genomes of different individuals of a species with an existing reference sequence, and using this as a basis for genetic difference analysis at the individual or population level. Through whole genome resequencing, researchers can find a large number of single nucleotide polymorphisms (SNPs), copy number variations (CNVs), insertion / deletions (InDels), structural variations (SVs), and other variation sites. These variation sites are used as molecular genetic markers and have been widely used in plant trait gene positioning cloning and molecular breeding research. Summary of the Invention

[0006] The purpose of the present invention is to provide a SNP molecular marker for identifying cotton boll shape traits and its application.

[0007] The present invention achieves the above-mentioned purpose through the following technical solutions: The present invention provides a SNP molecular marker for identifying the boll shape trait of cotton. The nucleotide sequence of the SNP molecular marker is one or more combinations of SEQ ID NOs. 1-6, as follows: (1) Located at base 101 of the nucleotide sequence shown in SEQ ID NO. 1-2, the genotype is A or C; (2) The 101st base of the nucleotide sequence shown in SEQ ID NO. 3-4 has a genotype of G or A; (3) Located at the 101st base of the nucleotide sequence shown in SEQ ID NO.5-6, the genotype is A or G.

[0008] The present invention also provides a use of the above-mentioned SNP molecular marker for identifying the boll shape trait of cotton in early prediction and screening and identification of cotton boll shape.

[0009] As a further optimization scheme of the present invention, cotton boll shape traits are identified based on SNP molecular markers, as follows: When the SNP molecular marker is the 101st base of the nucleotide sequence shown in SEQ ID NO.1-2, and the genotype is A, the cotton boll shape is a short round type; when the genotype is C, the cotton boll shape is a long pointed type; When the SNP molecular marker is the 101st base of the nucleotide sequence shown in SEQ ID NO.3-4, and the genotype is G, the cotton boll shape is a short round type; when the genotype is A, the cotton boll shape is a long pointed type; When the SNP molecular marker is the 101st base of the nucleotide sequence shown in SEQ ID NO.5-6, and the genotype is A, the boll shape is a short round type; when the genotype is G, the boll shape of the cotton is a long pointed type.

[0010] The present invention also provides a method for detecting the cotton boll shape trait using the SNP molecular marker for identifying the cotton boll shape trait as described above, comprising the following steps: (1) Extract DNA from the cotton to be tested; (2) Using the sequence containing the site where the SNP molecular marker is located and its upstream and downstream bases as the amplification template, PCR amplification is performed using primers that verify the SNP molecular marker to obtain an amplification product containing the site where the SNP molecular marker is located; (3) Perform genotyping on the amplified product to obtain the SNP genotype of the cotton variety to be tested.

[0011] As a further optimization solution of the present invention, in step (2), the primers for verifying the SNP molecular marker are specifically as follows: The primers for verifying SNP molecular markers (1) are: SEQ ID NO.7: F: TGAATTTCTGAGTCCTAAATCCTTAACCT; SEQ ID NO.8: R: ATGGACCATTCCTACTACATCAATCATG; The primers for verifying SNP molecular markers (2) are: SEQ ID NO.9: F: GCGACGGAACGATTTTTCGTAA; SEQ ID NO.10: R: ACCATTATCTGATCTGGCAGTTTAAACTA; The primers used to verify the SNP molecular marker (3) are: SEQ ID NO.11: F: TTATAAGATTGCTCGCATATGAGCAAG; SEQ ID NO. 12: R: ACATATACGATGTCATCATTTTCACCA.

[0012] As a further optimization scheme of the present invention, cotton boll shape traits are detected based on SNP molecular markers. In step (3), the SNP genotype is as follows: SNP molecular marker (1): If the SNP genotype is A, the boll shape of cotton is short and round; if the SNP genotype is C, the boll shape of cotton is long and pointed; SNP molecular marker (2): If the SNP genotype is G, the boll shape of cotton is short and round; if the SNP genotype is A, the boll shape of cotton is long and pointed; SNP molecular marker (3): If the SNP genotype is A, the boll shape of the cotton is short and round; if the SNP genotype is G, the boll shape of the cotton is long and pointed.

[0013] The beneficial effects of the present invention are: 1) The SNP molecular markers provided by the present invention can be used for early prediction of cotton boll shape traits, screening and identification of cotton boll shape resources, and genetic improvement of cotton boll shape traits, and have broad application prospects; 2) The SNP molecular markers provided by the present invention have detection results directly expressed in the form of DNA and can be detected in all tissues and developmental stages of cotton. They are not restricted by environment or season, and are not affected by issues such as expression. There is no need to analyze the length of the fragment, only + / - (positive / negative) analysis is required, making them suitable for rapid, high-throughput, and automated screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a comparison of the bell shapes of long-pointed bell-shaped cotton materials and short-round bell-shaped cotton materials; the left side is the long-pointed bell-shaped cotton material SD21-472, and the right side is the short-round bell-shaped cotton material Round Leaf M2.

[0015] Figure 2 The bell-shaped index statistical analysis results corresponding to the genotypes of the three SNP sites ( Figure 2 a is a comparison chart of the bell-shaped index corresponding to the two genotypes of SNP site A01-6587988; Figure 2 b is a comparison chart of the bell-shaped index corresponding to the two genotypes of SNP site A01-6704674; Figure 2 c is a comparison of the bell-shaped index corresponding to the two genotypes of SNP site A01-6907797), P < 0.01.

[0016] Figure 3 This is the statistical analysis result of the bell-shaped index corresponding to the combined SNP site genotype ( Figure 3 a is a comparison chart of the bell-shaped index corresponding to the two genotype combinations of SNP sites A01-6587988 and A01-6704674; Figure 3 b is a comparison chart of the bell-shaped index corresponding to the two genotype combinations of SNP sites A01-6587988 and A01-6907797; Figure 3 c is a comparison chart of the bell-shaped index corresponding to the two genotype combinations of SNP sites A01-6704674 and A01-6907797; Figure 3d is a comparison chart of the bell-shaped index corresponding to the three genotype combinations of SNP sites A01-6587988, A01-6704674 and A01-6907797), P < 0.01. DETAILED DESCRIPTION

[0017] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0018] 1. Materials The long pointed boll-shaped cotton material is SD21-472, and the short round boll-shaped cotton material is round-leaf M2, both of which can be obtained from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences / National Cotton Germplasm Resources Medium-term Bank.

[0019] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.

[0020] 2. Methods 2.1 Upland cotton ( Gossypiumhirsutum L . ) Bell-shaped trait survey The long pointed boll-shaped cotton material (SD21-472) and the short round boll-shaped cotton material (round leaf M2) were used as parents (the long pointed boll-shaped and the short round boll-shaped were compared). Figure 1 As shown in the figure, long-pointed boll-shaped cotton materials and short-round boll-shaped cotton materials were crossed to obtain F1, and the F2 population containing 720 individual plants was formed by self-pollination as the mapping population. The boll shape of individual plants in the F2 population was investigated. The lengths of three bolls in the middle and lower parts of the inner boll and the width of the widest part in the middle were measured on each plant, and the average length and width (mm) were calculated. The boll shape index (boll length / boll width) was used to judge the boll shape of cotton. Among them, the larger the boll shape index, the longer and more pointed the bolls were; the smaller the boll shape index, the shorter and rounder the bolls were.

[0021] 2.2 Whole-genome resequencing Based on the bell-shape index, individual strains from the F2 population with extreme bell-shape traits were selected for BSA-seq pool sequencing. Whole-genome resequencing of the two pools of DNA with different bell-shape traits was performed using high-throughput Illumina HiSeq™ sequencing technology. A total of 56.8 gigabytes of raw data were generated. The raw sequence fragments may contain adapters or low-quality bases. Quality control and data filtering yielded high-quality clean data for subsequent analysis. An average of 99.24% of bases had a base error rate below 1% (Q20), and an average of 97.44% had a base error rate below 0.1% (Q30), with normal GC distribution. An average of 264,238,181.5 high-quality reads were obtained for the two samples, and the average alignment rate of the sequencing data to the reference genome was 93.87%, meeting the requirements of subsequent experimental analysis.

[0022] 2.3 Development of SNP molecular markers Based on the cotton reference genome data, BSA-seq analysis of cotton boll shape traits identified a candidate interval of 4.37-9.17 Mb between chromosome A01 of cotton as the boll shape trait. Molecular markers were developed in this interval, with a total of 20 pairs of molecular markers developed, further narrowing the candidate interval to 32 kb. Statistical analysis of the genotypes and phenotypes of SNP sites in the candidate interval in the progeny revealed that three SNP sites were significantly associated with boll shape. The nucleotide sequences of the three SNP sites are shown in SEQ ID NOs. 1-6. The reference sequence is the upland cotton standard line TM 1, and the reference genome version number is SEQ ID NOs. Gossypium hirsutum / ZJU-TM1(https: / / www.cottongen.org / species / Gossypium hirsutum / ZJU-TM1), the allele loci information of the three SNP markers is shown in Table 1: Table 1 SNPs associated with boll shape in upland cotton ; 2.4 Validation of SNP markers in upland cotton Three SNP markers ( Figure 2 a:A01-6587988; Figure 2 b:A01-6704674; Figure 2 c: A01-6907797) was verified, as Figure 2 and Figure 3 As shown, the horizontal axis is the bell shape index (bell length / bell width, a small bell shape index value corresponds to a short round bell shape, and a large bell shape index value corresponds to a long pointed bell shape), and the vertical axis is the genotype; Figure 2The upper left corner shows the significance of the association between the SNP genotype and the phenotype, expressed as -log10 (P-value). Figure 2 and Figure 3 The results showed that all three SNP sites were significantly associated with the boll shape trait of cotton; specifically, for SNP site A01-6587988, the boll shape index of cotton with genotype C / C was significantly greater than that of cotton with genotype A / A; for SNP site A01-6704674, the boll shape index of cotton with genotype A / A was significantly greater than that of cotton with genotype G / G; for SNP site A01-6907797, the boll shape index of cotton with genotype G / G was significantly greater than that of cotton with genotype A / A.

[0023] 2.5 Development of SNP molecular markers and detection of cotton boll shape based on SNP loci (1) Extracting DNA from cotton leaves using the CTAB method ① Weigh 0.2 g of leaves into a centrifuge tube, cool with liquid nitrogen, and quickly grind thoroughly using a tissue grinder. Add 1 mL of CTAB solution that has been heated in a 65°C water bath, mix thoroughly, and place in a water bath at 65°C for 30 min, inverting every 10 min. ② After the water bath, remove the centrifuge tube and centrifuge at 4°C for 10 min. Take the supernatant and add 800 μL of a mixture of chloroform and isoamyl alcohol in a volume ratio of 24:1. Slowly invert the tube until it is mixed and no layers are separated. Centrifuge at 12,000 rpm for 10 min at 4°C. ③Repeat the previous step; ④ Transfer the supernatant to another 1.5 mL centrifuge tube, add 2 volumes of ice-cold isoamyl alcohol (pre-stored in a -20°C refrigerator) and 200 μL of sodium acetate solution, slowly invert until flocculent DNA appears, and let it stand for 30 minutes; ⑤ Centrifuge at 12000 rpm for 10 min at 4°C, discard the waste liquid, and wash twice with 70% (v / v) ethanol solution and once with anhydrous ethanol; ⑥ Dry overnight, add ddH2O, dissolve DNA until completely dissolved, and store at 4℃ until use.

[0024] (2) Specific primers were designed based on the three SNP sites mentioned above. The nucleotide sequences of the specific primers are shown in SEQ ID NO. 7-12 in Table 2: Table 2 Specific primer sequences ; (3) Using the cotton leaf DNA from step (1) as an amplification template, PCR amplification was performed using the primers designed in step (2) to obtain an amplified product containing the site where the SNP molecular marker is located. The specific PCR amplification reaction system is shown in Table 3: Table 3 PCR reaction system ; The reaction program of PCR amplification is shown in Table 4: Table 4 PCR reaction procedure ; (4) performing genotyping detection on the amplified product of step (3) to obtain the genotype of the SNP site of the cotton variety to be tested; The genotypes of the SNP loci and their corresponding cotton boll shape traits are as follows: SNP site A01-6587988: If the SNP genotype is A / A, the boll shape of the cotton is short and round; if the SNP genotype is C / C, the boll shape of the cotton is long and pointed; SNP site A01-6704674: If the SNP genotype is G / G, the boll shape of the cotton is short and round; if the SNP genotype is A / A, the boll shape of the cotton is long and pointed; SNP site A01-6907797: If the SNP genotype is A / A, the cotton boll shape is a short round type; if the SNP genotype is G / G, the cotton boll shape is a long pointed type.

[0025] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. A SNP molecular marker for identifying cotton boll shape traits, characterized in that: The nucleotide sequence of the SNP molecular marker is one or more combinations of SEQ ID NO. 1-6, specifically as follows: (1) Located at base 101 of the nucleotide sequence shown in SEQ ID NO. 1-2, the genotype is A or C; (2) The 101st base of the nucleotide sequence shown in SEQ ID NO. 3-4 has a genotype of G or A; (3) Located at the 101st base of the nucleotide sequence shown in SEQ ID NO.5-6, the genotype is A or G.

2. Use of the SNP molecular marker for identifying cotton boll shape traits as claimed in claim 1 in early prediction and screening of cotton boll shape.

3. The use according to claim 2, characterized in that The cotton boll shape traits were identified based on SNP molecular markers, as follows: When the SNP molecular marker is the 101st base of the nucleotide sequence shown in SEQ ID NO.1-2, and the genotype is A, the cotton boll shape is a short round type; when the genotype is C, the cotton boll shape is a long pointed type; When the SNP molecular marker is the 101st base of the nucleotide sequence shown in SEQ ID NO.3-4, and the genotype is G, the cotton boll shape is a short round type; when the genotype is A, the cotton boll shape is a long pointed type; When the SNP molecular marker is the 101st base of the nucleotide sequence shown in SEQ ID NO.5-6, and the genotype is A, the boll shape is a short round type; when the genotype is G, the boll shape of the cotton is a long pointed type.

4. A method for detecting cotton boll shape traits using the SNP molecular marker for identifying cotton boll shape traits according to claim 1, characterized in that: The following steps are involved: (1) Extract DNA from the cotton to be tested; (2) Using the sequence containing the site where the SNP molecular marker is located and its upstream and downstream bases as the amplification template, PCR amplification is performed using primers that verify the SNP molecular marker to obtain an amplification product containing the site where the SNP molecular marker is located; (3) Perform genotyping on the amplified product to obtain the SNP genotype of the cotton variety to be tested.

5. The method according to claim 4, characterized in that In step (2), the primers for verifying the SNP molecular marker are as follows: The primers for verifying SNP molecular markers (1) are: SEQ ID NO.7: F: TGAATTTCTGAGTCCTAAATCCTTAACCT; SEQ ID NO.8: R: ATGGACCATTCCTACTACATCAATCATG; The primers for verifying SNP molecular markers (2) are: SEQ ID NO.9: F: GCGACGGAACGATTTTTCGTAA; SEQ ID NO.10: R: ACCATTATCTGATCTGGCAGTTTAAACTA; The primers used to verify the SNP molecular marker (3) are: SEQ ID NO.11: F: TTATAAGATTGCTCGCATATGAGCAAG; SEQ ID NO. 12: R: ACATATACGATGTCATCATTTTCACCA.

6. The method according to claim 4, characterized in that The cotton boll shape trait is detected based on SNP molecular markers. In step (3), the SNP genotype is as follows: SNP molecular marker (1): If the SNP genotype is A, the boll shape of cotton is short and round; if the SNP genotype is C, the boll shape of cotton is long and pointed; SNP molecular marker (2): If the SNP genotype is G, the boll shape of cotton is short and round; if the SNP genotype is A, the boll shape of cotton is long and pointed; SNP molecular marker (3): If the SNP genotype is A, the boll shape of the cotton is short and round; if the SNP genotype is G, the boll shape of the cotton is long and pointed.