Multifunctional probiotic engineering bacteria capable of continuously producing melanin in vivo in situ and application thereof

Abstract

The application discloses a kind of in vivo sustained in situ melanin production multifunctional probiotic engineering bacteria and application thereof, the present application research uses probiotic ne's escherichia coli 1917 (EcN) to construct gene engineering bacteria EcN-Mel, EcN-Mel has the advantages of oral safety, sustained in situ melanin production, target inflammation site, multi-mechanism synergistic treatment acute radiation enteritis;Research finds that EcN-Mel is better than EcN in treating acute radiation enteritis;It has stronger free radical scavenging capacity, stronger ability to reduce inflammation level, stronger ability to increase intestinal beneficial flora and reduce harmful flora, stronger ability to target lesion site-intestinal inflammatory site, higher survival rate in gastric acid environment, longer residence time in intestinal inflammatory site, concentration is increased by about 3 times, more stable in vivo.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a multifunctional probiotic engineered bacterium that continuously produces melanin in situ and its applications. Background Technology

[0002] Acute radiation enteritis (ARN) is intestinal damage caused by a large dose of radiation to the abdomen or whole body. The main clinical manifestations are severe gastrointestinal symptoms. The disease progresses rapidly and is a difficult-to-treat acute radiation sickness.

[0003] Direct radiation damage to the gut and the resulting oxidative stress and dysbiosis are key pathological mechanisms of ARN. Radiation-induced DNA damage and free radical production can lead to severe tissue damage and inflammatory responses. This manifests as excessive reactive oxygen species (ROS) causing lipid peroxidation, DNA damage, and ferroptosis, activating pro-inflammatory signaling pathways such as NF-κB [1,2]. ROS levels are positively correlated with the severity of inflammation, forming a vicious cycle of "oxidative stress-inflammation" [3,4]. In addition, the role of gut microbiota in regulating gut health and radiation damage cannot be ignored. Radiation can significantly affect the structure of gut microbiota, leading to microbiota imbalance and thus aggravating intestinal damage. The regulation of gut microbiota plays an important role in the repair of intestinal damage, mitigating damage by promoting epithelial cell regeneration and immune regulation [5].

[0004] The limitations of existing antioxidant therapies are as follows:

[0005] Natural enzymes: Superoxide dismutase (SOD), catalase (CAT), etc. are highly effective, but they have drawbacks such as high cost, poor stability, and strong immunogenicity [6,7]. Small molecule antioxidants: Vitamin C / E, etc. have limited efficacy, single function, are difficult to store, expensive, and cannot specifically target lesions [8].

[0006] Clinical drugs such as 5-aminosalicylic acid (5-ASA) and glucocorticoids have problems with low bioavailability, systemic side effects and drug resistance [9-14].

[0007] Nanozymes: Nanozymes (such as CeO2 and MoSe2) remove ROS by mimicking enzyme activity, but they have significant drawbacks: complex preparation process, poor gastrointestinal stability; and unclear potential toxicity and metabolic mechanism of non-natural components

[15] .

[0008] Melanin: As a natural antioxidant, it has unique advantages: it can effectively scavenge free radicals such as O2·- and ·OH and promote the balance of intestinal flora; its acid resistance makes it suitable for oral delivery and it has high biosafety [16-19]. However, exogenous melanin needs to be extracted and purified, which is complicated and has insufficient targeting.

[0009] Probiotics: Escherichia coli Nissle 1917 (EcN) is a traditional probiotic with good biosafety. However, natural EcN has inherent defects in the treatment of radiation enteritis: lack of antioxidant function: lack of endogenous free radical scavenging system, unable to block the vicious cycle of "oxidative stress-inflammation"; limited microbial regulation: although it can inhibit pathogenic bacteria, it cannot actively promote the proliferation of beneficial bacteria such as verrucous microbes; low targeting efficiency: it depends on passive colonization, and the retention concentration at the site of inflammation is not high.

[20]

[0010] Genetically engineered bacteria: These bacteria secrete therapeutic substances in situ by colonizing the intestine, but existing systems have defects: the hosts are mostly non-probiotics (such as Escherichia coli, Bacillus, Trichoderma reesei, and Pichia pastoris expression systems), resulting in insufficient biosafety; complex surface modifications are required to improve gastrointestinal tolerance, leading to high process costs; and there is a lack of treatment options that directly utilize melanin secreted by probiotics [21-23].

[0011] Patent application number 202410412709.6, entitled "Recombinant Bacteria for Fermentation Preparation of Melanin Using Tyrosine as a Substrate and Its Application," discloses a recombinant bacterium for fermentation preparation of melanin using tyrosine as a substrate and its application, belonging to the field of microbial metabolic engineering technology. This invention uses *Escherichia coli* BL21(DE3) as the starting strain, knocking out the genes pheA, trpR, and pykA, and overexpressing the tyrosine operon genes melC1 and melC2 from *Streptomyces antibioticus* and *Streptomyces castaneoglobisporus*, respectively, to obtain a recombinant *E. coli* strain capable of synthesizing melanin. However, the *E. coli* BL21(DE3) in this patent is a non-probiotic, exhibiting problems such as poor biocompatibility, insufficient targeting, and inability to continuously release melanin in situ. Furthermore, the main research objective is to increase melanin production. Since this recombinant *E. coli* strain is non-probiotic, its oral administration safety is insufficient, and there are no studies on its efficacy, in vivo stability, or targeting in treating acute radiation enteritis.

[0012] In the prior art, the patent application No. 202210125583.5, entitled "Application of BMNP in protecting the intestine from ionizing radiation damage", describes a chemically synthesized melanin analog (BMNP). It requires exogenous administration and lacks the ability to continuously produce melanin in situ in the intestine. It does not integrate multiple functions such as anti-oxidation, anti-inflammation and intestinal flora regulation, and lacks the ability to actively target inflamed sites.

[0013] In summary, the current treatment methods for intestinal inflammation such as acute radiation enteritis, which focus on the regulation of antioxidant flora, suffer from several problems: a lack of comprehensive intervention methods that balance safety and efficacy, have relatively simple processes, good in vivo stability, high targeting, long duration of action, and single function, and lack multi-factor comprehensive intervention such as the regulation of antioxidant and anti-inflammatory flora.

[0014] References:

[0015] [1] E.L. Campbell, S.P. Colgan, Control and dysregulation of redox signalling in the gastrointestinal tract, Nature reviews. Gastroenterology & hepatology 16(2)(2019)106 - 120.

[0016] [2] H. Sies, D.P. Jones, Reactive oxygen species(ROS) as pleiotropic physiological signalling agents, Nat. Rev. Mol. Cell Biol. 21(7)(2020)363 - 383.

[0017] [3] K. Brainina, N. Stozhko, M. Vidrevich, Antioxidants: Terminology, Methods, and Future Considerations, Antioxidants 8(8)(2019)297.

[0018] [4] J. Flieger, W. Flieger, J. Baj, R. Maciejewski, Antioxidants: Classification, Natural Sources, Activity / Capacity Measurements, and Usefulness for the Synthesis of Nanoparticles, Materials(Basel) 14(15)(2021)4135.

[0019] [5] Wang W, Cui B, Nie Y, et al. Radiation injury and gut microbiota - based treatment. Protein & cell, 2023, 1; 15(2):83 - 97.

[0020] [6] K. M. Sztanke, P. M.Celejewski,K.Kurek,S.Szkutnicki,P.Korga,W.Bulikowski,K.Sztanke,Antioxidant Therapy inInflammatory Bowel Diseases,Antioxidants 10(3)(2021)412.

[0021] [7]W.Liang,P.Wied,F.Carraro,CJSumby,B.Nidetzky,CKTsung,P.Falcaro,CJDoonan,Metal-Organic Framework-Based Enzyme Biocomposites,Chem.Rev.121(3)(2021)1077-1129.

[0022] [8]H.Vargas Robles,AFCitalan Madrid,A.García Ponce,A.SilvaOlivares,M.Shibayama,A.Betanzos,L.Del Valle Mondragon,P.Nava,M.Schnoor,Experimental Colitis Is Attenuated by Cardioprotective Diet SupplementationThat Reduces Oxidative Stress,Inflammation,and Mucosal Damage,Oxidative Medicine and Cellular Longevity 2016(2016)8473242.

[0023] [9]T.Kobayashi,B.Siegmund,C.Le Berre,SCWei,M.Ferrante,B.Shen,CNBernstein,S.Danese,L.Peyrin-Biroulet,T.Hibi,Ulcerative Colitis,Nat RevDis Primers 6(1)(2020)74.

[0024]

[10] M.F.Neurath,Current and emerging therapeutic targets for IBD,Nature reviews.Gastroenterology&hepatology 14(5)(2017)269-278.

[0025]

[11] D.C.Baumgart,C.Le Berre,Newer Biologic and Small-MoleculeTherapies for Inflammatory Bowel Disease,N.Engl.J.Med.385(14)(2021)1302-1315.

[0026]

[12] S.Zhang,B.Chen,B.Wang,H.Chen,Y.Li,Q.Cao,J.Zhong,M.J.Shieh,Z.Ran,T.Tang,M.Yang,B.Xu,Q.Wang,Y.Liu,L.Ma,X.Wang,N.Zhang,S.Zhang,W.Guo,L.Huang,S.Schreiber,M.Chen,Effect of Induction Therapy With Olamkicept vs Placebo onClinical Response in Patients With Active Ulcerative Colitis:A RandomizedClinical Trial,The Journal of the American Medical Association 329(9)(2023)725-734.

[0027]

[13] B.Gros,G.G.Kaplan,Ulcerative Colitis in Adults:A Review,TheJournal of the American Medical Association 330(10)(2023)951-965.

[0028]

[14] P.S.Dulai,S.Singh,V.Jairath,E.Wong,N.Narula,Integrating Evidenceto Guide Use of Biologics and Small Molecules for Inflammatory BowelDiseases,Gastroenterology 166(3)(2024)396-408.

[0029]

[15] B.Yang,Y.Chen,J.Shi,Reactive Oxygen Species(ROS)-BasedNanomedicine,Chem.Rev.119(8)(2019)4881-4985.

[0030]

[16] A.Mavridi-Printezi,A.Menichetti,D.Mordini,R.Amorati,M.Montalti,Recent Applications of Melanin-like Nanoparticles as Antioxidant Agents,Antioxidants 12(4)(2023)863.

[0031]

[17] C.Maraveas,I.S.Bayer,T.Bartzanas,Recent Advances in AntioxidantPolymers:From Sustainable and Natural Monomers to Synthesis and Applications,Polymers(Basel)13(15)(2021)2465.

[0032]

[18] E.Kim,M.Kang,T.Tschirhart,M.Malo,E.Dadachova,G.Cao,J.J.Yin,W.E.Bentley,Z.Wang,G.F.Payne,Spectroelectrochemical Reverse EngineeringDemonstratesThat Melanin's Redox and Radical Scavenging Activities AreLinked,Biomacromolecules 18(12)(2017)4084-4098.

[0033]

[19] L.Panzella,G.Gentile,G.D'Errico,N.F.Della Vecchia,M.E.Errico,A.Napolitano,C.Carfagna,M.d'Ischia,Atypical Structural andπ-Electron Featuresof a Melanin Polymer That Lead to Superior Free-Radical-ScavengingProperties,Angew.Chem.Int.Ed.52(48)(2013)12684-12687.

[0034]

[20] Yan X,Liu XY,Zhang D,Zhang YD,Li ZH,Liu X,Wu F,ChenGQ.Construction of a sustainable3-hydroxybutyrate-producing probioticEscherichia coli for treatment of colitis.Cell Mol Immunol.2021;18(10):2344-2357.

[0035]

[21] J.Zhou,M.Li,Q.Chen,X.Li,L.Chen,Z.Dong,W.Zhu,Y.Yang,Z.Liu,Q.Chen,Programmable probiotics modulate inflammation and gut microbiota forinflammatory bowel disease treatment after effective oral delivery,Nat Commun13(1)(2022)3432.

[0036]

[22] A.Xie, H.Ji, Z.Liu, Y.Wan, 17(15)(2023)14775-14791.

[0037]

[23] Z.-Y.Han,C.Zhang,J.-X.An,J.-Y.Qiao,X.-Z.Zhang,Microalgal biomass-assisted delivery of probiotics for modulation of gut homeostasis andalleviation of intestinal inflammation,Nano today 54(2024)102093. Summary of the Invention

[0038] To address the problems existing in the prior art, this application researched and constructed a genetically engineered bacterium, EcN-Mel, using the probiotic *Escherichia coli* 1917 (EcN). The study found that EcN-Mel is more effective than EcN in treating acute radiation enteritis; it possesses stronger abilities to reduce intestinal inflammation, stronger free radical scavenging capabilities, stronger abilities to increase beneficial intestinal flora and reduce harmful flora, and stronger ability to target the lesion site—the site of intestinal inflammation. It also exhibits higher survival rate in the acidic environment of the stomach, longer residence time at the site of intestinal inflammation, approximately three times higher concentration, and greater stability in vivo. The specific technical solution of this invention is as follows:

[0039] The first aspect is the construction of the genetically engineered bacterium EcN-Mel.

[0040] A genetically engineered bacterium was constructed based on the probiotic *Escherichia coli* Nissle 1917 (EcN). Using CRISPR / Cpf1 gene editing, the competing genes pheA, trpR, and pykA related to tyrosine synthesis in Nissle 1917 were knocked out, and the C-terminus of the endogenous gene Tyr1, related to tyrosine synthesis, was overexpressed with a 6-his fusion. This resulted in the genetically engineered bacterium *E. coli* Nissle 1917△pheA△trpR△pykA pUKTAC-Vstyr (M235A / N229H), abbreviated as "EcN-Mel," which was identified by colony PCR and sequencing.

[0041] The second aspect involves the cultivation, amplification, and screening of EcN-Mel.

[0042] Kanamycin resistance screening and amplification of EcN-Mel engineered bacteria were conducted. Melanin nanoparticles (MelNPs) were isolated from EcN-Mel cultures using a high-concentration hydrochloric acid precipitation method. Each bacterial supernatant contained approximately 0.52 mg / mL of melanin.

[0043] Thirdly, the physicochemical properties of EcN-Mel are characterized.

[0044] (I) Dynamic monitoring of the reaction process using a full-wavelength microplate reader

[0045] Results: Comparison of absorbance values ​​at 600 nm for EcN and EcN-Mel after 0, 2, 4, 6, 8, 12, and 24 hours of culture showed that at the same time point, the optical absorbance of EcN-Mel exceeded that of EcN, indicating melanin formation. It was concluded that the higher absorption after 300 nm was due to melanin, and the characteristic peaks and absorption characteristics were similar to those of the melanin standard.

[0046] (II) TEM observation of morphology

[0047] TEM morphology images suggest that the edges of EcN-Mel are unevenly thickened and darkened, which is caused by melanin; no nanostructures were observed in the EcN supernatant, while the EcN-Mel culture supernatant showed spherical melanin nanoparticles with a size of approximately 50 nm.

[0048] (III) SEM observation of morphology

[0049] SEM observation of the morphological images suggests that EcN and EcN-Mel are rod-shaped, with EcN-Mel appearing longer, possibly due to the insertion of the exogenous gene and changes in culture conditions.

[0050] (iv) FTIR detection of chemical functional groups

[0051] FT-IR spectroscopy revealed that EcN-Mel and MelNPs exhibited peak patterns similar to those of commercial melanin, confirming that EcN-Mel can generate melanin nanoparticles.

[0052] (V) DLS detection of hydration size

[0053] MelNPS, EcN, and EcN-Mel were measured using DLS, with hydration sizes of approximately 50 nm, 1100 nm, and 1750 nm, respectively.

[0054] (vi) Colony PCR identification

[0055] PCR identification results showed that all colonies had a band at a length of 1359 bp, confirming that the screened colonies were positive clones containing the target gene.

[0056] (vii) Colony identification by Western blot

[0057] Tyrosinase (Tyr protein) expression in EcN-Mel showed a distinct band at 38.7 kDa; while the EcN strain without genetic modification did not show a corresponding band.

[0058] Colony PCR and WB identification results confirmed that the genetically engineered bacteria EcN-Mel was successfully constructed.

[0059] Fourthly, a comparison of the radical scavenging abilities of EcN-Mel and EcN.

[0060] Compared with the control group, EcN-Mel showed a decrease in electron spin resonance signal, indicating that EcN-Mel has a broad-spectrum free radical scavenging ability. When EcN-Mel was co-incubated with gastrointestinal mimicry solution, SDF-EcN-Mel showed a similar decrease in electron spin resonance signal as EcN-Mel, indicating that the gastrointestinal mimicry solution had no significant effect on the free radical scavenging ability of EcN-Mel. In the absence of gastric acid, ECN itself has no free radical scavenging ability, indicating that EcN-Mel has the potential for antioxidant therapy and good gastrointestinal stability, while EcN does not have free radical scavenging ability.

[0061] Fifth aspect: EcN-Mel safety evaluation

[0062] Treatment with melanin produced by EcN-Mel at different concentrations had no significant effect on the survival of Hiec cells. At a concentration of 200 ug / mL, the survival of cells remained above 85%, indicating that nanoMel has good biocompatibility at the cellular level.

[0063] There were no significant differences in any blood routine indicators at different time points (0 days, 3 days, 7 days, and 14 days) after oral administration of EcN-Mel to healthy mice, indicating that oral administration of EcN-Mel had no significant effect on blood routine indicators. Various serum biochemical indicators fluctuated, but were mostly within the normal reference range. No obvious histological abnormalities or structural damage were observed under light microscopy of various tissues and organs, indicating that oral administration of EcN-Mel had no significant effect on the histological structure of major organs.

[0064] The above results collectively demonstrate that EcN-Mel has good biocompatibility and is suitable for subsequent biomedical applications.

[0065] Sixth aspect: Comparison of EcN-Mel and EcN in vivo and in vitro colonization

[0066] (I) In vitro MPI detection

[0067] MPI signals of EcN-Mel@SPIONs and gastrointestinal tract simulant solution at different time points were detected and quantitatively analyzed. Results: Although the MPI signal of EcN-Mel@SPIONs fluctuated at different time points, it always maintained a strong MPI signal. The MPI signal after 24 hours did not decrease compared with the initial value, indicating that EcN-Mel@SPIONs have good gastrointestinal stability.

[0068] (II) In vivo MPI detection

[0069] In ARN model mice, oral delivery of EcN@SPIONs resulted in no MPI signal in the abdominal intestinal region for 24 hours; however, in ARN model mice, oral delivery of EcN-Mel@SPIONs maintained a strong MPI signal in the abdominal intestinal region for 24 hours, suggesting that EcN-Mel@SPIONs can colonize and remain extensively in the inflamed intestinal segment (colon). At the 24-hour time point, the colonic MPI signal intensity in the EcN-Mel@SPIONs group was significantly higher than that in the EcN@SPIONs group (P < 0.001), with the former being 6 times higher than the latter, indicating that EcN-Mel colonizes in the abdominal intestinal region for a longer period than EcN.

[0070] Seventhly, a comparison between EcN-Mel and EcN in the treatment of acute radiation enteritis.

[0071] Histochemical analysis was performed, including H&E staining score, hematoxylin and eosin staining, alcian blue staining, and immunohistochemical staining. The results confirmed that EcN-Mel could effectively alleviate the histological abnormalities in ARN model mice, while no significant relief was observed in the ECN group.

[0072] Eighthly, a comparison of the anti-inflammatory effects of EcN-Mel and EcN.

[0073] The expression levels of inflammatory factors IL-6 and TNF-α in the small intestinal tissue of ARN model mice treated with different groups were detected by enzyme-linked immunosorbent assay (ELISA). The results showed that compared with the ARN model group, the levels of TNF-α and IL-6 in the EcN-Mel group were significantly reduced (P values ​​were 0.001 and 0.01, respectively), indicating that inflammation was significantly reduced in the EcN-Mel group. Compared with the ARN model group, the levels of TNF-α and IL-6 in the ECN group were also reduced (P values ​​were 0.05 for both groups), indicating that inflammation was alleviated in the ECN group.

[0074] Ninth aspect: Comparison of the effects of EcN-Mel and EcN on gut microbiota

[0075] Compared with ARN model mice, oral treatment with EcN-Mel significantly promoted the proliferation of beneficial bacteria (such as Akkermansia) and may enhance intestinal barrier function; the proportion of potentially harmful bacteria (Proteobacteria) was slightly higher than that in the healthy group, but the difference was not significant.

[0076] Oral EcN treatment partially reversed changes in harmful flora in ARN model mice, but its effect was weaker than EcN-Mel intervention alone.

[0077] Compared with the prior art, the beneficial effects of this application are as follows:

[0078] This application uses the probiotic Escherichia coli 1917 (EcN) to construct the genetically engineered bacterium EcN-Mel. Studies have shown that EcN-Mel is superior to EcN...

[0079] 1. It has the ability to comprehensively intervene in multiple factors such as anti-oxidation, anti-inflammation, and regulation of intestinal flora, and has a better therapeutic effect on acute radiation enteritis;

[0080] 2. Stronger free radical scavenging ability;

[0081] 3. A stronger ability to increase beneficial gut bacteria and reduce harmful bacteria;

[0082] 4. Stronger ability to target lesions—intestinal inflammation lesions; longer residence time in intestinal inflammation lesions, exceeding 24 hours; and approximately 3 times higher concentration in intestinal inflammation lesions.

[0083] 5. It is more stable in the body and has a higher survival rate in the acidic environment of the stomach. Attached Figure Description

[0084] Figure 1 The colors of EcN and EcN-Mel cultures at 0, 3, 8, and 24 hours, among which...

[0085] The top image shows the color of the culture at 0, 3, 8, and 24 hours of EcN.

[0086] The following shows the colors of EcN-Mel cultures at 0, 3, 8, and 24 hours after the addition of copper ions and L-tyrosine to the culture medium.

[0087] Figure 2 UV-Vis absorption spectra of EcN and EcN-Mel at 0, 0.5, 3, 6, and 24 hours;

[0088] Figure 3 The absorbance values ​​at 600 nm of EcN and EcN-Mel after 0, 2, 4, 6, 8, 12, and 24 hours of culture;

[0089] Figure 4 UV-Vis absorption spectra of various culture substrates of EcN and EcN-Mel;

[0090] Figure 5 SEM and TEM images of EcN and EcN-Mel culture media, among which,

[0091] The left image is a SEM image of EcN and EcN-Mel, scale bar = 1 μm; the middle image is a biological TEM image of EcN and EcN-Mel, scale bar = 1 μm; and the right image is a TEM image of EcN and EcN-Mel.

[0092] Figure 6 After centrifuging EcN and EcN-Mel, TEM images of the bacterial culture supernatant were obtained, with a scale bar of 50 nm.

[0093] Figure 7 FT-IR spectra of EcN-Mel, MelNPs, and commercial melanin;

[0094] Figure 8 The size of EcN, EcN-Mel and melanin nanoparticles (MelNPs);

[0095] Figure 9 Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H) colony PCR identification, where 1-5 are randomly selected clone numbers;

[0096] Figure 10 WB identification of Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H) colonies;

[0097] Figure 11The free radical scavenging capabilities of EcN and EcN-Mel before and after treatment with gastrointestinal tract mimicry solution were evaluated. The control group was denoted as Control, EcN before treatment with gastrointestinal tract mimicry solution was denoted as EcN, and EcN-Mel after treatment with gastrointestinal tract mimicry solution was denoted as SDF-EcN-Mel.

[0098] a represents the ability to scavenge O2·-.

[0099] b represents the detection of NO scavenging ability.

[0100] c represents the detection of ·OH scavenging ability.

[0101] d represents the detection of DPPH· free radical scavenging ability.

[0102] e represents the detection of H2O2 scavenging ability;

[0103] Figure 12 Evaluation of the cytotoxicity of nanoMel on human intestinal epithelial cells Hiec, where nanoMel is the melanin produced by the genetically engineered bacterium EcN-Mel;

[0104] Figure 13 Blood routine test results at different time points (0 days, 3 days, 7 days, and 14 days) after oral delivery of EcN-Mel;

[0105] Figure 14 Serum biochemical test results at different time points (0 days, 3 days, 7 days, and 14 days) after oral delivery of EcN-Mel;

[0106] Figure 15 Histochemical results of major organs (heart, liver, spleen, lung, kidney) at different time points (0 days, 3 days, 7 days, 14 days) after oral delivery of EcN-Mel;

[0107] Figure 16 TEM images of SPIONs (left) and labeled biomimetic engineered bacteria EcN@SPIONs (middle) and EcN-Mel@SPIONs (right);

[0108] Figure 17 MPI signal images and their quantitative analysis at different time points after co-incubation of EcN-Mel@SPIONs and gastrointestinal simulated solution in vitro;

[0109] Figure 18 In vivo MPI images of mice at 0h, 6h, 8h, and 24h after oral delivery of EcN@SPIONs and EcN-Mel@SPIONs, where EcN@SPIONs are represented by EcN and EcN-Mel@SPIONs by EcN-Mel;

[0110] Figure 19 Statistical graph of in vivo MPI signal intensity at 0h, 6h, 8h and 24h after oral delivery of EcN@SPIONs and EcN-Mel@SPIONs to mice;

[0111] Figure 20 A schematic diagram of the establishment of an acute radiation intestinal injury (ARN) model and treatment plan;

[0112] Figure 21 Hematoxylin & eosin staining of small intestinal tissue of mice after 3 days of treatment in different groups. Scale bar, 50 μm.

[0113] Figure 22 A statistical chart comparing the pathological scores of small intestine tissues in mice after 3 days of treatment in different groups;

[0114] Figure 23 A statistical chart comparing the villus length of small intestinal tissue in mice after 3 days of treatment in different groups;

[0115] Figure 24 Alcian blue staining of small intestinal tissue of mice after 3 days of treatment in different groups. Scale bar, 100 μm.

[0116] Figure 25 A statistical chart comparing the number of goblet cells in each crypt of the small intestine tissue of mice after 3 days of treatment in different groups;

[0117] Figure 26 Immunohistochemical staining of Ki67 in small intestinal tissue of mice after 3 days of treatment (scale bar, 50 μm).

[0118] Figure 27 A semi-quantitative comparative statistical chart of Ki67-positive cells in the small intestine tissue of mice after 3 days of group treatment;

[0119] Figure 28 Tunel immunohistochemical staining images of small intestinal tissue of mice after 3 days of treatment in different groups. Scale bar, 50 μm.

[0120] Figure 29 A semi-quantitative comparative statistical chart of Tunel-positive cells in the small intestinal tissue of mice after 3 days of group treatment;

[0121] Figure 30 The levels of TNF-α and IL-6 in small intestinal tissue homogenate of mice were detected by enzyme-linked immunosorbent assay kit after 3 days of treatment in mice. Among them, a represents the level of TNF-α and b represents the level of IL-6.

[0122] Figure 31 Linear discriminant analysis plot of mouse group treatment;

[0123] Figure 32A statistical graph showing the differences in gut microbiota composition in mice after group treatment;

[0124] Figure 33 A color comparison of the cultures of genetically engineered bacteria from two sources of tyrosinase. The left is tyrosinase VsTYR (M235A / N229H) from Verrucomicrobium spinosum, and the right is tyrosinase from Bacillus megaterium.

[0125] in Figures 1-33 middle,

[0126] *, **, ***, and **** represent P<0.05, P<0.01, P<0.001, and P<0.0001, respectively, indicating that the difference between the two groups is statistically significant, as determined by a two-tailed t-test. Data are derived from the mean ± standard deviation of at least three independent trials. Detailed Implementation

[0127] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.

[0128] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0129] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and are commercially available. Experimental methods not specifying detailed conditions are performed according to conventional experimental methods or the operating instructions recommended by the supplier.

[0130] The gene names involved in this invention are explained as follows:

[0131] pheA gene: a bifunctional enzyme gene for branching acid mutase and prephenyl acid dehydratase;

[0132] trpR gene: tryptophan operon repressor protein gene;

[0133] pykA gene: pyruvate kinase gene;

[0134] VsTYR gene: tyrosinase gene derived from Verrucomicrobium spinosum;

[0135] The nucleotide sequence of the pheA gene is shown in SEQ ID No. 1, the nucleotide sequence of the upstream homologous arm of the pheA gene is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream homologous arm of the pheA gene is shown in SEQ ID No. 3.

[0136] The nucleotide sequence of the trpR gene is shown in SEQ ID No. 4, the nucleotide sequence of the upstream homologous arm of the trpR gene is shown in SEQ ID No. 5, and the nucleotide sequence of the downstream homologous arm of the trpR gene is shown in SEQ ID No. 6.

[0137] The nucleotide sequence of the pykA gene is shown in SEQ ID No. 7, the nucleotide sequence of the upstream homologous arm of the pheA gene is shown in SEQ ID No. 8, and the nucleotide sequence of the downstream homologous arm of the pheA gene is shown in SEQ ID No. 9.

[0138] The amino acid sequence of VsTYR is shown in SEQ ID No. 28.

[0139] Main biomaterials

[0140]

[0141]

[0142] Main reagents and materials

[0143] Reagent Name Manufacturer Name 2,2-Di-(4-tert-octylphenyl)-1-picrylhydrazine radical (DPPH) Sigma Aldrich Shanghai Trading Co., Ltd. Isopropyl-β-D-thiogalactoside (IPTG) Sangon Biotech (Shanghai) Co., Ltd. <![CDATA[Copper(II) sulfate pentahydrate (CuSO4·5H2O)]]> Sangon Biotech (Shanghai) Co., Ltd. Tyrosine Sangon Biotech (Shanghai) Co., Ltd. LB liquid culture medium Sangon Biotech (Shanghai) Co., Ltd. LB kanamycin resistance solid medium Sangon Biotech (Shanghai) Co., Ltd. Kanamycin Sangon Biotech (Shanghai) Co., Ltd. Bacterial cryopreservation solution Shanghai Beyotime Biotechnology Co., Ltd. Rhamnose Beijing Innocare Technology Co., Ltd. pepsin Beijing Innocare Technology Co., Ltd. trypsin Beijing Innocare Technology Co., Ltd. Electron microscopy fixative Beijing Solarbio Technology Co., Ltd. Dimethyl sulfoxide Sigma Aldrich Shanghai Trading Co., Ltd. fetal bovine serum Gibco, USA 0.25% trypsin Gibco, USA 1640 culture medium Hyclone, a US company Penicillin Hyclone, a US company Phosphate-buffered saline (PBS) Hyclone, a US company

[0144] Main instruments

[0145]

[0146]

[0147] Example 1: Construction of the genetically engineered bacterium E. coli Nissle 1917△pheA△trpR△pykA pUKTAC-Vstyr(M235A / N229H)

[0148] Based on the tyrosine metabolic pathway and its global regulation in Escherichia coli, this invention constructs a genetically engineered bacterium based on the probiotic Escherichia coli Nissle 1917 (EcN). Using the CRISPR / Cpf1 gene editing method, the competing genes pheA, trpR, and pykA related to tyrosine synthesis in E. coli Nissle 1917 are knocked out, and the endogenous gene Tyr1 related to tyrosine synthesis is overexpressed with a 6his fusion at the C-terminus. The resulting Nissle 1917 overexpressing the Tyr1 gene has excellent melanin production capacity.

[0149] The primer sequence information used in the following examples is shown in Table 1.

[0150] Table 1. Primer sequence listing

[0151]

[0152]

[0153] I. Construction of ΔpheA gene knockout strain E. coli Nissle 1917

[0154] (I) Experimental Materials and Reagents

[0155] Strains: E. coli Nissle 1917; E. coli DH5α (used for plasmid cloning and amplification)

[0156] plasmid

[0157] pEcCpf1 (carries the CRISPR / Cpf1 system, kanamycin resistant)

[0158] pTargetF (carries the N23 targeting sequence, kanamycin resistant)

[0159] (II) Steps

[0160] 1. Primer design and PCR amplification of homologous arms

[0161] Objective: To amplify the upstream and downstream homologous arms (UP / DH) of pheA;

[0162] Upstream and downstream homologous primers (UP / DH) are used for homologous recombination, as shown in Table 1;

[0163] N23 sequence replacement primer: pheA-N23-F / R, used for pTargetF modification, see Table 1;

[0164] The steps are as follows:

[0165] PCR system (50 μL): template DNA, 50 ng (EcN genome), 2.5 μL each of forward and reverse primers (10 μM), 1 μL of dNTPs (10 mM), 0.5 μL of Phusion DNA polymerase, 10 μL of 5×GC Buffer, and ddH2O to 50 μL.

[0166] PCR program: 98℃ pre-denaturation for 30 seconds, 98℃ denaturation for 10 seconds, 60℃ annealing (primer specific) for 30 seconds, 72℃ extension (1kb / min) for 30 seconds, 72℃ final extension for 5 min.

[0167] Gel recovery: Target bands (UP / DH) were recovered by gel cutting after 1% agarose gel electrophoresis (120V, 30min) using AxyPrep. TM The kit was eluted according to the instructions (30 μL ddH2O).

[0168] 2. Construct homologous recombination fragments (UD)

[0169] Objective: Connect the UP and DH segments.

[0170] step

[0171] Overlap extension PCR (50 μL): 100 ng UP fragment, 100 ng DH fragment, 0.5 μL Phusion polymerase, cycle number = 20, extension time 1 kb / min; PCR program is the same as "1. Primer design and PCR amplification of homologous arms", annealing temperature reduced to 55℃.

[0172] Purify the UD fragment: Repeat the gel recovery once, using the same method as "1. Primer design and PCR amplification of homologous arms".

[0173] 3. Modify the pTargetF plasmid

[0174] Objective: Insert the target N23 sequence.

[0175] step

[0176] PCR amplification linearization pTargetF

[0177] Primers: pheA-N23-F / R (containing N23 sequence) system is the same as "1. Primer design and PCR amplification homologous arm", template is pTargetF plasmid (50ng);

[0178] DpnI digestion: 45 μL of PCR product, 1 μL of DpnI enzyme, incubated at 37°C for 1 h;

[0179] Transformation of E. coli DH5α competent cells: heat shock method (42℃, 90 sec), spread on Kanade plates (100 μg / mL), and incubated at 37℃ for 12 h.

[0180] 4. Preparation of competent cells

[0181] Objective: To obtain competent E. coli DH5α-pEcCpf1 cells.

[0182] step

[0183] Inoculation with E. coli DH5α: Inoculate a single colony into 5 mL LB (containing 50 μg / mL Kan) and incubate at 37℃ and 200 rpm for 12 h;

[0184] Expanded culture: 1:100 transfer to 50 mL LB (Kan), OD600≈0.6, incubate on ice for 15 min;

[0185] Competent preparation: Centrifuge at 5000g for 5 min at 4℃, discard the supernatant; resuspend in 10 mL of 0.1M CaCl2 pre-chilled on ice, incubate on ice for 30 min, centrifuge at 5000g for 5 min at 4℃, discard the supernatant. Resuspend in 1 mL of 10% glycerol pre-chilled on ice, aliquot (100 μL / tube), and store at -80℃.

[0186] 5. Co-conversion and screening

[0187] Target: pTargetF-UD fragment

[0188] step

[0189] System: 100 μL of E. coli DH5α-pEcCpf1 competent cells, 100 ng of pTargetF-pheA plasmid, and 500 ng of pheA-UD fragment;

[0190] Heat shock method (42℃, 90sec).

[0191] Resuscitation and plating: Immediately add 1 mL LB, revive at 37℃ and 200 rpm for 1 h; plating onto Kans plates, incubate at 37℃ for 24 h.

[0192] 6. Eliminate edit plasmids

[0193] Objective: Remove pTargetF and pEcCpf1.

[0194] step

[0195] Rhamnose induction: Select positive clones and add them to 5 mL LB (Kan + 10 mM rhamnose) and incubate at 37°C for 12 h;

[0196] Sucrose reverse selection: After induction with 10mM rhamnose for 12h, the sample was plated on 10% sucrose plates (without resistance) and incubated at 37℃ for 24h.

[0197] II. Construction of the E. coli Nissle 1917△pheA△trpR strain with the trpR gene knocked out

[0198] Use trpR-UP-F / R, trpR-DH-F / R, and trpR-N23-F / R primers, and follow the steps in "I. Construction of △pheA in E.coli Nissle 1917 with pheA gene knocked out".

[0199] III. Construction of the E. coli Nissle 1917 △pheA△trpR△pykA strain with pykA gene knockout

[0200] Using primers pykA-UP-F / R, pykA-DH-F / R, and pykA-N23-F / R, and following the steps outlined in "I. Construction of E.coli Nissle 1917△pheA with pheA gene knocked out", the final result was E.coli Nissle 1917△pheA△trpR△pykA, which was then sent to a sequencing company to verify the knockout region.

[0201] IV. Construction of strain E. coli Nissle 1917△pheA△trpR△pykA pUKTAC-Vstyr(M235A / N229H)

[0202] (I) Construction of pUKTAC-Vstyr(M235A / N229H) plasmid

[0203] 1. Based on the VsTYR gene, the VsTYR(M235A / N229H) gene was obtained by mutation. Its amino acid sequence is shown in SEQ ID No. 29. VsTYR(M235A / N229H) is a mutant of VsTYR, with mutation sites at M235A and N229H. VsTYR(M235A / N229H) was constructed by Hangzhou Fenghai Biotechnology Co., Ltd.

[0204] 2. The Vstyr(M235A / N229H) gene was codon optimized using the JCat tool (http: / / www.jcat.de). After optimization, the GC content was 52% and the CAI value was 0.89. The optimized gene nucleotide sequence is shown in SEQ ID No. 30.

[0205] 3. The pUKTAC-Vstyr(M235A / N229H) plasmid was constructed using the pUKTAC vector. This plasmid was constructed by Hangzhou Fenghai Biotechnology Co., Ltd.

[0206] (II) Transformation and Screening of Recombinant Bacteria

[0207] 1. Preparation of E. coli Nissle 1917 and E. coli Nissle 1917ΔpheAΔtrpRΔpykA electrotransformation competent cells

[0208] (1) The two strains were activated and cultured at 37℃ respectively;

[0209] (2) Inoculate each single clone into 5 ml of LB liquid culture medium;

[0210] (3) The next day, 1% was transferred to 50ml of LB liquid medium and the cells were collected by centrifugation when the OD reached about 0.8.

[0211] (4) The bacterial cells were washed three times with 10% glycerol, and finally resuspended in 2 ml of 10% glycerol to obtain the prepared competent cells.

[0212] 2. Electroconversion

[0213] 1 μL of the synthesized pUKTAC-Vstyr(M235A / N229H) plasmid was added to the prepared Nissle1917 and Nissle1917ΔpheAΔtrpRΔpykA electroporation competent cells, respectively, and mixed well. The cells were placed on ice for 5 min, electroporated at 2500V, and then 1 ml of LB medium was added. After incubation at 37℃ for 1 h, the cells were plated on LB plates containing Kan (50 mg / ml). The colonies that grew were identified by colony PCR.

[0214] V. Colony PCR Identification

[0215] Identification primers:

[0216] pUKTAC-JD-F:GTGATGACGGTGAAAACCTCTGA (SEQ ID No. 31)

[0217] pUKTAC-JD-R:TCGCCACCTCTGACTTGAGCGTC (SEQ ID No. 32)

[0218] Identifying positive clone 1359bp

[0219] System: Pick a single clone and mix it into 10 μL of sterile water. Then take 0.5 μL as a template and perform colony PCR identification according to the system in Table 2. PCR program: 95℃ for 5 min; 30× (95℃ for 30 s, 60℃ for 30 s, 72℃ for 1.5 min); 72℃ for 5 min.

[0220] Table 2. qRT-PCR reaction system

[0221]

[0222] VI. Genetically engineered E. coli Nissle1917 △pheA △trpR △pykA pUKTAC-Vstyr(M235A / N229H) plasmid

[0223] sequencing

[0224] The genetically engineered bacterium E. coli Nissle 1917△pheA△trpR△pykA pUKTAC-Vstyr(M235A / N229H) is hereinafter referred to as "EcN-Mel".

[0225] The sample was sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing. The sequence of the EcN-Mel plasmid is shown in SEQ ID No. 33.

[0226] Example 2: Culture, amplification, and screening of genetically engineered bacteria

[0227] I. Cultivation of ECN

[0228] Pour 100 mL of LB liquid culture medium into a sterilized conical flask, add 100 μL of EcN frozen bacterial solution, seal the flask, and incubate overnight in a shaker at 37°C at 150 rpm.

[0229] II. Amplification of EcN

[0230] Pour 100 mL of LB liquid culture medium into a sterilized conical flask, add 100 μL of EcN cryopreserved bacterial solution, seal the flask, and incubate at 37°C in a shaker for 6–8 hours at 150 rpm. Measure the OD600 value using a microplate reader. When the OD600 value is between 0.6 and 0.8, transfer 10 mL of the bacterial solution to a 15 mL centrifuge tube and centrifuge at 4000 rpm for 10 minutes. Dissolve the precipitate in 1 mL of bacterial cryopreservation solution, aliquot into cryovials, seal with sealing film, and store at -80°C for later use.

[0231] III. Kanamycin Resistance Screening of EcN-Mel Engineered Bacteria

[0232] Pour 100 mL of LB liquid medium into a sterilized conical flask, add 100 μL of EcN-Mel cryopreserved bacterial culture and 100 μL of kanamycin (50 mg / mL), seal the flask, and incubate overnight at 37°C on a shaker at 150 rpm. Streak a small amount of the bacterial culture onto a kanamycin-resistant LB solid culture dish, seal the flask, and incubate overnight at 37°C on a shaker at 150 rpm. Pick a single colony from the dish and transfer it to a fresh 100 mL LB liquid medium, seal the flask, and incubate at 37°C on a shaker for 6–8 hours at 150 rpm. Measure the OD600 value using a microplate reader; when it is between 0.6 and 0.8, transfer 10 mL of the bacterial culture to a 15 mL centrifuge tube and centrifuge at 4000 rpm for 10 minutes. Dissolve the precipitate in 1 mL of bacterial cryopreservation solution, aliquot into cryovials, seal with sealing film, and store at -80°C for later use.

[0233] IV. Amplification of EcN-Mel engineered bacteria

[0234] Pour 100 mL of LB liquid culture medium into a sterilized conical flask, add 100 μL of EcN-Mel cryopreserved bacterial solution, seal the flask, and incubate at 37°C in a shaker for 6–8 hours at 150 rpm. Measure the OD600 value using a microplate reader. When the OD600 value is between 0.6 and 0.8, transfer 10 mL of the bacterial solution to a 15 mL centrifuge tube and centrifuge at 4000 rpm for 10 minutes. Dissolve the precipitate in 1 mL of bacterial cryopreservation solution, aliquot into cryovials, seal with sealing film, and store at -80°C for later use.

[0235] V. Procedures for EcN-Mel engineered bacteria to produce melanin

[0236] Pour 100 mL of LB liquid culture medium into a sterilized conical flask, add 100 μL of EcN-Mel frozen bacterial culture, and 5 mg / mL CuSO4·5H2O solution. -1 Add 1 mL of 80 mg of tyrosine and 1 mM of IPTG (23.83 mg), seal the container, and incubate overnight in a shaker at 37°C. The bacterial solution turns black the next day, indicating the production of melanin.

[0237] like Figure 1 As shown above, the culture of the unmodified strain EcN remained a consistent golden yellow color, becoming cloudy over time;

[0238] like Figure 1 As shown below, after adding copper ions and L-tyrosine to the culture medium, the color of the EcN-Mel culture changed from golden yellow to light brown, and finally to dark brown. This change is attributed to the continuous production of melanin.

[0239] Analysis: Tyrosinase catalyzes the conversion of L-tyrosine to dopa. Dopa is oxidized to dopa chromium and rearranged into 5,6-dihydroxyindole or 5,6-dihydroxyindole-2-carboxylic acid, which eventually undergoes spontaneous polymerization to form melanin. The presence of copper ions can accelerate the synthesis rate of melanin.

[0240] VI. Purification of Melanin Nanoparticles (Mel)

[0241] The culture medium of EcN-Mel was filtered through a 0.22 μm filter membrane, and the filtrate was centrifuged at 11,000 rpm for 10 minutes. One-third volume of 6M hydrochloric acid was added to the supernatant, and the mixture was allowed to stand at room temperature for 10 hours, then centrifuged at 11,000 rpm for 10 minutes. The purified Mel was obtained by centrifugation and resuspending in deionized water five times (12,000 rpm, 10 minutes each time), and then lyophilized into a black powder. The Mel was lyophilized using a freeze dryer, weighed, and the yield was quantified. An appropriate amount of ammonia solution (25%–28%) was added to dissolve the Mel, and then the solution was obtained by rotary evaporation.

[0242] Melanin nanoparticles (MelNPs) were isolated from EcN-Mel cultures using a high-concentration hydrochloric acid precipitation method. Each bacterial supernatant contained approximately 0.52 mg / mL of melanin.

[0243] Example 3: Physicochemical performance characterization of genetically engineered bacteria

[0244] I. Dynamic monitoring of reaction progress using a full-wavelength microplate reader

[0245] (I) Method

[0246] At 0, 0.5, 3, 6, and 24 hours of culture, 200 μL each of EcN-Mel culture medium and melanin extraction solution Mel were placed in a 96-well microplate and the UV-Vis absorption spectrum of each sample was measured using a full-wavelength microplate reader, with a scanning range of 300–1000 nm.

[0247] After culturing for 0, 2, 4, 6, 8, 12, and 24 hours, 200 μL each of EcN-Mel culture medium and melanin extraction solution Mel were placed in a 96-well microplate and the absorbance of each sample at 600 nm was measured using a full-wavelength microplate reader.

[0248] UV-Vis absorption spectra of various culture substrates of EcN and EcN-Mel (CuSO4·5H2O solution, tyrosine, IPTG, and kanamycin)

[0249] (II) Results

[0250] like Figure 2As shown, in the UV-Vis absorption spectra at 0, 0.5, 3, 6, and 24 hours, EcN and EcN-Mel exhibit characteristic absorption peaks in the 300-350 nm range, and in the visible region (400-850 nm), a monotonically decreasing broadband absorption is observed without obvious peaks.

[0251] like Figure 3 As shown, the absorbance values ​​of EcN and EcN-Mel at 600 nm were compared after 0, 2, 4, 6, 8, 12, and 24 hours of culture. At the same time point, the optical absorbance of EcN-Mel exceeded that of EcN, indicating melanin formation.

[0252] like Figure 4 As shown, the UV-Vis absorption spectra of various culture substrates of EcN and EcN-Mel show that reagents such as CuSO4, tyrosine, IPTG, and kanamycin have weak light absorption in the 300-850 nm range, having almost no impact on the absorption of the bacterial culture. After deducting the light absorption of these reagents, the main difference between EcN and EcN-Mel is the production of melanin. Therefore, it is believed that the higher absorption beyond 300 nm is due to melanin, and the characteristic peaks and absorption characteristics are similar to those of melanin standards.

[0253] II. TEM observation of morphology

[0254] After centrifuging 10 mL of each of the EcN and EcN-Mel culture media, the supernatant and precipitate were collected separately. The precipitated bacterial cells were resuspended in PBS. 10 μL of the diluted EcN and EcN-Mel resuspension and the supernatant after centrifugation of the two culture media were carefully and quickly added dropwise onto a copper grid covered with an amorphous carbon membrane and allowed to air dry at room temperature. The morphology of the products in the EcN and EcN-Mel culture media and the supernatant after centrifugation was observed on a TEM with an accelerating voltage of 200 kV.

[0255] like Figure 5 The TEM images (middle) and (right) suggest that the edges of EcN-Mel are unevenly thickened and darkened, which is caused by melanin.

[0256] like Figure 6 As shown, no nanostructures were observed in the EcN supernatant, while the EcN-Mel culture supernatant showed spherical melanin nanoparticles with a size of approximately 50 nm.

[0257] III. SEM Observation of Morphology

[0258] 50 μL of centrifuged and concentrated EcN and EcN-Mel bacterial solutions were respectively added to aluminum foil. After drying, another 50 μL was added. This process was repeated several times until a thin film visible to the naked eye was formed on the surface of the aluminum foil. The film was then sprayed with gold and observed and photographed using SEM.

[0259] like Figure 5 The SEM morphology image (left) suggests that EcN and EcN-Mel are rod-shaped, with EcN-Mel appearing longer, possibly due to the insertion of the exogenous gene and changes in culture conditions.

[0260] IV. FTIR Detection of Chemical Functional Groups

[0261] Vacuum-dried potassium bromide powder was ground to below 2 μm using an agate mortar. 1 mg of freeze-dried EcN-Mel, Mel powder samples (MelNPs), commercial melanin powder, and 100 mg of ground and sieved potassium bromide powder were added to each sample. The mixture was ground and mixed thoroughly multiple times until no large particles were visible to the naked eye. The potassium bromide powder mixture was then pressed into tablets using a tablet press under infrared lamp irradiation. The infrared spectrum was obtained by measuring the amount of infrared light transmitted through the tablets on an infrared spectrometer. Detection conditions: scanning range 4000–400 cm⁻¹. -1 The resolution is 4cm. -1 The scan was performed 256 times to analyze the surface chemical functional groups.

[0262] like Figure 7 The FT-IR spectra suggest that EcN-Mel and MelNPs exhibit peak patterns similar to those of commercial melanin.

[0263] The stretching vibration peaks of NH and Oh are at 3380 cm⁻¹ -1 Related to the C=O structure and 1200cm -1 1500-1550cm -1 (Indole skeleton vibration) Correspondingly, the C=C bond in the aromatic ring is 1644 cm⁻¹ -1 The peaks correspond to each other.

[0264] This study confirms the successful production of engineered bacteria EcN-Mel, which can produce melanin nanoparticles; the engineered EcN strain, through genetic engineering as the basis for tyrosinase gene expression, produced EcN-Mel bacteria capable of producing melanin.

[0265] V. DLS detection of hydration dimensions

[0266] After extraction and purification of the melanin solution secreted by engineered bacteria, 1 mL of a 10 μg / mL Mel solution was added to a cuvette and measured using a Malvern potentiometric particle size analyzer. Data acquisition conditions: 633 nm helium-neon laser irradiation, diffraction angle of 173°, test temperature of 25℃, and detection of Mel hydration size. Instrument measurement parameters were set as follows: temperature 20℃, angle 90°, equilibration time 60 seconds. All samples were tested three times.

[0267] The results are as follows Figure 8 As shown, the hydration size of MelNPS, EcN, and EcN-Mel was detected by DLS and was approximately 50 nm, 1100 nm, and 1750 nm, respectively.

[0268] VI. Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr(M235A / N229H) colony PCR identification

[0269] (I) Method

[0270] Refer to Example 1.

[0271] (II) Results

[0272] The results are as follows Figure 9 As shown, 1-5 are randomly selected clones. PCR identification results show that all of them have a band at the 1359bp position. The PCR identification results confirm that the selected colonies are positive clones containing the target gene.

[0273] VII. Western blot identification of Nissle 1917ΔpheAΔtrpRΔpykA pUKTAC-Vstyr (M235A / N229H) colonies

[0274] (I) Method

[0275] After culturing EcN and EcN-mel bacterial solutions for 8 hours, bacterial pellets were collected. Subsequently, protein quantification was performed on each sample. Proteins were separated by 10% SDS-PAGE. After gel preparation, electrophoresis, and membrane transfer, the membrane was blocked with 5% skim milk and incubated with primary antibody at 4°C for 12 hours and secondary antibody at 37°C for 1 hour. The antibody dilution information was Recombinant anti-hisTag antibody (GB15125, 1:2000, Servicebio). Gel image analysis was performed.

[0276] (II) Results

[0277] The results are as follows Figure 10 As shown, the expression of tyrosinase (Tyr protein) in EcN-Mel shows a distinct band at 38.7 kDa; while the EcN strain without genetic modification does not show a corresponding band.

[0278] Colony PCR and WB identification results confirmed that the genetically engineered bacteria EcN-Mel was successfully constructed.

[0279] Example 4: Detection of Free Radical Scavenging Ability of Genetically Engineered Bacteria

[0280] I. Methods

[0281] (a) Stability testing of EcN-Mel in digestion fluid simulant (SDF)

[0282] Sodium chloride and pepsin were dissolved in deionized water to a concentration of 32 μg / mL, and the pH was adjusted to 1.2 with hydrochloric acid to obtain a gastric juice simulation solution.

[0283] Dissolve dipotassium hydrogen phosphate in deionized water, add trypsin, dissolve in deionized water to a concentration of 100 μg / mL, and adjust the pH to about 7.5 with sodium hydroxide to obtain a simulated intestinal fluid solution.

[0284] The original bacterial culture with OD600≈2.5 was concentrated 100 times. 200 μL of the concentrated bacterial culture and gastric juice simulation solution (volume ratio 1:1) were incubated together for 4 hours. Then, the EcN-Mel precipitate was collected by centrifugation and intestinal juice simulation solution (volume ratio 1:1) was incubated together for 20 hours to simulate the gastric emptying time and intestinal transit time after oral delivery. This was named SDF-treated EcN-Mel (SDF-EcN-Mel).

[0285] (II) ESR detection of free radical scavenging ability

[0286] The scavenging abilities of EcN-Mel and SDF-EcN-Mel for DPPH·, ·OH, O2·-, H2O2 and ·NO were compared using ESR spectroscopy.

[0287] In short, a 10 mM DPPH solution was prepared in ethanol for measurement, and 100 mM 5,5-dimethyl-1-oxypyrroline was used as a spin trapping agent.

[0288] The reaction of xanthine (10 mM) with xanthine oxidase (1 U / mL) to generate O2·-, and 100 mM 5,5-dimethyl-1-oxypyrroline is used as a spin trapping agent.

[0289] The ·OH,5,5-dimethyl-1-oxypyrroline is generated by the reaction of ferrous ions with H2O2 and used as a spin trapping agent;

[0290] 400 μL of 20 mM H2O2 solution was mixed with 100 μL of deionized water and deoxygenated for 30 minutes to serve as the source of H2O2. 100 mM of 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxo-3-oxide potassium salt was used as a spin trapping agent.

[0291] 10 mM S-nitroso-N-acetyl-DL-penicillamine was used as the source of NO, and 100 mM 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxo-3-oxide potassium salt was used as a spin trap.

[0292] Incubate with 200 μg / mL EcN-Mel and SDF-EcN-Mel for 10 minutes each. Place the test solution into an ESR quartz tube and cycle through freeze-degassing-thawing multiple times. After degassing is complete, record the ESR spectrum at room temperature.

[0293] II. Results

[0294] The results are as follows Figure 11 As shown, compared with the control group, EcN-Mel showed a weakening of electron spin resonance signal, indicating that EcN-Mel has a broad-spectrum free radical scavenging ability;

[0295] When EcN-Mel was co-incubated with a gastrointestinal tract mimicry solution, SDF-EcN-Mel exhibited a weakened electron spin resonance signal similar to that of EcN-Mel, indicating that the gastrointestinal tract mimicry solution had no significant effect on the free radical scavenging ability of EcN-Mel.

[0296] like Figure 11 As shown, ECN itself has no ability to scavenge free radicals in the absence of gastric acid, so ECN was not treated with gastrointestinal tract mimicry solution.

[0297] III. Conclusion

[0298] These results indicate that EcN-Mel has the potential for antioxidant therapy and good gastrointestinal stability, while EcN lacks the ability to scavenge free radicals. Therefore, only EcN-Mel holds promise for the treatment of gastrointestinal oxidative stress-related diseases via oral delivery.

[0299] Example 5: Safety evaluation of the genetically engineered bacterium EcN-Mel

[0300] The experiment was conducted using male C57BL / 6J mice (6–8 weeks old, 18–22 g).

[0301] I. Safety Evaluation Methods for Genetically Engineered Bacteria

[0302] (I) CCK-8 assay kit for detecting cell viability

[0303] 5000 Hiec cells were seeded in 96-well cell culture plates and cultured for 12 hours after cell attachment. Different concentrations of nanoMel (0, 12.5, 25, 50, 100, 200 μg / mL) were added, with 6 parallel wells per group. After co-incubation with cells for 24 hours, CCK-8 reagent was added. One hour later, the absorbance at 450 nm was measured using a microplate reader to analyze the effect of nanoMel on cell viability.

[0304] Note: nanoMel refers to the melanin produced by the genetically engineered bacterium EcN-Mel.

[0305] (II) Complete Blood Count

[0306] Healthy mice were orally administered the original bacterial culture with an EcN-Mel [OD600 value] of 2.5 ± 0.1, concentrated 100 times, at 10 μL / g (1 x 10⁻⁶). 9 [Administered at a dose of CFU / 100 μL (based on mouse body weight), with healthy mice given only saline via gavage as controls. Fresh blood was collected by enucleation at different time points after administration (days 0, 3, 7, and 14), placed in anticoagulant tubes, and the whole blood was stored at 4°C for complete blood count analysis.]

[0307] (III) Serum Biochemical Detection

[0308] For serum extraction, whole blood in anticoagulant tubes was allowed to stand at room temperature for 30 minutes, then centrifuged at 3000 rpm for 10 minutes, and the supernatant serum was carefully collected. Serum biochemical indicators were quantitatively detected using a serum biochemical analyzer, with 5 mice per group. The detected indicators included liver function indicators: aspartate aminotransferase (AST) and alkaline phosphatase (ALP); and kidney function indicators: urea (UREA) and uric acid (UA), etc.

[0309] (III) Histochemical Analysis

[0310] Orally administer EcN-Mel bacterial culture to healthy mice [dosage: original bacterial culture with OD600 value between 2 and 2.5, concentrated 100 times, 10 μL / g (1 x 10⁻⁶)]. 9 [CFU / 100μL (mouse body weight dose)], with healthy mice in the oral saline group serving as controls. At different time points after drug administration (days 0, 3, 7, and 14), mice were anesthetized with 10% chloral hydrate and then perfused with 50mL of saline and 50mL of 4% paraformaldehyde via the heart. Major organs such as the heart, liver, spleen, lungs, and kidneys were rapidly isolated and immersed in 4% paraformaldehyde. After 24 hours, they were embedded in paraffin. Sections were prepared at 5μm thickness and dewaxed. Tissue sections were immersed in hematoxylin staining solution for 3 minutes, stained with eosin for 1 minute, dehydrated, mounted, and observed and photographed under an inverted microscope.

[0311] II. Results

[0312] like Figure 12 As shown, within the tested concentration range, different concentrations of nanoMel treatment had no significant effect on the survival activity of Hiec cells. At a concentration of 200 ug / mL, the cell survival activity remained above 85%, indicating that nanoMel has good biocompatibility at the cellular level.

[0313] like Figure 13As shown, there were no significant differences in various blood routine indicators at different time points (0 days, 3 days, 7 days, and 14 days) after oral administration of EcN-Mel to healthy mice, indicating that oral administration of EcN-Mel had no significant effect on blood routine indicators.

[0314] like Figure 14 As shown, the serum biochemical indicators of healthy mice at different time points (0 days, 3 days, 7 days, and 14 days) after oral administration of EcN-Mel showed that the parameters of each indicator fluctuated at different time points, but were mostly within the normal reference range.

[0315] like Figure 15 As shown, no obvious histological abnormalities or structural damage were observed in the light microscopy of various organs (heart, liver, spleen, lung, and kidney) at different time points, indicating that oral delivery of EcN-Mel has no significant effect on the histological structure of major organs.

[0316] The above results collectively demonstrate that EcN-Mel has good biocompatibility and is suitable for subsequent biomedical applications.

[0317] Example 6: Monitoring the metabolic distribution of genetically engineered bacteria using magnetic particle imaging

[0318] I. In vitro MPI detection

[0319] (I) Method

[0320] After culturing EcN and EcN-Mel for 2 hours, 1 mL of 5 mg / mL superparamagnetic iron oxide nanoparticles (SPIONs) were added to each, and after co-incubation for 24 hours, the samples were centrifuged and washed 3 times to obtain SPION-labeled engineered bacteria, named EcN@SPIONs and EcN-Mel@SPIONs. The morphology of SPIONs, labeled biomimetic engineered bacteria EcN@SPIONs and EcN-Mel@SPIONs was observed by TEM.

[0321] 100 mL of EcN-Mel@SPIONs culture medium was concentrated 100-fold. 100 μL of the concentrate was incubated in a gastric juice simulant for 30 minutes (v / v 1:1), centrifuged, and then resuspended in an intestinal simulant (v / v 1:1). MPI signals were then acquired at different time points (0, 2, 4, 6, 8, and 24 hours) with an excitation field of 45 kHz. Two-dimensional imaging parameters: Scan mode: default; Field of view: 6 cm × 4 cm.

[0322] (II) Results

[0323] like Figure 16 As shown, the TEM images of SPIONs, labeled biomimetic engineered bacteria EcN@SPIONs, and EcN-Mel@SPIONs suggest the following:

[0324] SPIONs are nanoparticles with a diameter of approximately 30 nm. After EcN and EcN-Mel are labeled with SPIONs, it can be observed that EcN and EcN-Mel engulf SPIONs.

[0325] like Figure 17 As shown, the labeled EcN-Mel@SPIONs were co-incubated with a gastrointestinal tract mimicry solution in vitro. MPI was used to detect the MPI signal of EcN-Mel@SPIONs and the gastrointestinal tract mimicry solution at different time points and to perform quantitative analysis. The results showed that although the MPI signal of EcN-Mel@SPIONs fluctuated at different time points, it always maintained a strong MPI signal. The MPI signal after 24 hours did not decrease compared with the initial value, indicating that EcN-Mel@SPIONs have good gastrointestinal stability.

[0326] II. In vivo MPI assessment of EcN-Mel colonization

[0327] (I) Method

[0328] 1. Establish a mouse model of acute radiation enteritis (ARN).

[0329] ARN model was established by exposing the abdomen of 6- to 8-week-old male C57BL / 6 mice to X-rays at a dose rate of 10 mGy / s (220 mV, 13 mA) and an irradiation dose of 12 Gy.

[0330] 2. Drug administration, in vivo MPI

[0331] Six ARN model mice were randomly divided into two groups of three. After fasting for 24 hours, mice had free access to water. EcN@SPIONs and EcN-Mel@SPIONs were orally administered, respectively. The original bacterial culture (OD600 value of 2.5 ± 0.1) was concentrated 100-fold and administered at a dose of 10 μL / g mouse body weight. MPI signals were acquired at different time points (0, 6, 8, and 24 hours) before and after gavage. The excitation field was 45 kHz. Two-dimensional imaging parameters: Scan mode: default; Field of view: 6 cm × 4 cm.

[0332] (II) Results

[0333] like Figure 18As shown, after oral administration of EcN@SPIONs to ARN mice, the abdominal region maintained a strong MPI signal intensity at 6 and 8 hours, but almost no MPI signal was observed at 24 hours, suggesting that EcN@SPIONs were excreted from the intestine; while after oral administration of EcN-Mel@SPIONs to ARN mice, the abdominal region maintained a strong MPI signal intensity at 6, 8 and 24 hours.

[0334] like Figure 19 As shown, after 24 hours in vivo, the MPI signal intensity of the EcN-Mel@SPIONs group was significantly higher than that of the EcN@SPIONs group, suggesting that the colonization time of EcN-Mel in the abdomen is longer than that of EcN.

[0335] like Figure 19 As shown, after oral administration of EcN@SPIONs to ARN model mice, there was no MPI signal in the abdominal intestinal region for 24 hours; while after oral administration of EcN-Mel@SPIONs to ARN model mice, the abdominal intestinal region still maintained a strong MPI signal intensity for 24 hours, suggesting that EcN-Mel@SPIONs can colonize and remain in a large amount of inflamed intestinal segments (colon).

[0336] like Figure 19 As shown, at the 24-hour time point, the colonic MPI signal intensity of mice in the EcN-Mel@SPIONs group was significantly higher than that in mice in the EcN@SPIONs group (P < 0.001), with the former being 6 times that of the latter. This indicates that EcN-Mel has a longer colonization time in the abdominal intestinal region than EcN.

[0337] The reasons may be as follows: The mucosal layer of the inflamed intestinal segment is imbalanced, expressing a large number of positively charged proteins, leading to the accumulation of positive charges on the surface of the intestinal mucosa of the diseased segment. This provides a natural target site for agents with negative surface charges. The bacteria and Mel carry negative surface charges, allowing them to target and adhere to the positively charged intestinal mucosa surface of the inflamed segment through electrostatic interactions. The intestinal mucosal barrier is damaged in the inflamed segment, increasing permeability. Mel has a strong mucosal adhesion ability, which can prolong its colonization and retention time in the inflamed segment. Furthermore, *E. coli* is a dominant commensal bacterium in the gut and has a certain degree of active homing to the inflamed segment. These factors work together to promote the targeted colonization of EcN-Mel@SPIONs in the inflamed intestinal segment and prolong its retention time.

[0338] Example 7: Treatment of Acute Radiation Enteritis (ARN) Mice with Genetically Engineered Bacteria

[0339] I. Establishing a mouse ARN model

[0340] ARN model was established by exposing the abdomen of 6- to 8-week-old male C57BL / 6 mice to X-rays at a dose rate of 10 mGy / s (220 mV, 13 mA) and an irradiation dose of 12 Gy.

[0341] Mice were randomly divided into 4 groups:

[0342] Control group: No treatment accepted;

[0343] ARN model group: X-ray irradiation;

[0344] EcN-Mel treatment group: X-ray irradiation + EcN-Mel treatment;

[0345] EcN treatment group: X-ray irradiation + EcN treatment;

[0346] Administration: Administer EcN and EcN-Mel by gavage 24 hours and 6 hours before X-ray irradiation; Dosage: Original bacterial culture with an OD600 value of 2–2.5, concentrated 100 times, 10 μL / g (1 x 10⁻⁶). 9 CFU / 100μL) mouse body weight dose, 3 days after the end of different treatment regimens.

[0347] See the schematic diagram of the model establishment and treatment plan. Figure 20 .

[0348] II. Histochemical Analysis

[0349] (I) Method

[0350] Three days after the end of the group treatment, the mice were euthanized with carbon dioxide, and small intestinal tissue was obtained and soaked in 4% paraformaldehyde. After 24 hours, the tissue was embedded in paraffin, sectioned at a thickness of 5 micrometers, and dewaxed. The intestinal tissue sections were stained according to the standard procedure.

[0351] The general procedure for H&E staining is as follows: Tissue sections are immersed in hematoxylin staining solution for 3 minutes, eosin staining for 1 minute, dehydrated, mounted, observed under an inverted microscope, photographed, and scored. The specific scoring criteria are shown in Table 3.

[0352] Table 3. Histological scoring scheme for ARN

[0353]

[0354]

[0355] The general procedure for Alixin Blue staining (AB / PAS staining) is as follows: dewaxing paraffin sections, Alixin Blue staining, periodic acid staining, Schiff staining, hematoxylin staining, dehydration and mounting, microscopic observation, and image acquisition and analysis.

[0356] Immunohistochemical staining procedure: Citrate antigen retrieval, inactivation of endogenous peroxidase, antigen blocking, addition of primary antibody (incubation overnight at 4°C), addition of secondary antibody (Ki67 and Tunel) (incubation at 37°C for 30 minutes), diaminobenzidine (DAB) staining, dehydration, mounting, observation and photography under an inverted microscope.

[0357] (II) Results

[0358] like Figure 21 The hematoxylin & eosin staining pattern shows that

[0359] Compared with healthy mice, the small intestinal tissue of the model group mice showed severe morphological and structural abnormalities, including crypt atrophy and absence, basement membrane thickening, mucosal epithelial cell erosion and shedding, exposure of the lamina propria, disappearance of normal goblet cells, and in place of severe mucosal gland defects, mucosal ulcers and extensive inflammatory cell infiltration, indicating that the mouse ARN model was successfully established.

[0360] After EcN-Mel treatment, the small intestinal mucosal epithelial cells and mucosal glands became neatly and tightly arranged, with no significant reduction or shedding, less inflammatory cell infiltration, and a significant decrease in histopathological score; while after EcN treatment, the relief was not obvious, and the pathological score did not decrease significantly.

[0361] like Figure 22 As shown,

[0362] Compared with the healthy group, the small bowel histopathological score of the IR group was significantly higher than that of the healthy group (P < 0.001), indicating that the ARN model was successfully constructed.

[0363] The small bowel pathology score of the IR+EcN-Mel group was significantly lower than that of the IR group (P<0.05).

[0364] The pathological scores of small bowel tissue in the IR+EcN group were not statistically different from those in the IR group, suggesting that no significant remission was observed in the ECN group.

[0365] like Figure 23 As shown,

[0366] The villus length of the small intestine in the IR+EcN-Mel group was significantly higher than that in the IR group (P < 0.05).

[0367] There was no statistically significant difference in villus length between the IR+EcN group and the IR group.

[0368] like Figure 24 The Allicin blue staining diagram is shown.

[0369] Compared with healthy mice, the small intestinal villi structure of the model group mice was significantly atrophied, damaged, and disappeared. After EcN-Mel treatment, the damage to the small intestinal villi structure was significantly improved, the intestinal mucosal damage was reduced, and the number of goblet cells was restored, while no significant relief was observed in the ECN group.

[0370] like Figure 25 As shown,

[0371] The number of goblet cells in each crypt of the small intestine in the IR+EcN-Mel group was significantly higher than that in the IR group (P<0.01).

[0372] There was no statistically significant difference in crypt depth between the IR+EcN group and the IR group.

[0373] like Figure 26 Immunohistochemical staining of Ki67 in small intestinal tissue of mice after 3 days of treatment in different groups and Figure 24 Tunel immunohistochemical staining results showed

[0374] In the IR model group, the proliferation capacity of small intestinal tissue cells was reduced and the number of apoptotic cells increased; after EcN-Mel treatment, the proliferation capacity of small intestinal tissue cells was significantly increased and the number of apoptotic cells decreased; no significant remission was observed in the ECN group.

[0375] like Figure 27 As shown,

[0376] The number of Ki67-positive cells in the small intestine tissue of the IR+EcN-Mel group was significantly higher than that of the IR group (P<0.01).

[0377] There was no statistically significant difference in Ki67-positive cells in the small intestine tissue between the IR+EcN group and the IR group.

[0378] like Figure 28 As shown,

[0379] The number of Tunel-positive cells in the small intestine of the IR+EcN-Mel group was significantly higher than that of the IR group (P<0.01).

[0380] like Figure 29 As shown

[0381] There was no statistically significant difference in the number of Tunel-positive cells in the small intestine tissue between the IR+EcN group and the IR group.

[0382] The above results collectively indicate that EcN-Mel can effectively alleviate histological abnormalities in ARN model mice, while no significant allergy was observed in the ECN group.

[0383] Example 8: Detection of the anti-inflammatory ability of genetically engineered bacteria

[0384] I. Methods

[0385] An acute radiation enteritis (ARN) model was established in mice, and the mice were divided into four groups for drug administration. The ARN model and drug administration groups were the same as in Experiment 7. Inflammatory factors in mouse small intestinal tissue were measured: Three days after the end of treatment, mice were euthanized with carbon dioxide, and small intestinal tissue was collected, weighed, and homogenized in PBS at 4°C. The tissue was centrifuged at 3000 rpm for 20 minutes at 4°C, and the supernatant was collected. The expression levels of representative inflammatory factors such as IL-6 and TNF-α in the small intestinal tissue homogenate were detected using an enzyme-linked immunosorbent assay (ELISA) kit.

[0386] II. Results

[0387] like Figure 30 As shown, compared with healthy mice, the levels of TNF-α and IL-6 pro-inflammatory cytokines in the small intestinal tissue of ARN model mice were significantly increased.

[0388] Compared with the ARN model group, the levels of TNF-α and IL-6 in the EcN-Mel group were significantly reduced, with P values ​​of 0.001 and 0.01, respectively.

[0389] Compared with the ARN model group, the levels of TNF-α and IL-6 in the ECN group were reduced, with P values ​​of 0.05 for both.

[0390] III. Conclusions and Analysis

[0391] Conclusion: Inflammation was significantly reduced in the EcN-Mel group; inflammation was alleviated in the ECN group.

[0392] Analysis: Excessive production of reactive oxygen species can stimulate the secretion of various pro-inflammatory cytokines at the site of inflammation, thereby increasing the production of intracellular reactive oxygen species and forming a vicious cycle. The EcN-Mel group can significantly reduce the inflammation level of the small intestine tissue in ARN model mice, while the EcN group has a weaker effect in relieving inflammation of the small intestine tissue.

[0393] Example 9: The Effects of Genetically Engineered Bacteria on the Intestinal Microbiota

[0394] I. Methods for analyzing fecal intestinal flora

[0395] On day 3 after treatment in mice, fresh fecal samples were collected in sterile tubes and stored at -80°C for subsequent testing. Fecal DNA was extracted using a DNA Microprep Kit according to the manufacturer's instructions. The samples were centrifuged at 10,000 rpm for 1 minute. The supernatant was collected, and 1200 μL of DNA binding buffer was added. The samples were transferred to an IC-Z column and centrifuged twice (10,000 rpm, 1 minute each time), discarding the supernatant. 400 μL, 700 μL, and 200 μL of DNA washing buffer were added sequentially, and the samples were washed three times, centrifuged at 10,000 rpm for 1 minute each time, discarding the supernatant. The IC-Z column was transferred to a 1.5 mL centrifuge tube, 10 μL of enzyme-free water was added, and the samples were allowed to stand for 1 minute. The samples were then centrifuged at 10,000 rpm for 1 minute, discarding the supernatant. The samples were centrifuged at 8,000 rpm for 1 minute, and the concentration of the extracted DNA was determined using a micro-spectrophotometer.

[0396] PCR amplification primer design for the V4 region of the bacterial 16S rDNA gene: Specific primers (V4: 515F-806R) were synthesized according to the V4 sequencing region.

[0397] 515-F: 5′-GTGCCAGCMGCCGCGGTAA-3′ (SEQ ID No. 33);

[0398] 806-R: 5′-GGACTACHVGGGTWTCTAAT-3′ (SEQ ID No. 34).

[0399] PCR amplification, product identification, recovery, and quantitative fluorescence were performed according to standard procedures. Library construction was conducted according to the TruSeq DNA PCR-Free Sample Preparation Kit instructions, followed by HiSeq high-throughput gene sequencing. In-depth analysis of community diversity, species classification, and abundance was performed.

[0400] II. Results

[0401] like Figure 31 The LDA EffectSize analysis shown, and the linear discriminant analysis (LEfSe), i.e., LDA-LEfSe analysis, indicate that...

[0402] Compared with the healthy control group, the IR group showed a decrease in Bacteroidetes, an increase in Proteobacteria, and an upregulated abundance of enteropathogenic bacteria, reflecting the characteristics of gut microbiota dysbiosis in the IR group.

[0403] Compared with the IR group mice, EcN-Mel treatment significantly promoted the abundance of Verrucomicrobia (such as Akkermansia). This specific microbiota regulation effect showed a synergistic effect with the antioxidant function of EcN-Mel: on the one hand, the proliferation of Akkermansia may enhance intestinal barrier function. On the other hand, the increased abundance of Akkermansia has been reported to be associated with a decrease in intestinal ROS levels, suggesting that it may indirectly improve the intestinal microenvironment by alleviating oxidative stress.

[0404] EcN treatment: partially reversed the changes in harmful flora in the IR group, but the effect was weaker than EcN-Mel intervention alone.

[0405] like Figure 32 As shown, the Control group (healthy control group) was dominated by Bacteroidetes and Firmicutes, with a lower proportion of Proteobacteria. Compared with the healthy control group, the IR model group had a significantly higher proportion of Proteobacteria than the EcN-Mel group, suggesting that opportunistic pathogens may increase under inflammatory conditions. Furthermore, the IR group had a significantly lower proportion of Verrucomicrobia than the EcN-Mel group, indicating that inflammation leads to a reduction in beneficial bacteria. Compared with the Control group, the proportion of Bacteroidetes decreased and the proportion of Proteobacteria increased; these results reflect the characteristics of gut microbiota dysbiosis in the IR group.

[0406] Compared with the IR group mice, the Verrucomicrobia phylum was significantly higher after EcN-Mel treatment, suggesting that EcN-Mel may promote the proliferation of beneficial bacteria such as Akkermansia.

[0407] The proportion of potentially harmful bacteria, specifically Proteobacteria, was slightly higher in the control group than in the control group, but the difference was not significant.

[0408] Compared to the IR group mice, the proportion of verrucous microbes after EcN treatment was between that of the IR and EcN-Mel groups, suggesting that EcN may partially restore beneficial bacteria. The proportion of Bacteroidetes remained lower than that of the Control group but higher than that of the IR group. Harmful bacteria: The proportion of Proteobacteria was lower than that of the IR group but higher than that of the Control group.

[0409] Comparative Example 1: Constructing genetically engineered bacteria using tyrosinase from other sources.

[0410] The construction of the strain E. coli Nissle 1917△pheA△trpR△pykA with the pykA gene knocked out is described in Example 1.

[0411] A strain of E. coli Nissle 1917 overexpressing the Tyr1 gene was constructed using tyrosinase derived from Bacillus megaterium and E. coli Nissle 1917△pheA△trpR△pykA, following the procedure described in Example 1.

[0412] Result: As Figure 33 As shown, under the same culture conditions, the test tubes using tyrosinase derived from Bacillus megaterium produced a lighter color than those using tyrosinase VsTYR (M235A / N229H) derived from Verrucomicrobium spinosum. This indicates that the tyrosinase from Verrucomicrobium spinosum has higher catalytic efficiency. The melanin production of genetically engineered bacteria using tyrosinase derived from Bacillus megaterium was low, so this method was not chosen.

[0413] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The use of genetically engineered bacteria in the biological preparation of a drug for treating acute radiation enteritis, characterized in that: The genetically engineered bacteria are genetically engineered bacteria expressing a tyrosinase gene, and the nucleotide sequence of the plasmid of the genetically engineered bacteria is shown as SEQ ID No.

33. ​ The tyrosinase gene is a VsTYR mutant gene optimized according to the codon bias of Escherichia coli, and the nucleotide sequence of the gene is shown as SEQ ID No.

30. The VsTYR mutant gene has mutation sites of M235A and N229H, and the amino acid sequence of the gene is shown as SEQ ID No.

29. The VsTYR gene is a tyrosinase gene derived from Verrucomicrobium spinosum, and the amino acid sequence of the gene is shown as SEQ ID No. 28, and the NCBI accession number of the VsTYR gene is MK550618.

1. The starting bacteria of the genetically engineered bacteria are Escherichia coli with pheA gene, trpR gene and pykA gene knocked out, and the Escherichia coli is E. coli Nissle 1917, which is a probiotic, and the drug for treating acute radiation enteritis is an oral preparation.

2. Use according to claim 1, characterized in that: The preparation method of the genetically engineered bacteria is to integrate the gene of the VsTYR mutant gene optimized according to the codon bias of Escherichia coli into the starting bacteria of the genetically engineered bacteria by using the CRISPR / Cpf1 gene editing method.

3. Use according to claim 1, characterized in that: The genetically engineered bacteria have a broad spectrum of free radical DPPH·, ·OH, O2·-, H2O2 and ·NO clearance ability.

4. The use according to claim 1, characterized in that: The genetically engineered bacteria can reduce the inflammation level of the small intestine tissue of the acute radiation enteritis model mice.

5. The use according to claim 1, characterized in that: The genetically engineered bacteria have a concentration of more than 3 times of E. coli Nissle 1917 in the abdominal colonization of the acute radiation enteritis model mice, and the melanin is continuously released for more than 24 hours.

6. The use according to claim 1, characterized in that: The genetically engineered bacteria increase the beneficial bacteria Verrucomicrobia in the intestinal flora of the acute radiation enteritis model mice, and reduce the harmful bacteria Bacteroidetes.

7. The use according to any one of claims 1-6, wherein the drug for treating acute radiation enteritis is an oral liquid preparation.

8. The use according to claim 1, characterized in that: The melanin produced by the genetically engineered bacteria has no obvious effect on the survival activity of Hiec cells, and has good biocompatibility at the cellular level.

9. The use according to claim 1, characterized in that: The genetically engineered bacteria have no obvious effect on blood routine indexes, and have no obvious effect on the histological structure of main organs.

Images