Application of Escherichia coli regulatory factor DpiA in acid tolerance regulation

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of an escherichia coli transcription factor DpiA in acid tolerance regulation. By systematically analyzing an escherichia coli acid tolerance regulation mechanism, it is found for the first time that DpiA serves as a negative regulation factor to participate in escherichia coli acid stress response, and the expression quantity of DpiA is in negative correlation with acid tolerance; the acid tolerance is tested by weakly expressing the regulatory factor gene dpiA, which shows that the growth level in an acid environment (especially in an acid environment with pH of 4.5-5.5) is obviously improved compared with that of a wild strain without regulating the expression quantity of the dpiA, so that the blank of the existing research on the cognitive function of the DpiA is filled, a new view angle is provided for understanding a regulation network of the environmental adaptability of bacteria, and the application prospect is broad. Meanwhile, a new strategy is provided for improving the acid tolerance of the escherichia coli.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to an application of Escherichia coli transcription factor DpiA in acid tolerance regulation. Background Art

[0002] Acid tolerance in Escherichia coli is one of its core survival strategies for adapting to the host's gastrointestinal acidic environment and external stresses, and it plays a crucial role in regulating its pathogenicity, environmental adaptability, and potential industrial applications. In industrial biomanufacturing, many fermentation processes produce large amounts of organic acids (such as lactic acid, acetic acid, and butyric acid) and acidic amino acids. The accumulation of these acidic products significantly lowers the pH of the fermentation system, causing stress on the growth and metabolism of the strain, thereby limiting the yield and efficiency of the target product. Therefore, improving the acid tolerance of E. coli can significantly enhance the metabolic activity of engineered strains under low pH conditions, thereby improving the production efficiency of organic acids and other fermentation products, reducing the use of neutralizers and the cost of fermentation process control. Furthermore, strains with high acid tolerance are better able to adapt to harsh environmental conditions and exhibit enhanced environmental adaptability. However, significant gaps remain in our understanding of the dynamic transcriptional regulatory network underlying acid tolerance in E. coli. A modular analysis approach based on iModulon can systematically reveal the underlying regulatory mechanisms of acid stress responses, providing functional modules and regulatory elements for the design of acid-tolerant chassis cells for synthetic biology, with important applications in public health and biotechnology.

[0003] DpiA (DNA-binding transcriptional dual regulator) is a dual transcriptional regulator involved in anaerobic citric acid catabolism. Under citric acid and anaerobic conditions, it activates citric acid fermentation genes, citCDEFXGT Operator, citAB Operon and mdh , and for dissimilating hexuronic acid exuTR In addition, when overexpressed in E. coli, DpiA disrupts plasmid inheritance, making it genetically unstable and inhibiting the expression of genes encoding regulators of anaerobic metabolism. appY The SOS response is induced by competing with DnaA and DnaB for binding to the A / T-rich sequence at the replication origin.

[0004] Currently, most studies focus on the anaerobic citrate decomposition function of DpiA in Escherichia coli. However, no studies have yet shown the potential regulatory relationship of DpiA under acid stress. Summary of the Invention

[0005] The present invention constructs a comprehensive set of Escherichia coli tolerance regulatory networks based on large-scale transcriptome data analysis, screens and establishes the Escherichia coli acid tolerance DpiA iModulon and the key transcriptional regulatory factor DpiA, and further determines the role of the DpiA transcriptional regulatory factor in the regulation of Escherichia coli acid tolerance by constructing engineered bacteria that overexpress or weakly express the DpiA transcriptional regulatory factor.

[0006] The technical route adopted by the present invention is as follows: One of the technical solutions provided by the present invention is the use of the transcriptional regulator DpiA or its encoding gene in regulating the acid tolerance of Escherichia coli; The regulation of the acid tolerance of Escherichia coli is specifically reflected in that the acid tolerance of Escherichia coli is negatively correlated with the expression level of DpiA, that is, the acid tolerance of Escherichia coli decreases with the increase of the expression level of DpiA; Furthermore, the amino acid sequence of the transcriptional regulator DpiA is shown in SEQ ID NO.1; Furthermore, the nucleotide sequence of the gene encoding the transcriptional regulatory factor DpiA is shown in SEQ ID NO.2.

[0007] The second technical solution provided by the present invention is a method for improving the acid tolerance of Escherichia coli, which is achieved by reducing the expression level of the transcriptional regulator DpiA in Escherichia coli; Furthermore, the method for reducing the expression level includes but is not limited to: weak expression of DpiA; the method for weak expression of DpiA includes but is not limited to weak expression at the transcriptional level or weak expression at the protein translation level; the weak expression at the transcriptional level includes but is not limited to regulating the expression of DpiA using a weak promoter or a promoter with a low copy number; the weak expression at the protein translation level includes but is not limited to inhibiting the expression of the target gene at the translation level using small regulatory RNA (sRNA) technology, etc.; Furthermore, sRNA technology specifically binds to the target gene mRNA through its target binding sequence (TBS), and recruits Hfq protein with the help of scaffold sequence to stabilize the sRNA-mRNA hybrid structure, thereby blocking ribosome binding or movement and inhibiting the expression of the target gene at the translation level.

[0008] The third technical solution provided by the present invention is a method for reducing the acid tolerance of Escherichia coli, which is achieved by increasing the expression level of the transcriptional regulator DpiA in Escherichia coli; Furthermore, the method for increasing the expression level includes but is not limited to: overexpressing DpiA; the method for overexpressing DpiA includes but is not limited to overexpression at the transcriptional level or overexpression at the protein translation level; the overexpression at the transcriptional level includes but is not limited to regulating the expression of DpiA using a strong promoter or a promoter with a high copy number; the overexpression at the protein translation level includes but is not limited to improving translation efficiency by using a strong RBS (ribosome binding site); Preferably, by introducing a recombinant expression vector containing the DpiA coding gene into the target Escherichia coli, the expression level of the transcriptional regulator DpiA in the Escherichia coli is increased, thereby reducing the acid tolerance of the recombinant Escherichia coli; The expression plasmid used in the recombinant expression vector includes but is not limited to medium and low copy number Escherichia coli expression vectors commonly used in the art. The medium and low copy number expression vectors refer to expression vectors with a copy number within the range of 10-15, such as: pBR322, pTK204, p15C-Kong plasmids, etc.

[0009] The fourth technical solution provided by the present invention is a recombinant Escherichia coli with improved acid tolerance, in which the p20-MicC plasmid is used as the backbone plasmid to construct a targeted inhibitory dpiA Gene expression of sRNA recombinant expression vector, and the recombinant expression vector is introduced into the starting strain to obtain; Furthermore, the targeted inhibition dpiA The target binding sequence (TBS) used in the sRNA recombinant expression vector for gene expression is GATCAATAGGGTTAATGGAGCTGTCAT; Furthermore, the targeted inhibition dpiA The sRNA recombinant expression vector for gene expression is p20C-sRNA- dpiA Plasmid, nucleotide sequence is shown in SEQ ID NO.5; Furthermore, the starting strain of Escherichia coli includes but is not limited to MG1655; Furthermore, the recombinant Escherichia coli has improved acid tolerance at pH 4.5-5.5.

[0010] The fifth technical solution provided by the present invention is a recombinant Escherichia coli with reduced acid tolerance. The Escherichia coli is obtained by using MG1655 as the starting strain, and constructing a recombinant expression vector containing the DpiA encoding gene using the p15C-Kong plasmid as the backbone plasmid, and then introducing the recombinant expression vector into the starting strain.

[0011] Beneficial effects: This paper systematically analyzes the regulatory mechanism of acid tolerance in Escherichia coli and finds for the first time that DpiA is involved in the acid stress response of Escherichia coli as a negative regulatory factor, and its expression level is negatively correlated with acid tolerance. dpiA Testing acid tolerance showed that the growth level in acidic environment (especially pH 4.5-pH 5.5) was lower than that in unregulated environment. dpiA The expression level of the wild-type strain was significantly improved, filling the gap in existing research on the function of DpiA, providing a new perspective for understanding the bacterial environmental adaptability regulatory network, and providing a new strategy for improving the acid tolerance of Escherichia coli. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Picture 1 p15C- dpiA Plasmid map.

[0013] Picture 2 p20C-sRNA- dpiA Plasmid map.

[0014] Picture 3 This is to verify the acid tolerance of the p15-DpiA strain.

[0015] Picture 4 is the growth level of the p20-sDpiA strain under neutral conditions.

[0016] Picture 5 This is to verify the acidic tolerance of the p20-sDpiA strain at pH 5.5.

[0017] Picture 6 This is to verify the acidic tolerance of the p20-sDpiA strain at pH 4.5. DETAILED DESCRIPTION

[0018] The present invention will be further described below with reference to the following examples. The following examples are provided to enable those skilled in the art to better understand the present invention, but are not intended to limit the present invention in any way.

[0019] The original strain Escherichia coli MG1655 used in the present invention is derived from a typical strain preserved by ATCC (ATCC®700926).

[0020] The construction method of the p15C-Kong plasmid involved in the embodiments of the present invention has been disclosed in the following document: Lin, Z., Xu, Z., Li, Y., Wang, Z., Chen, T., Zhao, X., 2014. Metabolic engineering of Escherichia coli for the production of riboflavin. Microb. Cell Fact. 13, 1-12; the nucleotide sequence of the p15C-Kong plasmid is shown in SEQ ID NO. 3.

[0021] The p20C-MicC plasmid and p20C-Kong plasmid (p20C-Kong is an empty plasmid without TBS and MicC) involved in the embodiments of the present invention have been constructed as described in the following literature: Hu, W., Liu, S., Wang, Z., Chen, T., 2021. Improving riboflavin production by knocking down ribF, purA and guaC genes using synthetic regulatory small RNA. J. Biotechnol. 336, 25-29; the p20C-Kong plasmid is an empty plasmid without TBS and MicC. The nucleotide sequence of the p20C-MicC plasmid is shown in SEQ ID NO. 4.

[0022] Phanta DNA polymerase and related systems, 2× Rapid Taq Master Mix, 1 kb DNA Ladder, 10× Loading Buffer, and other molecular biology reagents used in this invention were purchased from Nanjing Vazyme (https: / / www.vazyme.com / ). 2× MultiF Seamless Assembly Mix, DpnI enzyme, and other molecular biology reagents were purchased from Abclonal (https: / / www.abclonal.com / ). Other biochemical reagents were purchased from Sangon Biotech (Shanghai) Co., Ltd. (http: / / www.sangon.com / ).

[0023] The present invention is further explained below through specific embodiments.

[0024] Example 1 Method for constructing a collection of Escherichia coli-tolerant iModulons The present invention discloses a method for constructing a comprehensive set of Escherichia coli tolerance regulatory networks based on large-scale transcriptome data analysis. First, 977 Escherichia coli RNA-seq datasets covering 11 types of environmental stresses, including antibiotics, extreme temperatures, acidity, and osmotic pressure, were collected from the NCBI SRA database system. Through a standardized quality control process (including sequence quality assessment, low-quality sample filtering, and expression normalization), a gene expression matrix containing 597 high-quality transcriptome data was finally obtained. Using the optimized independent component analysis algorithm (OptICA), after removing empty iModulons with 0 genes, 142 stable non-empty iModulons were finally obtained, which were defined as the tolerance iModulons comprehensive set ZYH142. This comprehensive set covers 4,305 genes, which are associated with multiple tolerance phenotypes and are classified based on gene function annotations and the overlap with known regulators. A 30% gene overlap threshold was used to identify 104 regulatory iModulons. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis defined 18 functional iModulons. The remaining iModulons were categorized as single genotypes (2) and uncharacterized (18). This comprehensive collection provides a global regulatory module library for systematically analyzing the environmental adaptation mechanisms of Escherichia coli.

[0025] Example 2 Screening process of DpiA iModulon and its regulatory factors Based on the tolerance collection ZYH142 constructed in Example 1, the present invention further screened for potential key regulatory factors through unique tolerance subset analysis. 597 RNA-seq data sets were divided by tolerance type, and the OptICA algorithm was applied to generate an acid tolerance collection (AC) derived from 90 acid-stress RNA-seq data sets. Comparison of iModulons between the ZYH142 collection and the AC subset revealed the presence of the acid-tolerance-specific regulatory DpiA iModulon in the AC collection, which co-occurs only in the collection and the acid-tolerance subset. DpiA directs citric acid catabolism under anaerobic conditions and induces the SOS response. Furthermore, there is a significant negative correlation between DpiA and DksA iModulon. Furthermore, based on transcriptome data from Aquino et al., differential iModulon activity analysis revealed that decreased DpiA iModulon activity in strains with enhanced acid tolerance is associated with a function in regulating acid tolerance. This further confirms DpiA's role as a key regulator of acid tolerance.

[0026] Example 3 Construction of strains overexpressing and weakly expressing DpiA transcriptional regulatory factors (1) p15C- dpiA Plasmid construction Using the Escherichia coli K-12 MG1655 genome as a template and DpiA-F and DpiA-R as upstream and downstream primers, PCR amplification was performed to obtain the linearized target gene fragment 1 (DpiA); Plasmid backbone fragment 1 was obtained by PCR amplification using p15C-Kong as a template and p15-DpiA-F and p15-DpiA-R as upstream and downstream primers; The fragment obtained by PCR was purified, and the concentration of the DNA fragment was quantified using a nucleic acid protein quantifier (Bio-Rad). Gene fragment 1 and backbone fragment 1 were connected using seamless cloning technology and verified by colony PCR to obtain p15C- dpiA Plasmid, map such as Picture 1 The primer sequences used in the operation process are shown in Table 1.

[0027] PCR amplification system: 2 μL template, 2 μL upstream and downstream primers, 2 μL each, 1 μL dNTP, 25 μL phanta buffer, 17 μL sterile double-distilled water, 1 μL DNA polymerase, total volume 50 μL.

[0028] PCR reaction conditions were: 95°C for 3 minutes, 30 cycles (95°C for 20 seconds, 58°C for 20 seconds, 72°C for 1 minute), 72°C for 10 minutes, and 4°C for 10 minutes. Transformation and culture were then performed, and single colonies were picked and verified by colony PCR using p15-F as the upstream primer and p15-R as the downstream primer.

[0029] (2) p20C-sRNA- dpiA Plasmid construction Small regulatory RNA (sRNA) technology can inhibit target gene expression at the translational level. sRNAs are based on natural regulatory elements and consist of a target binding sequence and a scaffold sequence. A TBS designed based on the mRNA of the target gene to be attenuated can target the synthetic sRNA element to that mRNA. The scaffold sequence, which contains an Hfq protein binding site and a terminator, recruits the Hfq protein, stabilizing the sRNA-mRNA hybrid and thereby inhibiting ribosome translation. This study employed the general design guidelines for sRNA elements proposed by Sang et al., selecting the most efficient MicC scaffold sequence. The specific design process involved: first, a TBS was designed based on the target gene (dpiA) mRNA sequence; second, the TBS was inserted 5' of the MicC scaffold sequence. The binding capacity of the TBS to the target gene and the binding free energy (ΔG) between the sRNA and mRNA were evaluated using a combination of the TargetRNA2 and UNAfold online tools, respectively. Finally, the designed TBS was fused to the scaffold sequence using primers and overexpressed on a plasmid. A 20-copy plasmid vector was selected to ensure maximum attenuation efficiency.

[0030] TBS was designed in the upstream and downstream primers s-DpiA-F and s-DpiA-R. PCR amplification was performed using primers s-DpiA-F / R and p20C-MicC as a template to connect TB-dpiA (TBS) to the plasmid vector to obtain plasmid backbone 2. The fragment obtained by PCR was purified, and the concentration of the DNA fragment was quantified using a nucleic acid protein quantifier (Bio-Rad). The plasmid backbone 2 was circularized using seamless cloning technology and verified by colony PCR to obtain p20C-sRNA- dpiA Plasmid (SEQ ID NO.5), map as Picture 2 The primer sequences used in the operation process are shown in Table 1.

[0031] PCR amplification system: 2 μL template, 2 μL upstream and downstream primers, 2 μL each, 1 μL dNTP, 25 μL phanta buffer, 17 μL sterile double-distilled water, 1 μL DNA polymerase, total volume 50 μL.

[0032] PCR reaction conditions were: 95°C for 3 minutes, 30 cycles (95°C for 20 seconds, 58°C for 20 seconds, 72°C for 1 minute), 72°C for 10 minutes, and 4°C for 10 minutes. Transformation and culture were then performed, and single colonies were picked and verified by colony PCR using s-DpiA-F as the upstream primer and SR as the downstream primer.

[0033] (3) The operational procedures for constructing strains that overexpress or weakly express the DpiA transcriptional regulatory factor are as follows: p15C- dpiA The plasmid was introduced into Escherichia coli MG1655 by electroporation to obtain strain p15-DpiA.

[0034] The p15C-Kong plasmid was introduced into Escherichia coli MG1655 by electroporation to obtain strain p15-C as a control.

[0035] p20C-sRNA- dpiA The plasmid was introduced into Escherichia coli MG1655 by electroporation to obtain strain p20-sDpiA.

[0036] The p20C-Kong plasmid (p20C-Kong is an empty plasmid without TBS and MicC) was introduced into Escherichia coli MG1655 by electroporation to obtain strain p20-C as a control.

[0037] Table 1 Primer sequences used for strain construction

[0038] Example 4 Verification of the Acid Tolerance Regulation Mechanism of the Transcriptional Regulator DpiA (1) Verification of acid tolerance of DpiA-overexpressing strains Pick single colonies from the LB solid culture medium plates streaked with the p15-DpiA strain and the p15-C strain, inoculate them into 5 mL liquid LB culture medium tubes containing ampicillin, and culture them overnight at 37°C and 220 rpm. Take 1 mL of bacterial solution and place it in a sterile 2 mL EP tube. Centrifuge it at 4200 rpm for 3 min, and discard the supernatant. Add 1 mL of sterilized M9 basic salt culture medium to the EP tube, pipette to mix, and centrifuge it at 4200 rpm for 3 min. Discard the supernatant and repeat this step. Add 1 mL of sterilized M9 basic salt culture medium to the EP tube, pipette to resuspend it, and measure the OD of the bacterial solution. 600 The initial OD value after inoculation 600 The cells were transferred to 50 mL of M9 minimal salt medium containing ampicillin and pH 5.5 (pH adjusted with hydrochloric acid) with a value of 0.1. 1 mM IPTG was added as inducer. The shake flasks were placed in a shaker at 37°C and cultured at 220 rpm for 48 hours. Samples were taken every 2 hours during the logarithmic growth phase to measure the logarithmic growth curve. After the stationary phase, samples were taken every 12 hours to measure and record the OD value of the bacterial solution. 600 Value. Growth curve as Picture 3 shown.

[0039] The results showed that after 48 hours of shake flask fermentation, the maximum biomass of p15-DpiA was 18.36% lower than that of the control strain, indicating that overexpression of the transcription factor DpiA significantly impaired the acid tolerance of E. coli.

[0040] (2) Verification of acid tolerance of weakly expressed DpiA strains Single colonies were picked from the LB solid culture medium plates streaked with the p20-sDpiA strain and the p20-C strain, respectively, and inoculated into 5 mL liquid LB culture tubes containing spectinomycin bacteria, and cultured overnight at 220 rpm at 37°C. 1 mL of bacterial solution was placed in a sterile 2 mL EP tube, centrifuged at 4200 rpm for 3 min, and the supernatant was discarded. 1 mL of sterilized M9 basic salt culture medium was added to the EP tube, pipetted to mix, and centrifuged at 4200 rpm for 3 min in a centrifuge, and the supernatant was discarded. Repeat this step. 1 mL of sterilized M9 basic salt culture medium was added to the EP tube, pipetted to resuspend, and the OD of the bacterial solution was measured. 600 The initial OD value after inoculation 600 The cells were transferred to 50 mL of M9 minimal salt medium containing spectinomycin (pH adjusted with hydrochloric acid) at pH 7.0, pH 4.5, and pH 5.5, respectively, with a pH value of 0.1. The shake flasks were placed in a shaker at 37°C and 220 rpm for 48 hours. During the logarithmic growth phase, samples were taken every 2 hours to measure the logarithmic growth curve. After the stationary phase, samples were taken every 12 hours to measure and record the OD value of the bacterial solution. 600 Value. Growth curve as Picture 4 、 Picture 5 、 Picture 6 shown.

[0041] The results showed that under neutral conditions of pH 7.0, the expression of dpiA The growth level of strain p20-sDpiA was significantly lower than that of the control bacteria. dpiA The biomass of strain p20-sDpiA and the control strain p20-C expressing an empty plasmid were 0.575 and 0.407 respectively when they reached the stationary phase, indicating weak expression. dpiA The biomass of the strain increased by 41.28% compared with the control. dpiA The maximum specific growth rate of the strain (0.417 / h) was significantly increased by 103% compared with the control (0.205 / h). dpiA The biomass of strain p20-sDpiA and the control strain p20-C expressing an empty plasmid were 0.352 and 0.272 respectively when they reached the stable phase, indicating weak expression. dpiAThe biomass of the strain increased by 29.41% compared with the control, confirming the key role of DpiA as a negative transcriptional regulator in acid stress response.

[0042] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various changes, modifications, substitutions and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. Application of the transcriptional regulator DpiA or its encoding gene in regulating the acid tolerance of Escherichia coli.

2. The use according to claim 1, wherein The amino acid sequence of the transcriptional regulatory factor DpiA is shown in SEQ ID NO.1; the nucleotide sequence of the gene encoding the transcriptional regulatory factor DpiA is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The regulation of the acid tolerance of Escherichia coli is specifically reflected in that the acid tolerance of Escherichia coli is negatively correlated with the expression level of DpiA.

4. A method for improving the acid tolerance of Escherichia coli, characterized in that: The method is achieved by reducing the expression level of the transcriptional regulatory factor DpiA in Escherichia coli.

5. The method for improving the acid tolerance of Escherichia coli according to claim 4, wherein: The method for reducing the expression level includes but is not limited to: weakly expressing DpiA; the method for weakly expressing DpiA includes but is not limited to weak expression at the transcription level or weak expression at the protein translation level.

6. A method for reducing the acid tolerance of Escherichia coli, characterized in that: The method is achieved by increasing the expression level of the transcriptional regulatory factor DpiA in Escherichia coli.

7. The method for reducing the acid tolerance of Escherichia coli according to claim 6, wherein: The method for increasing the expression level includes but is not limited to: overexpressing DpiA; the method for overexpressing DpiA includes but is not limited to overexpression at the transcription level or overexpression at the protein translation level.

8. A recombinant Escherichia coli with improved acid tolerance, characterized in that: In the starting strain of Escherichia coli, the p20-MicC plasmid was used as the backbone plasmid to construct a targeted inhibitory dpiA The sRNA recombinant expression vector of the gene expression is introduced into the starting strain to obtain it.

9. Use of the strain according to claim 8 in improving acid tolerance.

10. The use according to claim 9, characterized in that The acid tolerance refers to the tolerance under pH 4.5-5.5 conditions.

Images