Construction method and application of Pseudomonas proteinans Pyo gene knockout strain

Abstract

The invention provides a construction method and application of a Pseudomonas proteinans Pyo gene knockout strain, and belongs to the technical field of gene engineering. The invention provides a Pyo gene capable of influencing the virulence of pseudomonas proteus. The nucleotide sequence of the Pyo gene is shown as SEQ ID No.7. The invention also provides a preparation method of the Pyo gene capable of influencing the virulence of pseudomonas proteus. The invention provides a pseudomonas proteus Pyo gene knockout box, and then the gene knockout box is connected with a suicide plasmid to obtain a gene knockout vector. The invention further provides a homologous exchange method, and the gene knockout vector in the escherichia coli donor bacterium containing the gene knockout vector is transferred into the donor bacterium, so that the Pseudomonas proteinans Pyo gene knockout strain is obtained. Due to the deletion of the Pyo gene, the iron absorption and transportation capabilities of the pseudomonas proteinatica are reduced, the number of viable bacteria is reduced, and the pathogenicity of the pseudomonas proteinatica to the large yellow croaker is reduced.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a method for constructing a Pseudomonas aeruginosa Pyo gene knockout strain and its application. Background Art

[0002] Pseudomonas plecoglossicida is a Gram-negative bacterium with a rod-shaped morphology and polar flagella that can infect fish such as large yellow croaker, grouper, and rainbow trout. Infection with Pseudomonas plecoglossicida can cause white nodules in the spleen, kidney, and liver, hence the name visceral white spot disease (ICD). This disease, caused by Pseudomonas plecoglossicida, is a major problem plaguing the large yellow croaker aquaculture industry, resulting in high morbidity and mortality, causing significant economic losses and severely restricting the aquaculture industry's development.

[0003] Currently, there are a large number of literatures and patents on gene suppression of Pseudomonas aeruginosa in an attempt to obtain a large number of attenuated strains. For example, Chinese patent CN112625996A discloses a strain with a stable znuA gene silenced in Pseudomonas aeruginosa, Chinese patent CN113528407A discloses a strain with a tonB gene silenced in Pseudomonas aeruginosa, and Chinese patent CN110055200A discloses a strain with a clpV gene silenced in Pseudomonas aeruginosa. These mutant strains all have attenuated properties, but there is less research on other gene knockout schemes. Summary of the Invention

[0004] The present invention provides a method for constructing a Pyo gene knockout strain of Pseudomonas aeruginosa and its application. A mutant strain can be obtained by knocking out the Pyo gene, thereby reducing pathogenicity.

[0005] The present invention provides a Pyo gene that affects the virulence of Pseudomonas aeruginosa. The nucleotide sequence of the Pyo gene is shown in SEQ ID No.7.

[0006] The present invention provides a method for constructing a Pseudomonas aeruginosa Pyo gene knockout cassette, comprising the following steps: (1) using Pseudomonas aeruginosa genomic DNA as a template, performing fusion PCR amplification using two pairs of primers to obtain a fusion fragment; the nucleotide sequences of the two pairs of primers are shown in SEQ ID No. 1 to SEQ ID No. 4, respectively;

[0007] (2) Connecting the fusion fragment described in step (1) to a cloning vector, extracting the plasmid after transforming bacteria, and performing double enzyme digestion on the plasmid to obtain the Pseudomonas aeruginosa Pyo gene knockout cassette; the enzymes used for the double enzyme digestion include EcoR I and Hind III.

[0008] In a preferred embodiment of the present invention, the fusion PCR amplification in step (1) comprises amplifying with each pair of primers separately to obtain a first fragment and a second fragment; wherein the nucleotide sequences of the first pair of primers are shown as SEQ ID No. 1 and SEQ ID No. 2, and the nucleotide sequences of the second pair of primers are shown as SEQ ID No. 3 and SEQ ID No. 4; the amplification procedure comprises: pre-denaturation at 95° C. for 3 min; denaturation at 95° C. for 15 s, annealing at 55° C. for 15 s, extension at 72° C. for 1 min, 30 cycles; final extension at 72° C. for 5 min;

[0009] Fusion PCR was performed with the mixture of the first fragment and the second fragment. The fusion PCR procedure included: initial denaturation at 95°C for 3 min; 15 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 30 s; and final extension at 72°C for 5 min.

[0010] The fusion PCR product was used as a template and the primers shown in SEQ ID No. 1 and SEQ ID No. 4 were used as a primer pair for PCR amplification. The PCR amplification procedure included: pre-denaturation at 95° C. for 3 min; denaturation at 95° C. for 15 s, annealing at 55° C. for 15 s, and extension at 72° C. for 50 s, for 15 cycles; and final extension at 72° C. for 5 min.

[0011] The present invention provides a Pseudomonas aeruginosa Pyo gene knockout cassette constructed by the above construction method.

[0012] The present invention provides a gene knockout vector comprising the Pseudomonas aeruginosa Pyo gene knockout cassette, wherein the gene knockout vector is based on a suicide vector.

[0013] In a preferred embodiment of the present invention, the suicide vector comprises pEX18Gm.

[0014] The present invention provides a method for constructing the gene knockout vector, comprising the following steps: connecting the Pseudomonas aeruginosa Pyo gene knockout cassette between EcoR I and HindIII of a suicide vector to obtain the gene knockout vector.

[0015] The present invention provides the use of the above-mentioned Pseudomonas aeruginosa Pyo gene knockout cassette or the above-mentioned gene knockout vector in constructing a Pseudomonas aeruginosa Pyo gene knockout strain.

[0016] The present invention provides a method for constructing a Pseudomonas aeruginosa Pyo gene knockout strain, comprising the following steps: (1) transforming the above-mentioned gene knockout vector into competent Escherichia coli to construct an Escherichia coli carrying the knockout vector;

[0017] (2) Using the Escherichia coli carrying the knockout vector described in step (1) as the donor bacterium and the wild strain of Pseudomonas aeruginosa as the recipient bacterium, the homologous exchange method is used to obtain the Pseudomonas aeruginosa Pyo gene knockout strain through cultivation and screening.

[0018] The present invention also provides a Pseudomonas aeruginosa Pyo gene knockout strain Pp0402-ΔPYO constructed by the above construction method. The Pp0402-ΔPYO has been biologically deposited with a deposit number of CCTCC M 20251005.

[0019] The present invention also provides the use of the Pseudomonas aeruginosa Pyo gene knockout strain in preparing a vaccine strain or a vaccine.

[0020] Beneficial effects: The present invention provides a Pyo gene that affects the virulence of Pseudomonas aeruginosa, and the nucleotide sequence of the Pyo gene is shown in SEQ ID No. 7. A Pseudomonas aeruginosa Pyo gene knockout cassette is also provided. The Pseudomonas aeruginosa Pyo gene knockout cassette is constructed based on a fusion PCR amplification method, and then the Pseudomonas aeruginosa Pyo gene knockout cassette is connected to a suicide plasmid to obtain a gene knockout vector. The present invention also provides a method for utilizing the gene knockout vector to transfer the gene knockout vector from an Escherichia coli donor bacterium containing the gene knockout vector to the donor bacterium through a homologous exchange method, thereby obtaining a Pseudomonas aeruginosa Pyo gene knockout strain.

[0021] The deletion of the Pyo gene described in the present invention does not affect the growth ability of Pseudomonas aeruginosa, does not affect the enzymatic activity and hemolytic activity of ECP, and does not significantly affect the biofilm formation ability of Pseudomonas aeruginosa. The Pyo gene knockout strain Pp0402-△PYO described in the present invention exhibits a reduction or shortening of flagella, which significantly affects the motility of Pseudomonas aeruginosa, demonstrating that the Pyo gene may be related to flagellar growth or metabolic activity. At the same time, the deletion of Pyo reduces the ability of Pseudomonas aeruginosa to absorb and transport iron, thereby reducing the number of viable bacteria and reducing the pathogenicity of Pseudomonas aeruginosa to large yellow croaker.

[0022] Biological deposit information

[0023] The Pyo gene knockout strain of Pseudomonas plecoglossicida Pp0402-△PYO was deposited in the China Center for Type Culture Collection (CCTCC) on May 9, 2025. The specific deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC M 20251005. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is the plasmid map of pEX18Gm;

[0025] Figure 2 Colony PCR was used to identify transformants carrying the knockout cassette. In the figure, 1: DL2000 DNA Marker; 2-4: transformants carrying pEX18-pyo; 5: negative control using double-distilled water as a template; 6: positive control using the knockout plasmid as a template;

[0026] Figure 3 This is the result of colony PCR verification of Pp0402-△PYO (hereinafter abbreviated as 0402-△pyo). In the figure, 1: DL2000 DNA marker; lanes 2-7: 0402-△pyo transformants 1-6; 8: double-distilled water; 9: Pyo gene knockout vector;

[0027] Figure 4 This is the full-length gene verification result of 0402-△pyo. In the figure, 1: 0402-△pyo transformant; 2: Pyo knockout vector; 3: double-distilled water; 4: wild-type H17050402 DNA; 5: DL10000 DNA marker;

[0028] Figure 5 24-h growth curves of H17050402 (abbreviated as 0402 in the figure) and 0402-Δpyo;

[0029] Figure 6 The bacterial morphology of H17050402 and 0402-△pyo was observed by transmission electron microscopy (magnification 10000 times);

[0030] Figure 7 The figure shows the enzyme activity identification results of ECP of H17050402 and 0402-△pyo;

[0031] Figure 8 The figure shows the results of the hemolytic activity identification of ECP of H17050402 and 0402-△pyo;

[0032] Figure 9 The figure shows the results of the biofilm formation ability identification of H17050402 and 0402-△pyo;

[0033] Figure 10 This figure shows the comparison of the motility of H17050402 and 0402-△pyo;

[0034] Figure 11 The absorbance values ​​of H17050402 and 0402-△pyo at different OD;

[0035] Figure 12 Confocal microscopy scans of H17050402 and 0402-△pyo;

[0036] Figure 13 The survival rate of large yellow croaker after infection with H17050402 and 0402-△pyo. DETAILED DESCRIPTION

[0037] The present invention provides a Pyo gene that affects the virulence of Pseudomonas aeruginosa. The nucleotide sequence of the Pyo gene is shown in SEQ ID No.7.

[0038] The Pyo gene described in the present invention is a siderophore receptor for Pseudomonas aeruginosa, and is associated with the ability to absorb and utilize iron. In the present invention, knocking out the Pyo gene reduces pathogenicity. The nucleotide sequence of the Pyo gene is shown in SEQ ID No. 7:

[0039]

[0040] The present invention provides a method for constructing a Pseudomonas aeruginosa Pyo gene knockout cassette, comprising the following steps: (1) using Pseudomonas aeruginosa genomic DNA as a template, performing fusion PCR amplification using two pairs of primers to obtain a fusion fragment; the nucleotide sequences of the two pairs of primers are shown in SEQ ID No. 1 to SEQ ID No. 4, respectively;

[0041] (2) Connecting the fusion fragment described in step (1) to a cloning vector, extracting the plasmid after transforming bacteria, and performing double enzyme digestion on the plasmid to obtain the Pseudomonas aeruginosa Pyo gene knockout cassette; the enzymes used for the double enzyme digestion include EcoR I and Hind III.

[0042] The present invention does not specifically limit the specific strain of the Pseudomonas proteans. In one embodiment, Pseudomonas proteans H17050402 is used as an example for illustration, but it cannot be considered as the entire protection scope of the present invention. Pseudomonas proteans H17050402 was isolated, identified and preserved by the Aquatic Pathogens and Disease Control Laboratory of the Institute of Biotechnology, Fujian Academy of Agricultural Sciences, and has been disclosed in the article (Xu Binfu, Chen Xiujin, Chi Hongshu, et al. Preliminary analysis of genetic and serological clustering characteristics of Pseudomonas proteans in large yellow croaker [J]. Journal of Fujian Agricultural Sciences, 2022, 37(9): 8. DOI: 10.19303 / j.issn.1008-0384.2022.009.001.).

[0043] The present invention first locates the sequence of the Pyo gene of Pseudomonas aeruginosa about 500 bp upstream and downstream of the gene based on the sequence of the Pyo gene of Pseudomonas aeruginosa, and designs upstream and downstream fragment primers carrying enzyme cutting sites. The primer sequences are shown below.

[0044] Upstream fragment primer:

[0045] Pyo-1E (SEQ ID No. 1): CGGAATTCGCCTATCACGAACCCG;

[0046] Pyo-2 (SEQ ID No. 2): GGCGAGCAGATTGCG;

[0047] Downstream fragment primer:

[0048] Pyo-3 (SEQ ID No. 3): GCCAACCCATTTCAGCGATTG;

[0049] Pyo-4H (SEQ ID No. 4): CCCAAGCTTGGTCGTACCGCCACGG.

[0050] The present invention uses two pairs of designed primers to perform fusion PCR amplification. The fusion PCR amplification includes using Pseudomonas aeruginosa genomic DNA as a template and amplifying with primer pair Pyo-1E / Pyo-2 and primer pair Pyo-3 / Pyo-4H respectively to obtain a first fragment and a second fragment. The amplification procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute, for 30 cycles; and final extension at 72°C for 5 minutes. The amplification system, measured in 50 μL, includes: 20 μL of deionized water, 25 μL of 2×Phanta Max Master Mix, 2 μL of upstream and downstream primers, and 1 μL of template DNA.

[0051] Fusion PCR was performed on a mixture of the first fragment and the second fragment. The fusion PCR procedure included: preliminary denaturation at 95°C for 3 min; 15 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 30 s; and final extension at 72°C for 5 min. The fusion PCR system, measured in 46 μL, included: 17 μL of deionized water, 25 μL of 2×Phanta Max Master Mix, and 2 μL each of the first fragment and the second fragment.

[0052] PCR amplification was performed using the fusion PCR product as a template and primers Pyo-1E and Pyo-4H as a primer pair. During the PCR amplification, 2 μL of each primer was added to the fusion PCR system, and then PCR amplification was performed. The PCR amplification procedure included: initial denaturation at 95°C for 3 minutes; 15 cycles of denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 50 seconds; and a final extension at 72°C for 5 minutes. The PCR amplification product was recovered to obtain a 1099 bp Pyo gene knockout cassette.

[0053] The present invention provides a Pseudomonas aeruginosa Pyo gene knockout cassette constructed by the above construction method.

[0054] The present invention provides a gene knockout vector comprising the Pseudomonas aeruginosa Pyo gene knockout cassette, wherein the gene knockout vector is based on a suicide vector.

[0055] In a preferred embodiment of the present invention, the suicide vector includes pEX18Gm, which is donated by Nanjing Agricultural University and Suzhou Academy of Agricultural Sciences and has been disclosed in the article (Wang H, Yang Z, Du S, et al. Characterization of Pectobacterium carotovorum proteins differentially expressed during infection of Zantedeschia elliotiana in vivo and in vitro which are essential for virulence [J]. Molecular Plant Pathology, 2018. DOI: 10.1111 / mpp.12493.).

[0056] The present invention provides a method for constructing the gene knockout vector, comprising the following steps: connecting the Pseudomonas aeruginosa Pyo gene knockout cassette between EcoR I and HindIII of a suicide vector to obtain the gene knockout vector.

[0057] After obtaining the gene knockout cassette, the present invention first connects the gene knockout cassette to a cloning vector so that the correct knockout cassette sequence can be obtained by sequencing. As in the embodiment of the present invention, with reference to the operating steps of the cloning kit 5min TA / Blunt-Zero Cloning Kit (Novozymes), the knockout cassette fragment recovered and verified by electrophoresis is connected to the vector, and after transformation, the transformant is picked for plasmid extraction and enzyme digestion identification, the transformant with the correct enzyme digestion result is selected for sequencing. The plasmid is extracted from the transformant with correct sequencing and frozen at -20°C for standby use. The recombinant with the correct EcoR I and Hind III double enzyme digestion results is sent for sequencing. The recombinant with correct sequencing is subjected to plasmid extraction by shaking, and the target fragment is recovered by double enzyme digestion and frozen at -20°C for standby use.

[0058] The present invention utilizes EcoR I and Hind III double enzyme digestion Figure 1 After the suicide vector pEX18Gm and the cloning vector carrying the correct knockout cassette sequence were cloned, the pEX18Gm vector backbone and knockout cassette fragment were recovered, and the knockout cassette fragment was ligated to the pEX18Gm vector using T4 DNA ligase (TaKaRa) according to the kit steps to construct the knockout vector.

[0059] The present invention provides the use of the above-mentioned Pseudomonas aeruginosa Pyo gene knockout cassette or the above-mentioned gene knockout vector in constructing a Pseudomonas aeruginosa Pyo gene knockout strain.

[0060] The gene knockout cassette or knockout vector of the present invention can be used to knock out the Pyo gene of Pseudomonas aeruginosa, and obtain a Pyo gene knockout strain of Pseudomonas aeruginosa.

[0061] The present invention provides a method for constructing a Pseudomonas aeruginosa Pyo gene knockout strain, comprising the following steps: (1) transforming the above-mentioned gene knockout vector into competent Escherichia coli to construct an Escherichia coli carrying the knockout vector;

[0062] (2) Using the Escherichia coli carrying the knockout vector described in step (1) as the donor bacterium and the wild strain of Pseudomonas aeruginosa as the recipient bacterium, the homologous exchange method is used to obtain the Pseudomonas aeruginosa Pyo gene knockout strain through cultivation and screening.

[0063] The present invention utilizes a homologous exchange method to achieve Pyo gene knockout in Pseudomonas aeruginosa. Specifically, Escherichia coli carrying a knockout vector serves as a donor bacterium, and a wild-type Pseudomonas aeruginosa strain serves as a recipient bacterium. In one embodiment of the present invention, a donor bacterium is first constructed, such as by transforming the knockout vector into E. coli S17-1 competent cells.

[0064] In the embodiment of the present invention, two homologous exchanges were performed. In the first homologous exchange, S17-1 (gentamicin resistance) carrying the knockout vector and the wild-type Pseudomonas aeruginosa H17050402 (ampicillin resistance) were inoculated into LB of the corresponding resistance at 1% and cultured until OD 600 When the pH value is between 0.6 and 0.8, take 1 ml of each bacterial suspension, centrifuge and discard the supernatant, then resuspend and wash twice in sterile, antibiotic-free LB medium, and finally resuspend in 200 μL. Take equal volumes of the resuspended S17-1 and H17050402 bacterial suspensions, mix them evenly, and spread them on antibiotic-free LB plates. Incubate at 28°C overnight. Scrape the amphiphilic products from the incubation, dilute them at different times, and spread them on dual-resistant (gentamicin and ampicillin) TSA plates. Incubate at 28°C overnight. Select a single colony with rapid growth for PCR verification and streak it on a dual-resistant TSA plate.

[0065] During the second homologous exchange, 2 to 3 colonies that tested positive for knockout cassette fragments by single colony PCR were selected and cultured overnight in TSB on a shaker at 28°C. An appropriate amount of the bacterial solution was diluted and plated on ampicillin-resistant TSA plates containing 10% sucrose. After overnight culture in an incubator at 28°C, single colonies were picked and streaked onto gentamicin-resistant and ampicillin-resistant TSA plates (single colonies were first streaked onto the gentamicin-resistant plate and then onto the ampicillin-resistant plate). Culture was continued in an incubator at 28°C overnight. Single colonies that grew on the ampicillin plate but not on the gentamicin plate were then selected for colony PCR verification. Those that tested positive were the Pseudomonas aeruginosa Pyo gene knockout strains.

[0066] The present invention also provides a Pseudomonas aeruginosa Pyo gene knockout strain Pp0402-ΔPYO constructed by the above construction method. The Pp0402-ΔPYO has been biologically deposited with a deposit number of CCTCC M 20251005.

[0067] The Pyo knockout strain of Pseudomonas aeruginosa described in this study exhibited similar growth, ECP, and hemolytic activity to wild-type strains. Furthermore, the mutant strain exhibited fewer or shorter flagella than the wild-type strain, significantly impacting the motility of Pseudomonas aeruginosa. Furthermore, the Pyo deletion reduced the bacteria's ability to absorb and transport iron, thereby decreasing the number of viable bacteria and reducing their pathogenicity to large yellow croaker.

[0068] The present invention also provides the use of the Pseudomonas aeruginosa Pyo gene knockout strain in preparing a vaccine strain or a vaccine.

[0069] To further illustrate the present invention, the construction method and application of a Pseudomonas aeruginosa Pyo gene knockout strain provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0070] Unless otherwise specified, the test materials and methods used in the examples of the present invention are conventional commercially available products and well-known methods in the art.

[0071] Example 1

[0072] 1. Pseudomonas aeruginosa genome extraction

[0073] The activated wild strain H17050402 of Pseudomonas aeruginosa was transferred into a new TSB (Guangdong Huankai Microbiology Technology Co., Ltd.) at 1% and cultured for 16 h. The supernatant was removed by centrifugation, and the genomic DNA of Pseudomonas aeruginosa was extracted using the genome kit of Tiangen Biological Reagent Company and stored at -20°C.

[0074] 2. Construction of Pyo knockout vector

[0075] (1) Fusion PCR was used to construct a knockout cassette for the deleted gene. First, based on the known Pyo gene sequence, the sequences about 500 bp upstream and downstream of the gene and the multiple cloning restriction enzyme sites of the suicide vector pEX18Gm were located, and primers for the upstream and downstream fragments carrying the restriction enzyme sites (Pyo-1E / Pyo-2 and Pyo-3 / Pyo-4H) were designed.

[0076] The reaction system (50 μL) consisted of 20 μL deionized water, 25 μL 2× Phanta Max Master Mix, 2 μL each of Pyo-1E / Pyo-2 or Pyo-3 / Pyo-4H, and 1 μL of Pseudomonas aeruginosa genomic DNA to amplify the upstream and downstream fragments of the target gene, respectively. The reaction protocol was as follows: 95°C for 3 min; 30 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 1 min; and 72°C for 5 min.

[0077] Next, a knockout cassette was constructed using fusion PCR: a 46 μL reaction system consisting of 17 μL deionized water, 25 μL 2× Phanta Max Master Mix, and 2 μL each of the upstream and downstream fragments as templates. The reaction protocol was as follows: 95°C for 3 min, followed by 15 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 30 s, and 72°C for 5 min. Subsequently, 2 μL each of Pyo-1E and Pyo-4H was added to the reaction system, bringing the total to 50 μL. The protocol was then as follows: 95°C for 3 min, followed by 15 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 50 s, and 72°C for 5 min. The target bands were recovered using a Shanghai Bioengineering Gel Extraction Kit and verified by electrophoresis.

[0078] (2) The knockout cassette is constructed into a cloning vector so that the correct knockout cassette sequence can be obtained by sequencing.

[0079] Following the procedures of the 5-min TA / Blunt-Zero Cloning Kit (Novozymes), the knockout cassette fragment, recovered and verified by electrophoresis, was ligated into the vector. Following transformation, transformants were selected for plasmid extraction and enzyme digestion analysis. Several transformants with confirmed enzyme digestion results were selected for sequencing. Plasmids were extracted from transformants with correct sequencing results and frozen at -20°C until further use. Recombinants with correct EcoRI and HindIII double digestion results were sent for sequencing. Recombinants with correct sequencing results were subjected to plasmid extraction, followed by double enzyme digestion to recover the target fragment and frozen at -20°C until further use.

[0080] (3) Construction of knockout vector. The suicide vector pEX18Gm ( Figure 1 ) and a cloning vector carrying the correct knockout cassette sequence, the pEX18Gm vector backbone and knockout cassette fragment were recovered, and the knockout cassette fragment was ligated to the pEX18Gm vector using T4 DNA ligase (TaKaRa) according to the kit steps.

[0081] Ligation system (10 μL): 2 μL of 10× T4 DNA Ligase Buffer, 1 μL of linearized pEX18Gm vector, 3 μL of knockout cassette fragment, 1 μL of T4 DNA Ligase, and 3 μL of sterile ultrapure water. Mix thoroughly and incubate the system at 16°C for 3 hours.

[0082] Add 10 μL of the incubated ligation system to 100 μL of DH5α competent cells and mix thoroughly. Incubate on ice for 30 minutes, then heat shock at 42°C for 90 seconds. Immediately place on ice, add 1 mL of LB liquid medium after 2 minutes, and thaw at 37°C on a shaker at 120 rpm for 45 minutes. Centrifuge, remove the supernatant, resuspend the cells in LB, and spread an appropriate amount on a gentamicin-resistant plate. Incubate at 37°C overnight.

[0083] Transformants were picked from the plate for PCR identification. The PCR reaction system (25 μL) consisted of 12.5 μL of 2× Rapid Taq MasterMix, 1 μL each of Pyo-1E / Pyo-4H, one colony (transformant), and the remainder of sterile deionized water. The target fragment amplified was the knockout cassette. The PCR product was verified by DNA electrophoresis. Transformants that were confirmed to be correct by electrophoresis were shaken and plasmids were extracted for further sequencing verification. The knockout vectors, after sequencing, confirmed to have the correct knockout cassette sequence, were frozen at -20°C for later use.

[0084] Primers were designed based on the upstream and downstream sequences of the Pyo gene, and a band of the expected size was obtained by fusion PCR amplification. The knockout cassette of the Pyo gene is 1099 bp, and the gene knockout vector is named pEX18-pyo. The transformant (E. coli S17-1) carrying the gene knockout cassette was verified by colony PCR, and the results of agarose gel electrophoresis are shown in Figure 2 .

[0085] 3. Construction of Pyo gene knockout strain

[0086] (1) Transform the knockout vector into E. coli S17-1. Prepare E. coli S17-1 competent cells and transform the knockout vector into E. coli S17-1 competent cells using a conventional heat shock transformation method. Perform bacterial (transformant) PCR and store the transformants that are confirmed to carry the knockout vector in glycerol stock at -80°C for future use.

[0087] (2) First homologous exchange. Resuscitate S17-1 (gentamicin resistance) carrying the knockout vector and wild-type Pseudomonas aeruginosa H17050402 (ampicillin resistance), inoculate 1% into LB of the corresponding resistance, and culture until OD 600When the pH value is between 0.6 and 0.8, take 1 ml of each bacterial solution, centrifuge and discard the supernatant, resuspend and wash twice with sterile antibiotic-free LB liquid, and finally resuspend with 200 μL. Take equal volumes of resuspended S17-1 and H17050402 bacterial solutions, mix them evenly, take 30 μL and apply them to LB plates without antibiotics, and incubate them at 28°C overnight. Scrape the amphiphilic products after incubation, dilute them at different times (such as 100-fold, 1000-fold), and then apply them to dual-antibody (gentamicin and ampicillin resistance) TSA plates, and incubate them at 28°C overnight. Pick a single colony with faster growth for PCR verification and streak it on a dual-antibody TSA plate at the same time.

[0088] PCR system: 12.5 μL of 2× Rapid Taq Master Mix, 1 μL each of Pyo-1E / Pyo-4H, one colony (transformant), and the remainder sterile deionized water. The target fragment to be amplified is the length of the knockout cassette.

[0089] (3) Second homologous exchange. PCR verification is positive, that is, the knockout cassette fragment can be amplified. Pick 2 to 3 colonies and culture them in TSB shaker at 28°C overnight. Take an appropriate amount of bacterial solution to dilute and spread on ampicillin-resistant TSA plates containing 10% sucrose. After overnight culture in an incubator at 28°C, pick a single colony and streak it on gentamicin-resistant and ampicillin-resistant TSA plates respectively (single clones should be streaked on gentamicin-resistant plates first and then on ampicillin-resistant plates). Continue to culture in an incubator at 28°C overnight. Then pick a single colony that grows on the ampicillin plate but not on the gentamicin plate for colony PCR verification. The PCR system is the same as (2).

[0090] The full length of the Pyo gene is 2115 bp. Full-length primers were designed for gene knockout verification. The primer sequences are as follows:

[0091] Pyo-F (SEQ ID No. 5):ATGGCCGTGTGCATGG;

[0092] Pyo-R (SEQ ID No. 6):TCAGAAACTGTACTTGGCCG.

[0093] After two homologous exchanges between Pseudomonas aeruginosa H17050402 and a transformant carrying the Pyo gene knockout vector, a Pyo gene knockout strain (named 0402-△pyo) was obtained. The colony PCR results are as follows: Figure 3 As shown. The upstream and downstream primers of the gene knockout cassette were used to amplify the gene knockout strain transformants, and an expected band consistent with the size of the knockout cassette was obtained. Then the full-length primers of the Pyo gene were used to perform colony PCR verification of the transformants (as shown Figure 4The results showed that the expected-sized band could be obtained only in the wild-type strain 0402, but not in the gene knockout strains, indicating that the Pyo gene knockout strain had been successfully obtained.

[0094] Example 2 Functional Verification of Pyo Gene Knockout Strain 0402-Δpyo

[0095] 2.1 Materials

[0096] Large yellow croaker (Pseudomonas croaker) was obtained from the Sandao'ao large yellow croaker aquaculture area in Ningde, Fujian Province. They were temporarily maintained in aerated seawater tanks at a temperature of 16-21°C. Pseudomonas aeruginosa wild-type strain H17050402 and the Pyo gene knockout strain 0402-Δpyo were maintained in our laboratory. TSB (Guangdong Huankai Microbiology Technology Co., Ltd.), skim milk powder (Sigma), and blood agar plates (BKMAM) were used.

[0097] 2.2 Comparison of growth performance between H17050402 and 0402-△pyo

[0098] Single colonies from H17050402 and 0402-△pyo plates were picked and placed in Erlenmeyer flasks containing 10 ml of TSB. They were cultured overnight at 28°C and 200 rpm / min in a shaker as seed solution. The seed solution was inoculated at 1% inoculum into 100 ml of TSB in an Erlenmeyer flask and cultured at 28°C and 200 rpm in a shaker. The bacterial solution was aspirated at different time points to measure the OD value. 600 The experiment was repeated three times and the bacterial growth curve was drawn.

[0099] The results are as follows Figure 5 As shown in the figure, under the same culture conditions, the growth trends of 0402-△pyo and H17050402 at each stage were similar, with no significant difference, indicating that the deletion of the Pyo gene did not affect the growth ability of Pseudomonas aeruginosa.

[0100] 2.3 Phenotypic comparison between H17050402 and 0402-Δpyo

[0101] The bacterial pellets of H17050402 and 0402-△pyo strains were fixed in 2.5% glutaraldehyde for 2-4 h, rinsed three times with phosphoric acid solution, and fixed in 1% osmium acid at 4°C for 2 h; rinsed three times with ddH2O, dehydrated with gradient ethanol, transitioned with propylene oxide, embedded after gradient infiltration with 812 resin, and polymerized at 60°C. The embedded blocks were semi-thinly positioned and ultrathinly sectioned using a Leica UC7 ultramicrotome, and the sections were double-stained with uranyl acetate and lead citrate. The bacterial structure was observed using a transmission electron microscope.

[0102] like Figure 6Figure 2 shows the bacterial morphology of the wild-type Pseudomonas aeruginosa strain H17050402 and the knockout strain 0402-Δpyo observed by transmission electron microscopy. At 10,000x magnification, the knockout strain 0402-Δpyo exhibited reduced or shortened flagella, suggesting that the Pyo gene may be involved in flagellar growth or metabolic activity.

[0103] 2.4 Comparison of protein solubilization ability of H17050402 and 0402-△pyo bacterial supernatants

[0104] Preparation of protein plates: Prepare TSA solution and skim milk solution containing 15% skim milk powder respectively. Sterilize the TSA solution at 121℃ for 15 min and the skim milk powder solution at 115℃ for 15 min. Cool both to about 50℃. Mix the skim milk powder solution and TSA solution in a ratio of 1:10 and pour onto the plates so that the final concentration of skim milk powder in the plates is about 1.5%.

[0105] Preparation of bacterial supernatant: H17050402 and 0402-△pyo bacterial cultures grown overnight at 18°C ​​and 200 rpm were centrifuged at 12,000 rpm and 4°C for 10 min to separate the precipitates. The supernatant was retained and the precipitate was discarded. The supernatant was sterilized by filtration through a 0.22 μm filter membrane, and the filtered supernatant was mixed with a supersaturated ammonium sulfate solution in a ratio of 1:1 to precipitate the protein. The mixture was allowed to stand for 24 hours and then centrifuged at 12,000 rpm and 4°C for 10 min. The supernatant was discarded and the precipitate was dissolved with an appropriate amount of PBS, placed in a dialysis bag, and dialyzed in PBS solution for 3 days. During this period, the solution (i.e., PBS) was changed once a day. The solution was then slightly concentrated with sucrose, taken out, and the protein solubility was determined. The protein concentration of the bacterial supernatant of the two strains was adjusted to the same and stored at -80°C for later use.

[0106] To test the protein solubility of bacterial supernatants: Place a sterile Oxford cup on a protein plate. Take 20 μL of the supernatant from H17050402 and 0402-△pyo, each containing the same concentration, and drop it into the Oxford cup. Carefully transfer the plate to a 28°C incubator for overnight incubation. Observe the next day.

[0107] The supernatant of Pseudomonas aeruginosa, or ECP, has both enzymatic and hemolytic activity. ECPs of wild-type Pseudomonas aeruginosa strains H17050402 and 0402-△pyo were prepared using ammonium sulfate precipitation, and after adjusting the protein concentration to approximately 1 mg / mL, the enzymatic and hemolytic activities were compared using an Oxford cup. Figure 7 As shown, there was no significant difference in the diameter of the transparent zone formed by the Oxford cup on the protein plates of H17050402 and 0402-△pyo, indicating that the loss of Pyo did not change the enzyme activity of Pseudomonas aeruginosa ECP.

[0108] 2.5 Comparison of hemolytic activity between H17050402 and 0402-Δpyo strains

[0109] Place a sterilized Oxford cup on a blood agar plate (BKMAM). Take 20 μL of the supernatant from each of the H17050402 and 0402-Δpyo strains, each at the same concentration, and drop it into the Oxford cup. Carefully transfer the plate to a 28°C incubator for overnight incubation. Observe the next day.

[0110] On a blood agar plate, Figure 8 As shown, both H17050402 and 0402-△pyo showed no hemolytic activity and no difference.

[0111] 2.6 Comparison of biofilm-forming ability between H17050402 and 0402-Δpyo strains

[0112] Aseptically, the bacteria stored at -80℃ were transferred to 5mL TSB and cultured at 28℃ and 180rpm for 4-6h. Then, the inoculum volume was transferred to 5mL TSB and cultured at 20℃ and 180rpm until the OD 600 About 0.5.

[0113] Under sterile conditions, OD 600 About 0.5% of the bacterial solution was transferred to a 96-well plate, with 150 μL per well. Three replicates were set for each sample, and TSB medium was used as a negative control. The plates were cultured at 20°C and 28°C for 24 h, 48 h, and 72 h, respectively.

[0114] Take the plates separately, shake the plates gently to discard the culture medium, and avoid touching the biofilm at the bottom of the wells; gently rinse with 200 μL PBS (pH 7.4) three times, soaking for 10 seconds each time (to prevent the biofilm from falling off). Add 200 μL of anhydrous methanol to each well and fix at room temperature for 15 minutes; discard the methanol and air-dry the plate for 10 minutes (operate in a biosafety cabinet); add 200 μL of 0.1% crystal violet solution and stain at room temperature in the dark for 30 minutes; discard the staining solution and rinse with ultrapure water until no purple residue is left (it is recommended to rinse slowly with running water for 30 seconds); add 200 μL of 33% glacial acetic acid to each well and decolorize by shaking at room temperature for 10 minutes (horizontal shaker, 100 rpm); measure the OD with an enzyme reader. 570 value.

[0115] The biofilm formation ability of H17050402 and 0402-△pyo at 28℃ and 20℃ was analyzed as follows Figure 9 As shown, the OD values ​​of H17050402 were measured when cultured at 28℃ and 20℃ for 24h, 48h and 72h, respectively. 570The values ​​were all larger than those of 0402-△pyo, with significant differences achieved at 28℃ and 20℃ for 24h, respectively, and no significant differences at other time points. This indicates that the deletion of the Pyo gene has no significant effect on the biofilm formation ability of Pseudomonas aeruginosa.

[0116] 2.7 Comparison of motility between H17050402 and 0402-Δpyo strains

[0117] Aseptically, transfer the bacteria stored at -80℃ to 5mL TSB and culture them at 28℃ and 180rpm for 4-6h. Then transfer them to 5mL TSB at a 1% inoculum volume and culture them at 20℃ and 180rpm for OD 600 About 0.5.

[0118] Use sterile pipette tip (100 μL) to dip OD6 00 About 0.5% of the bacterial solution was spotted on TSA plates with an agar content of 0.35%, with 3 replicates for each group. The plates were cultured at 28°C for 24 h, 48 h, and 72 h, and the diameter of the swimming zone was measured with a vernier caliper.

[0119] like Figure 10 As shown in the figure, the motility of Pseudomonas aeruginosa H17050402 and 0402-△pyo was tested on TSA plates with 0.35% agar content. The results showed that under the same conditions, the colony diameters formed by H17050402 and 0402-△pyo were significantly different from 24 hours, and the difference was extremely significant at 72 hours, indicating that the deletion of the Pyo gene significantly affected the motility of Pseudomonas aeruginosa.

[0120] 2.8 Comparison of iron uptake capacity between H17050402 and 0402-Δpyo strains

[0121] Aseptically pick the bacterial strain and streak it on a TSA plate, place the plate at 28°C and culture for 1 day.

[0122] Use a sterile inoculating loop to pick a single mature colony and place it in 5 mL of TSB. Shake and culture at 200 rpm until the OD 600 About 0.6.

[0123] Take out the Calcein-AMrongye (4 mM) and PI solution (2 mM) stored at low temperature and return to room temperature for 20 to 30 minutes.

[0124] Add 5 μL of 4 mM Calcein-AM and 15 μL of PI solution to 5 mL of PBS buffer and mix thoroughly to prepare the staining solution. The final concentration of Calcein-AM is 4 μmol / L, and the final concentration of PI is 6 μmol / L.

[0125] Centrifuge the cultured liquid strain at 800g for 5 minutes, discard the supernatant, and rinse once with PBS. Centrifuge at 800g for 5 minutes, discard the PBS, and add an appropriate volume of Calcein-AM / PI staining solution. Typically, add 100 μL per well of a 96-well plate, 250 μL per well of a 24-well plate, 500 μL per well of a 12-well plate, and 1 mL per well of a 6-well plate. Incubate at 37°C in the dark for 15 minutes.

[0126] After incubation, observe the staining effect under a fluorescence microscope. First, use a wavelength of 490 ± 10 nm to excite the cells, which will be yellow-green for live cells. Then, use a wavelength of 545 nm to excite the cells, which will be red for dead cells. Alternatively, the staining can be directly analyzed using a fluorescence microplate reader with appropriate filters.

[0127] Pyo is a siderophore receptor in Pseudomonas aeruginosa and is associated with its ability to absorb and utilize iron. The fluorescent siderophore produced by Pseudomonas aeruginosa has specific absorption peaks at specific wavelengths. The effect of Pyo gene deletion on the iron uptake capacity of Pseudomonas aeruginosa can be quantitatively assessed by measuring the OD values ​​at wavelengths of 490-540 nm (for live cells) and OD values ​​at 535-620 nm (for dead cells).

[0128] The results are as follows Figure 11 As shown in the following figure: Under the wavelength of 490-540nm, the OD value of the wild strain H17050402 was 202, and the OD value of 0402-△pyo was 169; under the wavelength of 535-620nm, the OD value of the wild strain H17050402 was 580, and the OD value of 0402-△pyo was 260. This indicates that the deletion of the Pyo gene reduces the ability of Pseudomonas aeruginosa to absorb and transport iron, thereby reducing the number of viable bacteria. Figure 12 shown.

[0129] 2.9 Comparison of pathogenicity of H17050402 and 0402-Δpyo strains to large yellow croaker

[0130] Aseptically transfer the -80°C stored strain into 5 mL TSB and culture at 28°C at 200 rpm for about 6 h. Transfer the inoculum to 5 mL TSB at 1% inoculum and culture at 200 rpm for 16 h. Measure the OD 600 As the stock solution, the bacterial count was calculated on TSA plates, and the bacterial concentration (OD 600 The concentration of the diluted solution was about 0.5 and then diluted 5000 times) as the bacterial solution for the challenge (based on the results of the pre-challenge test) and kept at 4°C for later use.

[0131] Large yellow croaker (size 30-50g / tail) were divided into three groups (0402-△pyo challenge group, H17050402 challenge group and PBS control group), with 30 tails in each group, and temporarily cultured in aquaculture drums (160L) containing 120L aerated seawater for the determination of strain virulence test (seawater temperature in the culture drums was 16-21℃).

[0132] Intraperitoneal injection of large yellow croaker, 4×10 3 cfu / tail, and the control group was injected with 0.2 mL PBS per tail. The tails were observed for 7 days, and the number of deaths in each group was recorded and the survival rate was calculated to determine the virulence of the strain.

[0133] like Figure 13 As shown in the figure, under conditions of equal bacterial injection, large yellow croaker began to die in both the H17050402 and 0402-Δpyo challenge groups starting on day 4 after challenge. The 0402-Δpyo group showed a slightly slower mortality rate. By day 6 after challenge, all the wild-type H17050402 group had died, while the 0402-Δpyo group still had a 30% survival rate, which remained until day 7 after challenge. The deletion of the Pyo gene reduced the pathogenicity of Pseudomonas aeruginosa to large yellow croaker.

[0134] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A Pyo gene that affects the virulence of Pseudomonas aeruginosa, characterized in that: The nucleotide sequence of the Pyo gene is shown in SEQ ID No.

7.

2. A method for constructing a Pseudomonas aeruginosa Pyo gene knockout cassette, characterized in that: The following steps are involved: (1) Using the genomic DNA of Pseudomonas aeruginosa as a template, two pairs of primers were used to perform fusion PCR amplification to obtain a fusion fragment; the nucleotide sequences of the two pairs of primers are shown in SEQ ID No. 1 to SEQ ID No. 4, respectively; (2) Connecting the fusion fragment described in step (1) to a cloning vector, extracting the plasmid after transforming the bacteria, and performing double enzyme digestion on the plasmid to obtain the Pseudomonas aeruginosa Pyo gene knockout cassette; the enzymes used for the double enzyme digestion include EcoRI and HindIII.

3. The Pseudomonas aeruginosa Pyo gene knockout cassette constructed using the construction method of claim 1.

4. A gene knockout vector comprising the Pseudomonas aeruginosa Pyo gene knockout cassette according to claim 3, characterized in that: The gene knockout vector is based on a suicide vector.

5. The gene knockout vector according to claim 4, characterized in that The suicide vector includes pEX18Gm.

6. The method for constructing the gene knockout vector according to claim 4 or 5, characterized in that: The method comprises the following steps: connecting the Pseudomonas aeruginosa Pyo gene knockout cassette according to claim 3 between EcoR I and HindIII of a suicide vector to obtain the gene knockout vector.

7. Use of the Pseudomonas aeruginosa Pyo gene knockout cassette according to claim 3 or the gene knockout vector according to claim 4 or 5 in constructing a Pseudomonas aeruginosa Pyo gene knockout strain.

8. A method for constructing a Pseudomonas aeruginosa Pyo gene knockout strain, characterized in that: The following steps are involved: (1) transforming the gene knockout vector according to claim 4 or 5 into competent Escherichia coli to construct Escherichia coli carrying the knockout vector; (2) Using the Escherichia coli carrying the knockout vector described in step (1) as the donor bacterium and the wild strain of Pseudomonas aeruginosa as the recipient bacterium, the homologous exchange method is used to obtain the Pseudomonas aeruginosa Pyo gene knockout strain through cultivation and screening.

9. The Pseudomonas aeruginosa Pyo gene knockout strain Pp0402-ΔPYO constructed by the construction method of claim 8, characterized in that: The Pp0402-ΔPYO has been biologically deposited with the deposit number CCTCC M 20251005.

10. Use of the Pseudomonas aeruginosa Pyo gene knockout strain according to claim 9 in preparing a vaccine strain or vaccine.

Images