Gene marker for diagnosis of latent tuberculosis infection and application thereof

Abstract

The application discloses a gene marker for diagnosing latent tuberculosis infection and application thereof, and belongs to the technical field of biological medicine. The application screens a latent tuberculosis infection early diagnosis marker based on peripheral blood whole genome DNA methylation map, provides a new target for diagnosing latent tuberculosis infection, evaluates the diagnosis efficiency of the marker through pyrosequencing, develops a corresponding detection kit and a use method, and realizes rapid and accurate diagnosis of latent tuberculosis infection.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a gene marker for diagnosing latent tuberculosis infection and application thereof. BACKGROUND

[0002] Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (MTB), which seriously threatens human health. The number of deaths caused by infection with Mycobacterium tuberculosis ranks among the top in single infectious diseases. After infection with MTB, the body can have different development and outcomes, such as latent tuberculosis infection (LTBI) without disease, active tuberculosis after infection (divided into pathogen-positive and pathogen-negative tuberculosis according to the results of pathogen detection), etc. Accurate diagnosis of latent tuberculosis infection (LTBI) is an important challenge in global tuberculosis prevention and control. Although the existing mainstream diagnostic methods such as interferon-gamma release assay (IGRA) and tuberculin skin test (TST) can detect Mycobacterium tuberculosis infection, they cannot effectively diagnose latent tuberculosis infection, and the sensitivity and specificity are limited (for example, the sensitivity of IGRA is 87.9%, and the specificity is 79.8%). In addition, these immunological methods cannot predict the risk of progression of latent infection to active tuberculosis, resulting in a lack of precision in clinical intervention strategies. Therefore, it is urgent to explore new biomarkers to improve the diagnostic efficiency.

[0003] In recent years, epigenetics has developed rapidly, and the role of DNA methylation in infectious diseases has attracted much attention. As a key mechanism of epigenetic regulation, DNA methylation has shown potential in the diagnosis of tuberculosis. Studies have shown that the methylation status of specific CpG sites in certain genes is closely related to different stages of tuberculosis. For example, high methylation of the SIRT1 gene promoter region has been confirmed to be a marker for differentiating active tuberculosis; the methylation sites of the TSPAN4 gene were used to construct a classifier through machine learning, which achieved high diagnostic accuracy (AUC=0.83) in blood samples. In addition, methylation feature analysis based on oral swabs showed that a classifier composed of 7 specific CpG sites had an AUC of 0.94 in the validation set, indicating the application prospect of non-invasive samples. However, existing studies have focused on the differentiation between active tuberculosis and healthy people, or rely on the joint detection of multiple markers, and the value of a single methylation site in the specific diagnosis of LTBI has not been fully explored and the corresponding diagnostic method has not been developed and designed.

[0004] The main function of the RUFY1 gene, full name RUN and FYVE domain containing 1, also known as RABIP4, ZFYVE12, is concentrated in the endocytosis and membrane transport process of cells. The encoded protein contains a RUN domain and a FYVE type zinc finger domain. The protein can bind to phosphatidylinositol-3-phosphate (PI3P) on the early endosome membrane, and plays a key role in the early endosome transport, tethering and fusion process. In addition, RUFY1 is also involved in regulating the activity of RAB family small GTPases. RAB proteins play an important role in membrane transport in cells, and RUFY1 helps to regulate the activity state of these proteins by interacting with them, thereby affecting the material transport path in cells.

[0005] The present application finds that the methylation level of RUFY1 is increased in patients with latent tuberculosis infection by comparing the methylation level of peripheral blood genomic DNA of latent tuberculosis infection and healthy control population. The present application predicts that RUFY1 can be used as a genetic marker for diagnosing or assisting in diagnosing latent tuberculosis infection.

[0006] In view of this, the present application provides the following technical solutions. SUMMARY

[0007] In order to solve the problems of poor specificity, low sensitivity and long detection time in the existing diagnosis of latent tuberculosis infection, the present application provides a technical concept of using peripheral blood whole genome DNA methylation map as an early diagnostic marker for latent tuberculosis infection, which provides a new target and method for the diagnosis of latent tuberculosis infection. The present application first screens differential methylation sites that can be used for diagnosing latent tuberculosis infection, evaluates the diagnostic efficiency, and develops corresponding detection kits and use methods to realize accurate and rapid diagnosis of latent tuberculosis infection.

[0008] The present application includes the following technical solutions:

[0009] In the first aspect of the present application, the present application provides an application of a gene marker methylation level or a reagent for detecting the methylation level of the gene marker in the preparation of a product for diagnosing and / or assisting in diagnosing latent tuberculosis infection, wherein the gene marker is RUFY1.

[0010] The product includes but is not limited to any one of reagents, test papers, membrane strips, chips, kits or detection platforms.

[0011] The method for detecting the methylation level of the gene is known in the art, including but not limited to bisulfite sequencing, PCR, methylation-specific PCR, pyrosequencing, Sanger sequencing, high-throughput sequencing, third-generation sequencing, single-molecule sequencing, gene chip, chromatography, mass spectrometry or electrophoresis.

[0012] In this invention, the reagents for detecting the methylation level of gene markers include any reagents required for detecting the methylation level of the RUFY1 gene by any one or a combination of two or more of the following: bisulfite sequencing, PCR, methylation-specific PCR, pyrosequencing, Sanger sequencing, high-throughput sequencing, third-generation sequencing, or single-molecule sequencing.

[0013] In some embodiments of the present invention, the reagents for detecting the methylation level of gene markers are selected from those required for detecting the methylation level of the RUFY1 gene using gene methylation chip technology.

[0014] In some embodiments of the present invention, the reagents for detecting the methylation level of gene markers are selected from those required for detecting the methylation level of the RUFY1 gene using pyrosequencing technology.

[0015] In some embodiments of the present invention, the reagents for detecting the methylation level of gene markers are selected from reagents required for detecting the methylation level of the RUFY1 gene by methylation-specific PCR (MSP), preferably quantitative methylation-specific PCR (qMSP) technology.

[0016] In a specific embodiment of the present invention, the reagent used to detect the methylation level of the RUFY1 gene is the reagent required for detecting the methylation level of the RUFY1 gene by quantitative methylation-specific PCR (qMSP) technology.

[0017] The reagents include the primers shown in SEQ ID NO.5-6 and the probe shown in SEQ ID NO.7.

[0018] .

[0019] Furthermore, the reagents used to detect the methylation level of the RUFY1 gene also include conventional reagents based on quantitative methylation-specific PCR detection, including but not limited to transformants, DNA polymerases, dNTPs, and Mg. 2+ and buffer solution.

[0020] In a second aspect, the present invention provides a primer-probe combo for detecting the methylation level of the RUFY1 gene based on quantitative methylation-specific PCR (qMSP) technology, comprising primers shown in SEQ ID NO. 5-6 and probes shown in SEQ ID NO. 7.

[0021] Furthermore, the probe is labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.

[0022] The present application does not make specific limitation to the fluorescent reporter group and the fluorescent quenching group, and the person skilled in the art can select according to the specific needs. In some embodiments of the present application, the fluorescent reporter group is selected from at least one of FAM, VIC or CY5, and the fluorescent quenching group is selected from at least one of MGB, BHQ or TAMRA.

[0023] In a third aspect of the present application, the present application provides a kit for detecting the methylation level of the RUFY1 gene based on quantitative methylation-specific PCR (qMSP) technology, which comprises the primer probe combination of the second aspect of the present application.

[0024] Further, the kit further comprises a primer probe combination for detecting the methylation level of a reference gene (SEQ ID NO. 13). The nucleotide sequence of the reference gene is as follows:

[0025] GGAGGAGGATGCGTATTTCGTTTAGAAGGTTTTTTTAGTTTTTTTTTTTGTCGGATAGTGTTAGTCGGGTGTTTGTAGGGAAGTATTTTTTTTTTAGTTTTAGGTTTAAATTTTTGTTGTCGATTTTTTGTTCGTTATTAGTGGATAATTTTAGGTTTTACGTATATTTTGTTTTTTGGTAAGGAAAATCGTTGGAGTTAAATGAATTTAGAGAGTTTTA.

[0026] In a specific embodiment of the present application, in order to ensure 100% amplification efficiency, a probe primer is designed for the sequence near the target site which does not participate in methylation change (reference gene), which is used as a reference primer probe combination, which is composed of the primer shown as SEQ ID NO. 8-9 and the probe shown as SEQ ID NO. 10. Finally, the relative quantification of the methylation level of the target site of the sample is obtained by subtraction reaction.

[0027] .

[0028] Further, the kit further comprises common reagents based on quantitative methylation-specific PCR detection, including but not limited to transforming agent, DNA polymerase, dNTPs, Mg 2+ and buffer.

[0029] In the present application, the conversion agent is used to convert all non-methylated cytosine bases to uracil, leaving the methylated cytosine bases unchanged. The conversion agent is not particularly limited in the present application, including but not limited to one or a combination of two or more of hydrazine salt, bisulfite and bisulfite (such as sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.).

[0030] In the detailed embodiment of the present application, the kit further comprises a positive control and a negative control. Specifically, the positive control is a fully methylated plasmid as shown in SEQ ID NO. 11, and the negative control is a fully unmethylated plasmid as shown in SEQ ID NO. 12.

[0031] In the fourth aspect of the present application, the present application provides a use of the primer probe combination of the second aspect of the present application and the kit of the third aspect of the present application in the preparation of a product for diagnosing and / or assisting in the diagnosis of latent tuberculosis infection, wherein the product is used for detecting the methylation level of the RUFY1 gene, and the detection comprises the following steps:

[0032] 1) sample collection;

[0033] 2) DNA extraction;

[0034] 3) DNA sulfuration treatment;

[0035] 4) detection based on quantitative methylation-specific PCR (qMSP) technology, and the methylation level of the RUFY1 gene in the sample DNA is determined according to the Ct value.

[0036] Preferably, step 4) further comprises simultaneous real-time quantitative methylation-specific PCR (qMSP) detection of a reference gene, obtaining a ΔCT value, ΔCT = CT 样本 -CT 参照 , and the higher the ΔCT value, the lower the methylation level, and the diagnostic threshold is ΔCT = 6.31-6.43, and the latent tuberculosis infection is determined according to the diagnostic threshold.

[0037] In the detailed embodiment of the present application, step 4) uses the primer probe combination of the second aspect of the present application to detect the methylation level of the RUFY1 gene, and in the absence of special limitations, those skilled in the art can configure a methylation-specific PCR reaction system according to specific needs.

[0038] In the present application, the sample is selected from any one of serum, plasma, tissue, cultured cells, blood, feces, saliva, urine.

[0039] In the detailed embodiment of the present application, the detection sample is peripheral blood, which has the advantages of convenient sampling and non-invasive detection.

[0040]

[0040] Unless otherwise specified, the sample collection, sample DNA extraction and DNA sulfuration treatment described in the present application are all conventional technical means in the art, and those skilled in the art can use commercially available kits to complete sample DNA extraction and DNA sulfuration treatment.

[0041] The technical solution provided by the present application has the following advantages:

[0042] 1. Screening of LTBI diagnostic markers based on DNA methylation level: The whole blood genomic DNA methylation of latent tuberculosis infection patients and healthy controls is detected by 935K methylation chip, and differential methylation sites are screened as candidate targets. This whole genome screening method is more comprehensive and systematic, and provides more possibilities for discovering new non-invasive markers.

[0043] 2. Multi-technology joint verification: First, use the gold standard pyrosequencing for methylation detection to verify the methylation level difference and diagnostic efficiency of the candidate site in a large sample, then design Taqman probe primers for the site, and detect the methylation level of the sample by qMSP method, and the multi-technology joint improves the accuracy and reliability of the molecular target verification.

[0044] 3. New diagnostic markers are proposed: It is found that high methylation level of blood biomarker cg14820908 (RUFY1) can indicate LTBI, providing a new target for tuberculosis latent infection diagnosis.

[0045] 4. Development of related kits and use methods: The cg14820908 (RUFY1) methylation level detection kit and its use method are provided, including complete processes such as sample collection, DNA extraction, sulfuration, methylation level detection, etc., which have strong practicality and operability. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 DMR (RUFY1) of latent tuberculosis infection patients (LTBI) and healthy control group (HC);

[0047] Figure 2 Pyrosequencing verification of DNA methylation molecular target; A. Box plot showing the beta value distribution of cg14820908 (RUFY1) methylation marker from whole blood DNA of healthy controls (n=40) and LTBI (n=40) verified by pyrosequencing, P value is calculated by t-test, P****≤0.001; B. ROC curve of methylation marker cg14820908 (RUFY1) in all healthy controls and LTBI in pyrosequencing;

[0048] Figure 3qMSP validation of DNA methylation molecular targets; A. The methylation level of cg14820908 (RUFY1) in whole blood DNA was determined by qMSP in the validation set (80 healthy controls and 80 LTBI), Y axis represents the methylation level (ΔCT = CT 样本 -CT 参照 ), the higher the ΔCT, the lower the methylation level, P value was calculated by t-test, P****≤0.001; B. ROC curve of methylation marker cg14820908 (RUFY1) in qMSP set of all healthy controls and LTBI. DETAILED DESCRIPTION

[0049] The technical solutions in the embodiments of the present application will be described below in a clear and complete manner. Obviously, the described embodiments are only some of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0050] The present application relates to the research approved by the Ethics Committee of Beijing Center for Disease Control (2023 No. 15) Research details have been explained to patients or their guardians, and written informed consent has been obtained.

[0051] Example 1 Methylation chip reports the increased methylation level of RUFY1 in LTBI

[0052] Objective: To screen differential methylation sites as candidate markers by detecting 935K methylation chip of whole genome DNA in peripheral blood of 5 LTBI patients and 5 healthy controls (HC).

[0053] 1, sample collection

[0054] Collect 500 μL of peripheral blood sample from the research object, which can be directly operated or stored at -80℃.

[0055] 2, DNA extraction

[0056] Refer to the instruction manual of the Genomic DNA Extraction Kit (DP348) for operation, which includes the following steps:

[0057] (2.1) Take the sample from -80℃ to 38℃ water bath to melt, isolate, and move to a 15 mL centrifuge tube. Add 1-2.5 mL CL and mix well by inverting; centrifuge at 10,000 rpm (~11,500xg) for 1 min, and carefully aspirate the supernatant;

[0058] (2.2) Add 200 μL Buffer GB, 20 μL Proteinase K premix solution, mix well, and place at 56°C for 10 min, mix well several times during the process until the solution is clear;

[0059] (2.3) After 2-5 min at room temperature, add 350 μL Buffer BD, mix well, and transfer to the adsorption column CG2 (the adsorption column CG2 is placed in a collection tube), centrifuge at 12,000 rpm (~ 13,400 xg) for 30 sec, discard the liquid in the collection tube, and transfer the adsorption column CG2 to the collection tube;

[0060] (2.4) Add 600 μL rinse solution PWB (add anhydrous ethanol before use) to the adsorption column CG2, centrifuge at 12,000 rpm (~ 13,400 xg) for 30 sec, and discard the waste liquid;

[0061] (2.5) Centrifuge at 12,000 rpm (~ 13,400 xg) for 2 min, discard the waste liquid, move the column to a 1.5 mL ep tube, and place at room temperature for 2 min to dry the rinse solution in the adsorption column;

[0062] (2.6) Add 100 μL elution buffer TB to the middle of the adsorption membrane (avoid touching the adsorption membrane with the gun head), place at room temperature for 2 min, and centrifuge at 12,000 rpm (~ 13,400 xg) for 2 min;

[0063] (2.7) Second incubation: aspirate the eluent in the centrifuge tube into the adsorption column, place at room temperature for 2 min, centrifuge at 12,000 rpm (~ 13,400 xg) for 2 min, and obtain the final DNA, which is placed in an ice box;

[0064] (2.8) Use a UV spectrophotometer to detect the concentration and purity of the extracted DNA, and ensure that the quality of the DNA meets the requirements of subsequent detection; the DNA can be directly subjected to subsequent operations, or stored at -80°C for later use.

[0065] 3, DNA sulfuration

[0066] Refer to the instructions of ZYMO DNA sulfuration kit (EZ DNA Methylation-Gold TM Kit Cat.No.: D500) for operation, which specifically includes the following steps:

[0067] (3.1) CT conversion reagent preparation: 900 μL pure water, 300 μL M-Dilution buffer, and 50 μL Dissolving Buffer are added to the CT Conversion Reagent tube, and vortexed for 10 min;

[0068] (3.2) Take 130 μL CT conversion reagent into PCR tube, add 500 ng DNA, if the total volume is less than 150 μL, add water to make up. Shake the tube or mix the sample upside down, and centrifuge immediately. (If the DNA is more than 20 μL, adjust the proportion of water in the CT conversion reagent, for every 10 μL of DNA added, reduce the amount of water by 100 μL, and the maximum amount of DNA is 50 μL);

[0069] (3.3) Sulfuration procedure: 98℃ 10 min; 64℃ 2.5H; 4℃ for 20 H at the longest;

[0070] (3.4) Add 600 μL M-Binding Buffer to Zymo-Spin™ IC Column, place the filter column in a collection tube, move the mixture obtained in (2) to the Zymo-Spin™ IC Column, mix well by inverting, centrifuge at full speed (>10,000xg) for 30 s, and discard the filtrate;

[0071] (3.5) Add 100 μL M-Wash Buffer to the column, and centrifuge at full speed for 30 s;

[0072] (3.6) Add 200 μL M-Desulphonation Buffer to the column, and incubate at room temperature for 15-20 min, and centrifuge at full speed for 30 s;

[0073] (3.7) Add 100 μL M-Wash Buffer to the column, and centrifuge at full speed for 30 s; repeat once;

[0074] (3.8) Take the column out and prevent it from being contaminated in a sterile 1.5 mL ep tube, add 10 μL M-Elution Buffer to the filter membrane of the column, centrifuge at full speed for 30 s, elute the DNA, and store it at -20℃ for short-term storage and at -80℃ for long-term storage.

[0075] 4, Methylation chip detection

[0076] (4.1) Denaturation and amplification: add 0.1 mol / L NaOH to the sample to denature the DNA into single-stranded DNA, and add whole genome amplification reagent, and incubate at 37℃ overnight;

[0077] (4.2) Fragment the DNA: enzymatically treat the amplified product to obtain fragmented DNA, add isopropanol, centrifuge at 4℃ to precipitate, and after drying the precipitated DNA in the air, add hybridization buffer to redissolve the DNA precipitate;

[0078] (4.3) DNA hybridization: resuspended DNA samples after processing, distributed on the Illumina hybridization furnace chip to complete the hybridization reaction, in the hybridization process, the fragmented DNA after denaturation, with the specific site of 50 bases (connected to the microbeads on the chip) annealing;

[0079] (4.4) washing, extending, staining, scanning: wash away non-specific hybridization and unhybridized DNA, captured DNA as a template, single base extension reaction on the chip, add a detectable fluorescent group on the chip, so as to report the methylation of the sample; The corresponding manifest file is downloaded in advance, the chip is placed in the scanner, the fluorescent group of the single base extension product on the chip is excited by laser, the scanner acquires the fluorescence emitted by the fluorescent group, and generates raw data.

[0080] 5, data bioinformatics analysis

[0081] The obtained chip raw data and sample grouping table are imported into R, and ChAMP (version 2.29.1) software package is used in R for preprocessing to obtain raw data, BMIQ method is used to standardize the raw data, and subsequent methylation analysis is carried out. A plurality of differential methylation regions (Differential Methylation Region) of LTBI and HC are screened, wherein the DMR (RUFY1) difference is clear as shown in Figure 1 The methylation level of the target site of the LTBI group is significantly higher than that of the HC group.

[0082] The results show that the blood biomarker cg14820908 (RUFY1) of the LTBI patient has a high methylation level.

[0083] The sequence of the cg14820908 (RUFY1) gene is shown in SEQ ID NO. 1:

[0084] TACCTACAGGAAGCCCTGCCCCAAGCTCTTAGAGGGCGTGCTGTGAAAGCGTCCCGCCCCCAAACATTCCTATTGGGCGAGTCCAGCTCAAGGCCTCTCCTACGGAGCTGGTGGGCGCCATTTTGCACCCTCTGTCCCGGACGGAGGAGGATGCGCACCCCGCCCAGAAGGCTTTTCCAGCCTTCTCTCTTGCCGGATAGTGCCAGCCGGGTGCCTGCAGGGAAGCATCTTCCCCTCAGCTCCAGGCTCAAATTCTTGTTGCCGATCTTTCGTCCGCTACTAGTGGACAATTTTAGGTTTTACGCACACTTTGTTTTTTGGTAAGGAAAACCGTTGGAGTCAAATGAATTCAGAGAGTTCCATTTCAACTCCCATTATCTTGTCGCATTGCCTTGAGGGTGTAATAAAGACTGTCTGCAATTATCATCAGATATCTATACGTGCTGGCCAAATGTTCTCTGAAACCCAGTAAGCTGGTAT.

[0085] Example 2 Pyrosequencing to detect the methylation level of RUFY1

[0086] Objective: To detect the methylation level of candidate site cg14820908 (RUFY1) in 40 cases of LTBI group and 40 cases of healthy control group by pyrosequencing, and evaluate its diagnostic efficiency.

[0087] 1, DNA extraction

[0088] DNA extraction was performed using genomic DNA extraction kit (QIAGEN).

[0089] 2, methylation treatment

[0090] Methylation treatment was performed using Qiagen EpiTect Bisulfite Kit (Qiagen 59104).

[0091] 3, PCR amplification

[0092] Pyrosequencing primers were designed using software Pyro Mark Assay Design 2.0, and the primer sequences were as follows:

[0093] .

[0094] PCR amplification system (50 μL)

[0095] .

[0096] PCR amplification procedure as follows:

[0097] .

[0098] 4, Pyrosequencing on machine detection Q48.

[0099] 5, data processing.

[0100] Results as shown in Figure 2 , the LTBI group cg14820908 (RUFY1) methylation level is higher than that of healthy control group, the difference was statistically significant (P<0.05), the area under the ROC curve was 0.795 (95% CI=0.70-0.89). Pyrosequencing the site methylation level ≥25.42, the maximum Youden index, sensitivity 0.700, specificity 0.750.

[0101] Example 3 qMSP (methylation-specific quantitative PCR) detection of RUFY1 methylation level

[0102] Objective: To develop a reagent for detecting the methylation level of cg14820908 (RUFY1), including Taqman primer probe for qMSP amplification and detection of the gene, for detecting the methylation level of cg14820908 (RUFY1) in samples. qMSP detection of DNA methylation level (ΔCT= CT 样本 -CT 参照 ), the higher the ΔCT indicates the lower the methylation level.

[0103] 1, Taqman primer design

[0104] According to the DNA sequence of the candidate gene methylation site, qMSP primer was designed and synthesized, and the Taqman primer sequence was as follows:

[0105] .

[0106] 2, positive and negative control design

[0107] Fully methylated plasmid sequence (M, SEQ ID NO. 11):

[0108] GGAGGAGGATGCGTATTTCGTTTAGAAGGTTTTTTTAGTTTTTTTTTTTGTCGGATAGTGTTAGTCGGGTGTTTGTAGGGAAGTATTTTTTTTTTAGTTTTAGGTTTAAATTTTTGTTGTCGATTTTTCGTTCGTTATTAGTGGATAATTTTAGGTTTTACGTATATTTTGTTTTTTGGTAAGGAAAATCGTTGGAGTTAAATGAATTTAGAGAGTTTTA.

[0109] Fully unmethylated plasmid sequence (U, SEQ ID NO. 12):

[0110] GGAGGAGGATGTGTATTTTGTTTAGAAGGTTTTTTTAGTTTTTTTTTTTGTTGGATAGTGTTAGTTGGGTGTTTGTAGGGAAGTATTTTTTTTTTAGTTTTAGGTTTAAATTTTTGTTGTTGATTTTTTGTTTGTTATTAGTGGATAATTTTAGGTTTTATGTATATTTTGTTTTTTGGTAAGGAAAATTGTTGGAGTTAAATGAATTTAGAGAGTTTTA.

[0111] 3. qMSP reaction system (18 μL)

[0112] ;

[0113] Each qMSP reaction included a positive control (fully methylated plasmid) and a negative control (fully unmethylated plasmid).

[0114] 4. qMSP amplification procedure

[0115] .

[0116] 5. Result interpretation

[0117] Negative control Ct > 35 or not detected was qualified, the lower the value of ΔCt (Cttarget-Ct reference) represented the higher degree of methylation of the site.

[0118] .

[0119] 6. Quality control

[0120] After plasmid was quantitatively diluted to 0.1 ng / μL, it was diluted by 10 times gradient, and Taqman probe primer was used for amplification, and the amplification specificity and accuracy of Taqman probe primer were evaluated according to Ct value and amplification melting curve.

[0121] Results are shown in Figure 3 The quantitative methylation-specific PCR detection was performed in the validation cohort (n (LTBI) = 80, n (healthy control) = 80), and the results showed that the methylation level of cg14820908 (RUFY1) in the LTBI group was higher than that in the healthy control group, and the difference was statistically significant (P < 0.05), and the area under the ROC curve was 0.850 (95% CI = 0.79-0.91). When ΔCT = 6.31, the maximum Youden index was obtained by qMSP detection of the site, the sensitivity was 0.838, and the specificity was 0.850; when ΔCT = 6.43, the maximum Youden index was also obtained, and the sensitivity was 0.875 and the specificity was 0.813 at this cutoff value.

[0122] According to a large amount of clinical sample data, the diagnostic threshold is determined as ΔCT = 6.31-6.43, and the latent tuberculosis infection is judged: if the ΔCT value is lower than the interval, it is latent tuberculosis infection (LTBI), and if it is higher than the interval, it is healthy.

[0123] The above embodiments are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. The use of a reagent for detecting the methylation level of a gene marker in the preparation of a kit for the diagnosis and / or auxiliary diagnosis of latent tuberculosis infection, wherein the gene marker is RUFY1; The reagent used to detect the methylation level of the RUFY1 gene is the reagent required for detecting the methylation level of the RUFY1 gene by quantitative methylation-specific PCR technology, and is selected from the combination of the primers shown in SEQ ID NO.5-6 and the probe shown in SEQ ID NO.

7.

2. A primer-probe combination, wherein the primer-probe combination is used to detect the methylation level of the RUFY1 gene based on quantitative methylation-specific PCR technology, and consists of primers shown in SEQ ID NO.5-6 and probes shown in SEQ ID NO.

7.

3. A kit for detecting the methylation level of the RUFY1 gene based on quantitative methylation-specific PCR technology, the kit comprising the primer-probe combination as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes a primer-probe combination for detecting the methylation level of a reference gene, the primer-probe combination consisting of the primers shown in SEQ ID NO. 8-9 and the probe shown in SEQ ID NO.

10.

5. The reagent kit according to claim 4, characterized in that, The kit also includes commonly used reagents for quantitative methylation-specific PCR detection, including transformant, DNA polymerase, dNTPs, and Mg. 2+ and buffer solution.

6. The reagent kit according to claim 5, characterized in that, The kit also includes a positive control and a negative control. The positive control is the fully methylated plasmid shown in SEQ ID NO.11, and the negative control is the fully unmethylated plasmid shown in SEQ ID NO.

12.

7. The use of the kit according to any one of claims 3-6 in the preparation of diagnostic reagents for the diagnosis and / or auxiliary diagnosis of latent tuberculosis infection.

8. The application according to claim 7, characterized in that, The diagnostic reagent is used to detect the methylation level of the RUFY1 gene, and the detection includes the following steps: 1) Sample collection; 2) Extract DNA; 3) DNA sulfurization treatment; 4) Detection was performed using quantitative methylation-specific PCR technology, and the methylation level of the RUFY1 gene in the sample DNA was determined based on the Ct value; Step 4) also includes performing simultaneous real-time quantitative methylation-specific PCR detection on the reference gene to obtain the ΔCT value, where ΔCT = CT. 样本 -CT 参照 .

Images