Construction of engineering strain capable of synthesizing xylitol by utilizing multiple raw materials

Abstract

The invention discloses a construction method of an Escherichia coli engineering strain for efficiently synthesizing xylitol by using various carbon sources such as glucose, cane sugar and the like. The engineering strain realizes the target function through the following genetic modification: knocking out endogenous genes such as pyruvate oxidase poxB and the like, overexpressing key enzyme genes such as phosphoenolpyruvate synthetase ppsA and the like, and introducing heterologous genes such as exogenous xylitol-5-phosphate dehydrogenase and the like. The modified strain shows excellent xylitol synthesis capability, and has important application prospects in the fields of biological manufacturing, food raw material production and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of synthetic biology and food raw material production, and in particular to a recombinant Escherichia coli strain for synthesizing xylitol and a preparation method thereof. Background Art

[0002] Xylitol, a valuable sugar alcohol compound, has demonstrated significant application advantages in a variety of fields, including food, medicine, and chemicals. In the food industry, it not only serves as an ideal sweetener to satisfy consumers' craving for sweetness, but its low-calorie profile also makes it a preferred ingredient in healthy food formulations, particularly for those managing their weight and those advocating for a healthy diet. Furthermore, its unique anti-caries properties make it a key ingredient in oral care products such as chewing gum. In the pharmaceutical industry, xylitol serves as an excipient in pharmaceutical preparations and is used in the development of specialized foods for diabetic patients. In the chemical industry, the compound is a key precursor for the synthesis of a variety of high-value-added organic products.

[0003] Traditional industrial production of xylitol primarily relies on chemical synthesis, but this method has significant limitations. The production process requires maintaining extreme reaction conditions, including high temperature, high pressure, and strong acid / alkaline environments. This not only places stringent weather resistance requirements on production equipment, but also significantly increases overall production costs. Furthermore, the chemical synthesis process produces a large number of by-products. These impurities not only reduce the purity and quality of the final product, increase the complexity of the refining process, but also cause serious environmental pollutant emissions, leaving companies facing increasing pressure to comply with environmental regulations and management costs.

[0004] In recent years, with the rapid development of biocatalytic technology, enzymatic synthesis of xylitol has become a highly promising alternative. However, existing technology routes primarily use D-xylose as a raw material, and the complex and high cost of D-xylose production further restrict the production and application of xylitol. To overcome the current process bottleneck, the use of metabolic engineering and synthetic biology to construct engineered strains that can synthesize xylitol in a single step using fermentation from inexpensive raw materials such as glucose and sucrose is of great significance. Summary of the Invention

[0005] The purpose of the present invention is to provide an engineered strain capable of synthesizing xylitol using glucose, sucrose and the like as raw materials, and its application in the production of xylitol.

[0006] In order to solve the above technical problems, in a first aspect, the present invention provides a recombinant Escherichia coli, which is a recombinant bacterium obtained by carrying out the following transformations (1) to (20) in Escherichia coli;

[0007] (1) Knockout of the gene encoding pyruvate oxidase (poxB);

[0008] (2) Knockout of the gene encoding D-lactose dehydrogenase (ldhA);

[0009] (3) knockout of the gene encoding pyruvate formate lyase (pflB);

[0010] (4) Introduction of the glycerol 3-phosphate dehydrogenase gene (ScGPD1);

[0011] (5) Introduction of the glycerol phosphatase gene (ScGPP1);

[0012] (6) Knockout of the gene encoding glycerol kinase (glpK);

[0013] (7) Introduction of the glycerol dehydrogenase gene (GogdH);

[0014] (8) Introduction of the glyceraldehyde dehydrogenase gene (PogadH);

[0015] (9) Introduction of the hydroxypyruvate dehydrogenase gene (PshpdH);

[0016] (10) Knockout of the gene encoding hydroxypyruvate isomerase (hyi);

[0017] (11) Knockout of the gene encoding glyoxylate / hydroxypyruvate reductase A (ghrA);

[0018] (12) Knockout of the gene encoding glyoxylate / hydroxypyruvate reductase B (ghrB);

[0019] (13) Enhance the expression of phosphoenolpyruvate synthase gene (ppsA);

[0020] (14) Introduction of transketolase gene (ScTK);

[0021] (15) Enhance the expression of 1-deoxyxylulose 5-phosphate synthase gene (dxs);

[0022] (16) Introduction of xylitol 5-phosphate dehydrogenase gene (LzxpdH);

[0023] (17) Introduction of the xylitol 5-phosphate phosphatase gene (BsaraL);

[0024] (18) Introduction of sucrose permease gene (cscB);

[0025] (19) Introduction of sucrose hydrolase gene (cscA);

[0026] (20) Knockout of the gene encoding myristoyltransferase (lpxM).

[0027] The modifications of (13) and (15) mentioned above can be specifically as follows: the promoters of the phosphoenolpyruvate synthase gene (ppsA) and the 1-deoxyxylulose 5-phosphate synthase gene (dxs) are replaced with the P119 promoter.

[0028] The modifications of (1), (2), (16) and (17) above can be specifically as follows: the gene encoding pyruvate oxidase (poxB) and the gene encoding D-lactose dehydrogenase (ldhA) are knocked out respectively, and are replaced with the expression frames of the xylitol 5-phosphate dehydrogenase gene (LzxpdH) and the xylitol 5-phosphate phosphatase gene (BsaraL), so that the expression frames of the xylitol 5-phosphate dehydrogenase gene (LzxpdH) and the xylitol 5-phosphate phosphatase gene (BsaraL) are inserted into the chromosome in the form of two copies.

[0029] The modifications of (3), (18), and (19) mentioned above can be specifically as follows: the gene encoding pyruvate formate lyase (pflB) is knocked out and replaced with the expression frames of the sucrose permease gene (cscB) and the sucrose hydrolase gene (cscA).

[0030] The modifications of (4), (5), and (6) mentioned above can be specifically as follows: knocking out the gene encoding glycerol kinase (glpK) and replacing it with the expression frames of the glycerol 3-phosphate dehydrogenase gene (ScGPD1) and the glycerol phosphatase gene (ScGPP1).

[0031] The modifications of (7), (8), and (10) above can be specifically as follows: the gene encoding hydroxypyruvate isomerase (hyi) is knocked out and replaced with the expression frames of the glycerol dehydrogenase gene (GogdH) and the glyceraldehyde dehydrogenase gene (PogadH).

[0032] The modifications of (9) and (11) above can be specifically as follows: the gene encoding glyoxylate / hydroxypyruvate reductase A (ghrA) is knocked out and replaced with the expression frame of the hydroxypyruvate dehydrogenase gene (PshpdH).

[0033] The modifications of (12) and (14) above can be specifically as follows: the gene encoding glyoxylate / hydroxypyruvate reductase B (ghrB) is knocked out and replaced with the expression frame of the transketolase gene (ScTK).

[0034] Furthermore, the glycerol-3-phosphate dehydrogenase (ScGPD1) is derived from Saccharomyces cerevisiae.

[0035] Furthermore, the glycerol phosphatase (ScGPP1) is derived from Saccharomyces cerevisiae.

[0036] Furthermore, the glycerol dehydrogenase (GogdH) is derived from Gluconobacter oxydans.

[0037] Furthermore, the glyceraldehyde dehydrogenase (PogadH) is derived from Picrophilusoshimae.

[0038] Furthermore, the hydroxypyruvate dehydrogenase (PshpdH) is derived from Pseudomonas stutzeri.

[0039] Furthermore, the transketolase (ScTK) may be derived from Saccharomyces cerevisiae.

[0040] Furthermore, the xylitol 5-phosphate dehydrogenase gene (LzxpdH) may be derived from Lactobacillus zeae.

[0041] Furthermore, the xylitol 5-phosphate phosphatase gene (BsaraL) may be derived from Bacillus subtilis.

[0042] Furthermore, the sucrose permease gene (cscB) may be derived from Escherichia coli.

[0043] Furthermore, the sucrose hydrolase gene (cscA) may be derived from Escherichia coli.

[0044] In a second aspect, the present invention provides a method for constructing a recombinant Escherichia coli with improved xylitol production, comprising the following steps: performing the transformation according to the transformation (1) to (20) in claim 1.

[0045] In a third aspect, the present invention provides a method for producing or increasing the yield of xylitol, comprising the following steps: culturing the recombinant Escherichia coli described in the first and second aspects with glucose and / or sucrose as carbon sources, collecting the culture, and obtaining xylitol.

[0046] In a fourth aspect, the present invention provides the use of the recombinant Escherichia coli described in the first and second aspects in producing or increasing the yield of xylitol.

[0047] In a fifth aspect, the present invention provides a product for producing or increasing the yield of xylitol, wherein the active ingredient is the recombinant Escherichia coli described in the first and second aspects.

[0048] The above-mentioned product may be a bacterial agent containing the recombinant bacteria and / or a culture of the recombinant bacteria.

[0049] The term "culture" refers to any liquid or solid product (i.e., fermentation product) containing a microbial population after artificial inoculation and cultivation. This refers to a product obtained by growing and / or amplifying microorganisms. It can be a biologically pure culture of the microorganism or contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.

[0050] In a specific embodiment of the present invention, the components and final concentrations of the conversion glucose medium are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, glucose: 10% (g / 100 mL).

[0051] In a specific embodiment of the present invention, the components and final concentrations of the conversion sucrose medium are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, sucrose: 10% (g / 100 mL).

[0052] In a specific embodiment of the present invention, the starting Escherichia coli can be Escherichia coli MG1655, Escherichia coli BW25113, or Escherichia coli MC02.

[0053] In the present invention, the nucleotide sequence of the P119 promoter is SEQ ID No.3.

[0054] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate oxidase (poxB) is CAD6018048.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate oxidase (poxB) is Gene ID: 946132 (2025.6.25).

[0055] The NCBI Reference Sequence number of the D-lactose dehydrogenase gene ldhA is NC_000913.3 (1441854..1442843 (+)) (March 9, 2022), and the amino acid reference sequence number of the protein it encodes is NP_415898.1 (March 9, 2022). The NCBI Reference Sequence number of the pyruvate formate lyase (pflB) is NP_415423.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 945514 (June 25, 2025).

[0056] The NCBI Reference Sequence number (NCBI Reference Sequence) of the glycerol kinase (glpK) is NP_418361.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 948423 (2025.6.25).

[0057] The NCBI Reference Sequence number of the hydroxypyruvate isomerase (hyi) is NP_415041.1, and the NCBI Reference Sequence number of the gene encoding the hydroxypyruvate isomerase (hyi) is Gene ID: 946186 (2025.6.25).

[0058] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the glyoxylate / hydroxypyruvate reductase A (ghrA) is NP_415551.2, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946431 (2025.6.25).

[0059] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the glyoxylate / hydroxypyruvate reductase B (ghrB) is NP_418009.2, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 948074 (2025.6.25).

[0060] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the phosphoenolpyruvate synthase (ppsA) is NP_416217.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946209 (2025.6.25).

[0061] The replaced promoter sequence is NC_000913.3 (1787113-1787286(-)).

[0062] The glycerol-3-phosphate dehydrogenase (ScGPD1) is derived from Saccharomyces cerevisiae, and its NCBI Reference Sequence Number is NP_010262.1, and the NCBI Reference Sequence Number of its encoding gene is GeneID: 851539, 2025.7.6).

[0063] The glycerol phosphatase (ScGPP1) is derived from Saccharomyces cerevisiae, and its NCBI Reference Sequence Number is NP_012211.2, and the NCBI Reference Sequence Number of its encoding gene is GeneID: 854758, 2025.7.6).

[0064] The glycerol dehydrogenase (GogdH) is derived from Gluconobacter oxydans, and its NCBI Reference Sequence Number is WP_011253139.1, and the NCBI Reference Sequence Number of its encoding gene is LT900338.1 (1769255 to 1770250 (-), 2017.7.20).

[0065] The glyceraldehyde dehydrogenase (PogadH) is derived from Picrophilus oshimae, and its NCBI Reference Sequence Number is AAT42917.1, and the NCBI Reference Sequence Number of its encoding gene is GeneID: 2844486, 2024.10.22.

[0066] The hydroxypyruvate dehydrogenase (PshpdH) is derived from Pseudomonas stutzeri, and its NCBI Reference Sequence Number is ADL63037.1, and the NCBI Reference Sequence Number of its encoding gene is GU373722.1 (May 19, 2012).

[0067] The transketolase (ScTK) is derived from Saccharomyces cerevisiae, and its NCBI Reference Sequence Number is NP_015399.1, and the NCBI Reference Sequence Number of its encoding gene is GeneID: 856188, 2025.7.6.

[0068] The NCBI Reference Sequence Number of the 1-deoxyxylulose 5-phosphate synthase (dxs) is NP_414954.1, and the NCBI Reference Sequence Number of the gene encoding it is Gene ID: 945060 (2025.6.25). The replaced promoter sequence is NC_000913.3 (440178-440187(-)).

[0069] The xylitol 5-phosphate dehydrogenase (LzxpdH) is derived from Lactobacillus zeae, and its NCBI Reference Sequence Number is WP_070651242.1, and the NCBI Reference Sequence Number of its encoding gene is LS991421.1 (2754636 to 2755682 (-), 2020.8.3).

[0070] The xylitol 5-phosphate phosphatase (BsaraL) is derived from Bacillus subtilis, and its NCBI Reference Sequence Number is WP_413154961.1. The NCBI Reference Sequence Number of the encoding gene is CP010314.1 (2923680 to 2924498 (-), 2015.3.24).

[0071] The sucrose permease (cscB) is derived from Escherichia coli, and its NCBI Reference Sequence Number is CAA57217.1. The NCBI Reference Sequence Number of the encoding gene is X81461.2 (3171 to 4418 (-), 2015.3.24).

[0072] The sucrose hydrolase (cscA) is derived from Escherichia coli, and its NCBI Reference Sequence Number is CAA57219.1. The NCBI Reference Sequence Number of the encoding gene is X81461.2 (5619 to 7052(-), 2015.3.24).

[0073] The NCBI Reference Sequence number (NCBI Reference Sequence) of the myristoyltransferase (lpxM) is NP_416369.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding the myristoyltransferase (lpxM) is Gene ID: 945143 (2025.6.25).

[0074] The beneficial technical effects achieved by the present invention are as follows:

[0075] The present invention provides a recombinant Escherichia coli that can synthesize xylitol at a high level by using glucose and sucrose as raw materials, thereby providing a novel biotechnology route for synthesizing xylitol and can be used for mass production of xylitol. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0077] 图1 This is the HPLC peak diagram of xylitol (sample). DETAILED DESCRIPTION

[0078] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0079] The liquid LB medium (pH 7.0) in the following examples contained 1 g / 100 mL NaCl, 1 g / 100 mL tryptone, 0.5 g / 100 mL yeast extract, and the balance was water. Solid culture medium is obtained by adding agarose to liquid culture medium.

[0080] The starting E. coli in the following examples can specifically be one of E. coli MG1655, BW25113, or MC02. E. coli MG1655 (CGSC#: 6300), BW25113 (CGSC#: 76376), and plasmid pKD46 (CGSC#: 7739) are products of the Yale University Genetic Collection of E. coli (CGSC). E. coli MC02 is from the China General Microbiological Culture Collection (CGMCC) (No. 34378). The pKD46 plasmid contains the temperature-sensitive origin of replication, oriR101, which replicates normally at 30°C but is lost at temperatures above 37°C. E. coli carrying the pKD46 plasmid can be cultured at 30°C and induced with arabinose to efficiently express Gam, Exo, and Beta. Once exogenous dsDNA is electroporated into the cells, it undergoes homologous recombination with the genomic target sequence. The plasmid also carries an ampicillin resistance gene as a selection marker. The gene sequence of the pSCre plasmid is shown in SEQ ID NO.1, and the public can obtain it through gene synthesis: Escherichia coli carrying the pSCre plasmid can express the recombinase (Cre) gene when cultured at 30°C, causing the lox66 sequence and lox71 sequence on the chromosome to recombine, thereby eliminating the DNA sequence located between the lox66 sequence and lox71 sequence. In this patent, the kanamycin resistance gene located between the lox66 sequence and lox71 sequence in the sequence of SEQ ID NO.2 can be eliminated; Escherichia coli carrying the pSCre plasmid will automatically lose the pSCre plasmid when cultured at 42°C; and the streptomycin resistance gene is carried as a selection marker.

[0081] Table 1. List of sequence fragments

[0082] 序列号 片段名称P Height (5'-3') SEQ IDNO.1 pSCre aatgtgcctgtcaaatggacgaagcagggattctgcaaaccctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgttttttgggctaacaggaggaattaaccatgggatccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaccctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattagctcgagggtagatctggtactagtggtgaattcggtgagctcggtctgcagctggtgccgcgcggcagccaccaccaccaccaccactaatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtcgaccagacccgccataaaacgccctgagaagcccgtgacgggcttttcttgtattatgggtagtttccttgcatgaatccataaaaggcgcctgtagtgccatttacccccattcactgccagagccgtgagcgcagcgaactgaatgtcacgaaaaagacagcgactcaggtgcctgatggtcggagacaaaaggaatattcagcgatttgcccgagcttgcgagggtgctacttaagcctttagggttttaaggtctgttttgtagaggagcaaacagcgtttgcgacatccttttgtaatactgcggaactgactaaagtagtgagttatacacagggctgggatctattctttttatctttttttattctttctttattctataaattataaccacttgaatataaacaaaaaaaacacacaaaggtctagcggaatttacagagggtctagcagaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaaggactagtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgagatgtatgtctgaattagttgttttcaaagcaaatgaactagcgattagtcgctatgacttaacggagcatgaaaccaagctaattttatgctgtgtggcactactcaaccccacgattgaaaaccctacaaggaaagaacggacggtatcgttcacttataaccaatacgttcagatgatgaacatcagtagggaaaatgcttatggtgtattagctaaagcaaccagagagctgatgacgagaactgtggaaatcaggaatcctttggttaaaggctttgagattttccagtggacaaactatgccaagttctcaagcgaaaaattagaattagtttttagtgaagagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaaaacaaatactctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaaggcaaatatagagattagccttgatgaatttaagttcatgttaatgcttgaaaataactaccatgagtttaaaaggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattggtggttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctcgtaaccgaacttgagaacaaccagataaaaatgaatggtgacaaaataccaacaaccattacatcagattcctacctacgtaacggactaagaaaaacactacacgatgctttaactgcaaaaattcagctcaccagttttgaggcaaaatttttgagtgacatgcaaagtaagcatgatctcaatggttcgttctcatggctcacgcaaaaacaacgaaccacactagagaacatactggctaaatacggaaggatctgaggttcttatggctcttgtatctatcagtgaagcatcaagactaacaaacaaaagtagaacaactgttcaccgttagatatcaaagggaaaactgtccatatgcacagatgaaaacggtgtaaaaaagatagatacatcagagcttttacgagtttttggtgcatttaaagctgttcaccatgaacagatcgacaatgtaacagatgaacagcatgtaacacctaatagaacaggtgaaaccagtaaaacaaagcaactagaacatgaaattgaacacctgagacaacttgttacagctcaacagtcacacatagacagcctgaaacaggcgatgctgcttatcgaatcaaagctgccgacaacacgggagccagtgacgcctcccgtggggaaaaaatcatggcaattctggaagaaatagcgctttcagccggcaaacctgaagccggatctgcgattctgataacaaactagcaacaccagaacagcccgtttgcgggcagcaaaacccgcggccgcctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataatgtctaacaattcgttcaagccgaggggccgcaagatccggccacgatgacccggtcgtcggttcagggcagggtcgttaaatagccgcttatgtctattgctggtttaccggtttattgactaccggaagcagtgtgaccgtgtgcttctcaaatgcctgaggtttcaggcatgc SEQ IDNO.2 LKL aaaaatgatttgtcgttagtgttatacctagccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatgggaaatttactgagccaatccc SEQ IDNO.3 P119 atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggttccctctacaataatttgtttaactttcgcgcgtaacaggaggaattaacc SEQ IDNO.4 Ptrc ttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagacc SEQ IDNO.5 RBS aggaggaattaacc SEQ IDNO.6 TrrnB tgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtggggtctccccatcgagagtagggaactgccaggcatcaaataaacgaaaggctcagtcgaaagactgggcctt SEQ IDNO.7 glpCup gaagaaaaggaaccacaactccttcagaaaaaagcttcgctgtaatatgactacgggacaattaaac SEQ IDNO.8 glpkKdown tgtaaatgccgaatgaaggtttatgccgcatccggtagtcccgaaacgtgcgggggcaacccgcacac SEQ IDNO.9 hyyup tatcgccgataacgcacggacgcacctgaaacctgcttcatgcactatgaataagggagataaata SEQ IDNO.10 hyidown aacgtaacgctattcagacaatgctttttaggccgctaagttggcaggggatcgtgttgtctgaattca SEQ IDNO.11 ghrAup aacgtaacgctattcagacaatgctttttaggccgctaagttggcaggggatcgtgttgtctgaattca SEQ IDNO.12 ghrAdown taaagcatcaggattcctcctatccttggcgggattgaatacaggagagagttatgtatcccgtcgacc SEQ IDNO.13 ghrBup ggcattcttcagttttccttcatcatatttcaggctaaggtgatcgccttatcagtgaatggagagaagc SEQ IDNO.14 ghrBdown gccgcgactgcgtagagtaaagcccgataatcgctcgggcttttactctttattgggttgcagtaactgc SEQ IDNO.15 ppsAup atgaaccttcaattttattttttatgaaaacagcatttcatttttatggtttcgtttataccgatggttt SEQ IDNO.16 ppsAdown atgtccaacaatggctcgtcaccgctggtgctttggtataaccaactcggcatgaatgatgtagacaggg SEQ IDNO.17 poxBup tcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc SEQ IDNO.18 poxBdown aaagggtggcatttcccgtcataataaggacatgccatgattgatttacgcagtgataccgttacccgac SEQ ID19 pflBup aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttac SEQ ID20 pflBdown ttagatttgactgaaatcgtacagtaaaaagcgtacaataaaggctccacgaaagtggggccttttttag SEQ ID21 ldhAup attaaatttgaaattttgtaaaatatttttagtagcttaaatgtgattcaacatcactggagaaagtctt SEQ ID22 ldhAdown tcttgccgctcccctgcattccaggggagctgattcagataatccccaatgacctttcatcctctattct SEQ ID23 lpxMup agttcaacagatttcgaatattctgaagcaaacttgaacttatcatcaggcgaaggcctctcctcgcgag SEQ ID24 lpxMdown tctggtgatagtgtagcggcgcaacttgccccgcaccaaataaaaaaagccggtactgactgcgtaccgg SEQ ID25 dxsup tcgatacctcggcactggaagcgctagcggactacatcatccagcgtaataaataaacaataagtattaa SEQ ID26 dxsdown atgagttttgatattgccaaatacccgaccctggcactggtcgactccacccaggagttacgactgttgc ScGPD1 GeneID:851539(2025.7.6) ScGPP1 GeneID:854758(2025.7.6) GogdH GenBank: LT900338.1(1769255-1770250 (-))(2017.7.20) PogadH GeneID:2844486(2024.10.22) PshpdH GenBank: GU373722.1(2012.5.19) ScTK GeneID:856188(2025.7.6) LzxpdH GenBank: LS991421.1(2754636-2755682 (-),2020.8.3)。 BsaraL GenBank: CP010314.1(2923680-2924498 (-),2015.3.24)。 cscB GenBank: X81461.2(3171-4418 (-),2015.3.24)。 cscA GenBank: X81461.2(5619-7052(-),2015.3.24)。

[0083] Table 2 Primer sequences

[0084] 引物或序列名称 核苷酸序列(5’至3’) kan-R tcgtcaagaaggcgatagaa poxB-1 tcccatcccttccccctccgtcagatgaac poxB-2 gtcgggtaacggtatcactgcgtaaatcaa poxB-3 ggctatttaaccgttagtgcctcctttctc pflB-1 aaacgaccaccattaatggttgtcgaag pflB-2 ctaaaaaaggccccactttcgtggagc pflB-3 ccggaaaatttttctcacctgacc ppsA-1 atgaaccttcaattttattttttatgaaaa ppsA-2 ccctgtctacatcattcatgccgagttggt ppsA-3 aagcgtagaacgttatgtctggtttataaa lpxM-1 agttcaacagatttcgaatattctgaagca lpxM-2 ccggtacgcagtcagtaccggcttttttta lpxM-3 aacgccacatccggcctacagttcaatgat ldhA-1 attaaatttgaaattttgtaaaata ldhA-2 agaatagaggatgaaaggtcattgg ldhA-3 atgaatttttcaatatcgccatagctttca glpK-1 gaagaaaaggaaaccacaactccttcagaa glpK-2 gtgtgcggggttgcccccgcacgtttcggg glpK-3 cgccatttgccttgcgatatctgtgttgtg hyi-1 tatcgccgataacgcagcggacgcaccgac hyi-2 tgaattcagacaacacgatcccctgccaac hyi-3 tcttcaaattccatgacgttatccagttcg ghrA-1 tgctggtggcctttgtagatcataacgata ghrA-2 ggtcgacgggatacataactctctcctgta ghrA-3 ctttttttgccaccgaccacggatttgtta ghrB-1 ggcattcttcagttttccttcatcatattt ghrB-2 gcagttatgcaacccaataaagagtaaaa ghrB-3 ctttcatgccaggtgatgcagaaatcacct dxs-1 tcgatacctcggcactggaagcgctagcgg dxs-2 gcaacagtcgtaactcctgggtggagtcga dxs-3 agtcgctgaaacaactggctgaacagtcac

[0085] Example 1. Construction of Escherichia coli strain XY01-10

[0086] The preparation method of the relevant strains is obtained according to the following steps (1)-(2):

[0087] (1) Starting from Escherichia coli MG1655, the promoter of the phosphoenolpyruvate synthase gene ppsA in the strain was replaced with the P119 promoter to obtain the XY01 strain.

[0088] The specific steps are as follows:

[0089] (1-a) Preparation of targeting fragment XY-1

[0090] The following DNA fragment was synthesized (GenScript): from 5' to 3', it consisted of: ppsAup, LBL (from 5' to 3', it consisted of lox66, the Kan resistance gene, and lox71), and ppsAdown. PCR amplification was performed using the synthesized DNA fragment as a template using primers ppsA-1 / ppsA-2 to generate the target fragment XY-1.

[0091] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0092] The pKD46 plasmid was transformed into the starting E. coli MG1655 using the calcium chloride method. After overnight culture at 30°C on LB plates containing ampicillin, colonies were selected to obtain recombinant E. coli MG1655 / pKD46 containing the plasmid pKD46. After induction with arabinose, MG1655 / pKD46 expressed the three recombinant proteins of phage λ, conferring homologous recombination capability. Competent MG1655 / pKD46 cells were then prepared by washing with 10% glycerol.

[0093] (1-c) Homologous recombination

[0094] The target fragment XY-1 prepared in (1-a) was electroporated into the MG1655 / pKD46 competent cells prepared in (1-b) and incubated overnight at 37°C on LB plates containing kanamycin (50 µg / ml). A clone was selected and genomic DNA extracted. PCR amplification using primers ppsA-3 / Kan-R was performed to identify the clone. A positive clone was identified by amplifying a target band of approximately 1000 bp. Sequencing analysis confirmed that the target sequence on the genome of XY01-kan was correct, and the promoter region of the ppsA gene had been replaced with the P119 promoter. XY01-kan was cultured overnight at 42°C to eliminate the temperature-sensitive plasmid pKD46.

[0095] (1-d) Elimination of resistance

[0096] The pSCre plasmid was transformed into the XY01-kan strain, which had been depleted of pKD46, using the calcium chloride method. The strain was cultured overnight at 30°C on LB plates containing 50 mg / L streptomycin and 0.2% L-arabinose. The kanamycin resistance fragment was eliminated using the Cre recombinase on the pSCre plasmid. The temperature-sensitive pSCre plasmid was eliminated by culturing overnight at 42°C. The resulting strain was named XY01.

[0097] (2) Obtaining strains XY02, XY03, XY04, XY05, XY06, XY07, XY08, XY09, XY10, and XY11

[0098] Using the same method as in Example 1 (1), starting from strain XY01, strains XY02, XY03, XY04, XY05, XY06, XY07, XY08, XY09, and XY10 were obtained in sequence. Starting from strain MG1655, strain XY11 was obtained. The difference between the construction process of each strain and that of Example 1 (1) was that different starting strains, different target fragments, and different primers were used. The starting strains, target fragments (the specific sequences of the sequence fragments are shown in Table 1), primers, modified targets, and information on the obtained strains used in each step are shown in Table 3.

[0099] Table 3. XY01-XY11 construction process

[0100] Step number Starting strain Target practice clip name The targeting fragment contains the sequence fragment (5'-3') Modified targets Amplification primers Identification primers Obtain strains 1 MG1655 XY-1 ppsAup, LKL, P119, ppsAdown Replace the promoter of the phosphoenolpyruvate synthase gene (ppsA) with the P119 promoter ppsA-1 / ppsA-2 ppsA-3 / KanR XY01 2 XY01 XY-2 glpKup, LKL, P119, ScGPD1, RBS, ScGPP1, TrrnB, glpKdown The glycerol kinase gene (glpK) was knocked out and replaced with the expression cassettes of the glycerol 3-phosphate dehydrogenase gene (ScGPD1) and the glycerol phosphatase gene (ScGPP1). glpK-1 / glpK-2 glpK-3 / KanR XY02 4 XY02 XY-3 hyiup, LKL, P119, GogdH, RBS, PogadH, TrrnB, hyidown The hydroxypyruvate isomerase gene (hyi) was knocked out and replaced with the expression cassettes of the glycerol dehydrogenase gene (GogdH) and the glyceraldehyde dehydrogenase gene (PogadH). hyi-1 / hyi-2 hyi-3 / KanR XY03 6 XY03 XY-4 ghrAup, LKL, P119, PshpdH, TrrnB, ghrAdown The glyoxylate / hydroxypyruvate reductase A gene (ghrA) was knocked out and replaced with the expression cassette of the hydroxypyruvate dehydrogenase gene (PshpdH). ghrA-1 / ghrA-2 ghrA-3 / KanR XY04 7 XY04 XY-5 ghrBup, LKL, P119, ScTK, TrrnB, ghrBdown The glyoxylate / hydroxypyruvate reductase B gene (ghrB) was knocked out and replaced with the expression cassette of the transketolase gene (ScTK) ghrB-1 / ghrB-2 ghrB-3 / KanR XY05 8 XY05 XY-6 dxsup, LKL, P119, dxsdown Replace the promoter of the 1-deoxyxylulose 5-phosphate synthase gene (dxs) with the P119 promoter dxs-1 / dxs-2 dxs-3 / KanR XY06 9 XY06 XY-7 pflBup, LKL, Ptrc, cscB, RBS, cscA, TrrnB, pflBdown The pyruvate formate lyase gene (pflB) was replaced with the expression cassettes for sucrose permease (cscB) and sucrose hydrolase (cscA) pflB-1 / pflB-2 pflB-3 / KanR XY07 9 XY07 XY-8 lpxMup, LKL, lpxMdown Knockout of the myristoyltransferase gene (lpxM) lpxM-1 / lpxM-2 lpxM-3 / KanR XY08 10 XY08 XY-9 poxBup, LKL, Ptrc, LzxpdH, RBS, BsaraL, TrrnB, poxBdown The pyruvate oxidase gene (poxB) was knocked out and replaced with the expression cassettes of xylitol-5-phosphate dehydrogenase (LzxpdH) and xylitol-5-phosphate phosphatase (BsaraL). poxB-1 / poxB-2 poxB-3 / KanR XY09 11 XY09 XY-10 ldhAup, LKL, Ptrc, LzxpdH, RBS, BsaraL, TrrnB, ldhAdown The D-lactose dehydrogenase gene (ldhA) was knocked out and replaced with the expression cassettes of xylitol-5-phosphate dehydrogenase (LzxpdH) and xylitol-5-phosphate phosphatase (BsaraL). ldhA-1 / ldhA-2 ldhA-3 / KanR XY10 12 MG1655 XY-9 poxBup, LKL, Ptrc, LzxpdH, RBS, BsaraL, TrrnB, poxBdown The pyruvate oxidase gene (poxB) was knocked out and replaced with the expression cassettes of xylitol-5-phosphate dehydrogenase (LzxpdH) and xylitol-5-phosphate phosphatase (BsaraL) poxB-1 / poxB-2 poxB-3 / KanR XY011

[0101] Example 2: Production of xylitol using recombinant Escherichia coli XY10

[0102] The test bacteria were recombinant Escherichia coli XY09 and XY10; the control bacteria were MG1655, XY08, and XY11.

[0103] The components and final concentrations of the conversion glucose medium used are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, glucose: 10% (g / 100 mL).

[0104] The components and final concentrations of the transformation sucrose medium used are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, sucrose: 10% (g / 100 mL).

[0105] (1) Inoculate the recombinant bacteria XY09, XY10, MG1655, XY08, and XY11 cultured overnight into a shake flask containing 200 ml of LB medium at a 1% inoculum size. Cultivate at 37°C for 3-4 h until the OD600nm reaches 0.6-0.8. Then add arabinose at a final concentration of 0.2 g / L. Continue culturing at 37°C for 12 h. Centrifuge at 8000 rpm for 10 min to collect the bacteria.

[0106] (2) The collected cells were resuspended in a shake flask containing 10 mL of glucose conversion medium and transformed at 200 rpm and 37°C for 24 h. The supernatant was centrifuged and filtered. HPLC was performed using a Bio-Rad Aminex HPX-87H column (300 mm × 7.8 mm, 9 μm); the mobile phase was aqueous solution at a flow rate of 0.6 mL / min; and the column temperature was 80°C. Xylitol standard was purchased from Shanghai Yuanye Biotechnology (Cat. No. B20885). The retention time of the xylitol standard was 21 min.

[0107] The results showed that the xylitol production of the control strains MG1655 and XY08 was zero, and that of the control strain XY11 was 0.55±0.03 g / L. In contrast, the xylitol production of strains XY09 and XY10 was 58.16±6.22 and 67.26±5.32 g / L, respectively. The constructed strains were able to efficiently utilize glucose to synthesize xylitol.

[0108] (3) The cells collected in Example 2 (1) were resuspended in shake flasks containing 10 mL of conversion sucrose medium. The cells were transformed at 200 rpm and 37°C for 24 h. The supernatant was collected by centrifugation and filtered. The xylitol content was determined using the HPLC method described in Example 2 (2).

[0109] The results showed that the xylitol production of the control strains MG1655 and XY08 was zero, and that of the control strain XY11 was 0.36±0.01 g / L. In contrast, the xylitol production of strains XY09 and XY10 was 60.64±4.72 and 72.64±6.60 g / L, respectively. The constructed strains were able to efficiently utilize sucrose to synthesize xylitol.

[0110] The production characteristics of related strains are shown in Table 6.

[0111] Table 6 Comparison of yield of each strain

[0112]

Claims

1. A recombinant Escherichia coli comprising the following modifications: (12) Introduction of xylitol 5-phosphate dehydrogenase gene (LzxpdH); (13) Introducing the xylitol 5-phosphate phosphatase gene (BsaraL).

2. The recombinant Escherichia coli according to claim 1, wherein the introduced xylitol 5-phosphate dehydrogenase gene (LzxpdH) is derived from Lactobacillus zeae; and the xylitol 5-phosphate phosphatase gene (BsaraL) is derived from Bacillus subtilis.

3. The recombinant Escherichia coli according to claim 1-2, further comprising the following modifications: (1) Knockout of the gene encoding pyruvate oxidase (poxB); (2) Knockout of the gene encoding D-lactose dehydrogenase (ldhA); (3) knockout of the gene encoding pyruvate formate lyase (pflB); (4) Introduction of the glycerol 3-phosphate dehydrogenase gene (ScGPD1); (5) Introduction of the glycerol phosphatase gene (ScGPP1); (6) Knockout of the gene encoding glycerol kinase (glpK); (7) Introduction of the glycerol dehydrogenase gene (GogdH); (8) Introduction of the glyceraldehyde dehydrogenase gene (PogadH); (9) Introduction of the hydroxypyruvate dehydrogenase gene (PshpdH); (10) Knockout of the gene encoding hydroxypyruvate isomerase (hyi); (11) Knockout of the gene encoding glyoxylate / hydroxypyruvate reductase A (ghrA); (12) Knockout of the gene encoding glyoxylate / hydroxypyruvate reductase B (ghrB); (13) Enhance the expression of phosphoenolpyruvate synthase gene (ppsA); (14) Introduction of transketolase gene (ScTK); (15) Enhance the expression of 1-deoxyxylulose 5-phosphate synthase gene (dxs); (18) Introduction of sucrose permease gene (cscB); (19) Introduction of sucrose hydrolase gene (cscA); (20) Knockout of the gene encoding myristoyltransferase (lpxM).

4. A method for constructing a recombinant Escherichia coli with improved xylitol production, comprising the following steps: performing the transformation according to the transformation (1) to (20) in claims 1-3.

5. A method for producing or increasing the yield of xylitol, comprising the following steps: culturing the recombinant Escherichia coli according to claims 1 to 3 using glucose and / or sucrose as carbon sources, collecting the culture, and obtaining xylitol.

6. Use of the recombinant Escherichia coli according to claims 1-3 in producing or increasing the yield of xylitol.

7. A product for producing or increasing the yield of xylitol, wherein the active ingredient is the recombinant Escherichia coli according to claims 1-3.

Images