Escherichia coli for efficiently synthesizing xylitol and application thereof

Abstract

The invention provides recombinant escherichia coli for synthesizing xylitol. The recombinant Escherichia coli is subjected to multi-step genetic engineering modification, including knocking out genes such as 6-phosphofructokinase 1 and the like; the expression of genes such as KHG / KDPG aldolase genes is enhanced; and introducing genes such as an exogenous xylitol 5-phosphate dehydrogenase gene and the like. The modified strain can be used for synthesizing xylitol at a high level by taking glucose, cane sugar and the like as raw materials, and has industrial application prospects in the fields of biological manufacturing, food raw material production and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of synthetic biology and food raw material production, and in particular to a recombinant Escherichia coli strain for synthesizing xylitol and a preparation method thereof. Background Art

[0002] Xylitol is a naturally occurring five-carbon sugar alcohol widely found in a variety of plants and microorganisms. Due to its unique chemical properties, xylitol exhibits significant application value in a wide range of fields. For example, in the pharmaceutical field, xylitol serves as a key intermediate in the synthesis of anti-tumor drugs, vitamin compounds, and cardiovascular and cerebrovascular drugs. In the cosmetics industry, xylitol is widely used as a wetting agent in toothpaste and other skin care products due to its excellent moisturizing and antifreeze properties. In the food industry, xylitol is often used as an additive in products such as dairy products, soft drinks, chewing gum, and chocolate due to its refreshing taste. Furthermore, xylitol holds great promise in agriculture. It can be sprayed on crops as a foliar fertilizer, significantly enhancing their stress resistance and promoting nutrient absorption, thereby increasing yield and quality.

[0003] Currently, xylitol is primarily produced industrially through chemical catalytic hydrogenation. However, this method has numerous drawbacks: harsh reaction conditions (requiring high temperature and high pressure), expensive catalysts and environmental risks, low yields, and the production of numerous difficult-to-separate byproducts. Therefore, making this process greener and more efficient remains a pressing issue. In contrast, bioconversion has garnered significant attention in recent years due to its milder reaction conditions and environmental friendliness. Currently, the primary strategy for biosynthesizing xylitol is the efficient conversion of D-xylose to xylitol using D-xylose reductase. However, this enzyme typically relies on the expensive reduced coenzyme NADP(H), significantly limiting its application in industrial production. Furthermore, the D-xylose raw material commonly used in industry is primarily derived from corncobs, which require complex extraction processes and, as resources deplete, are increasingly expensive.

[0004] To overcome existing process bottlenecks, recent advances in metabolic engineering and synthetic biology have opened up new avenues for developing novel xylitol synthesis pathways. By optimizing metabolic networks, xylitol can be directly synthesized from inexpensive carbon sources, reducing production costs and potentially enabling sustainable, efficient industrial production. Therefore, developing biosynthetic routes for xylitol synthesis from inexpensive carbon sources such as glucose and sucrose holds great promise for overcoming the production bottlenecks of biological xylitol synthesis. Summary of the Invention

[0005] The present invention addresses the key technical bottlenecks in existing xylitol biosynthesis technologies and provides a new synthesis technology route. Specifically, through systematic metabolic pathway design and genetic engineering, the present invention constructs a recombinant Escherichia coli engineered strain that can efficiently synthesize xylitol from an inexpensive carbon source (glucose or sucrose). This technical solution focuses on solving the following core problems: (1) the high cost of raw materials in traditional processes; (2) the technical difficulty of low efficiency of existing biosynthesis pathways; and (3) the metabolic balance between carbon source utilization and product synthesis in microbial cell factories. The present invention achieves efficient bioconversion from basic carbon sources to xylitol, providing a technical solution with important application value for the industrial biomanufacturing of xylitol.

[0006] In order to solve the above technical problems, in a first aspect, the present invention provides a recombinant Escherichia coli, which is a recombinant bacterium obtained by carrying out the following transformations (1) to (16) in Escherichia coli;

[0007] (1) Knockout of the gene encoding 6-phosphofructokinase 1 (pfkA);

[0008] (2) Knockout of the gene encoding 6-phosphofructokinase 2 (pfkB);

[0009] (3) Knockout of the gene encoding 6-phosphogluconate dehydrogenase (gnd);

[0010] (4) Knockout of the gene encoding pyridine nucleotide transhydrogenase A subunit (pntA);

[0011] (5) Knockout of the gene encoding pyridine nucleotide transhydrogenase B subunit (pntB);

[0012] (6) Enhance the expression of KHG / KDPG aldolase gene (eda);

[0013] (7) Enhance the expression of phosphogluconate dehydratase gene (edd);

[0014] (8) Enhance the expression of phosphoenolpyruvate synthase gene (ppsA);

[0015] (9) Enhance the expression of transketolase I gene (tktA);

[0016] (10) Enhance the expression of transketolase II gene (tktB);

[0017] (11) Enhance the expression of soluble pyridine nucleotide transhydrogenase gene (sthA);

[0018] (12) Introduction of xylitol 5-phosphate dehydrogenase gene (LzxpdH);

[0019] (13) Introduction of the xylitol 5-phosphate phosphatase gene (BsaraL);

[0020] (14) Introduction of sucrose permease gene (cscB);

[0021] (15) Introduction of sucrose hydrolase gene (cscA);

[0022] (16) Knockout of the gene encoding myristoyltransferase (lpxM).

[0023] The modifications of (6)-(11) above can be specifically as follows: replacing the promoters of the KHG / KDPG aldolase gene (eda), phosphogluconate dehydratase gene (edd), phosphoenolpyruvate synthase gene (ppsA), transketolase I gene (tktA), transketolase II gene (tktB), and soluble pyridine nucleotide transhydrogenase gene (sthA) with the P119 promoter.

[0024] The modifications of (1)-(3) and (13)-(14) above can be specifically as follows: the 6-phosphofructokinase 1 gene (pfkA), the 6-phosphofructokinase 2 gene (pfkB), and the 6-phosphogluconate dehydrogenase gene (gnd) are knocked out respectively, and replaced with the expression frames of the xylitol 5-phosphate dehydrogenase gene (LzxpdH) and the xylitol 5-phosphate phosphatase gene (BsaraL), so that the expression frames of the xylitol 5-phosphate dehydrogenase gene (LzxpdH) and the xylitol 5-phosphate phosphatase gene (BsaraL) are inserted into the chromosome in three copies.

[0025] The modifications of (4)-(5) and (15)-(16) above can be specifically as follows: the gene expression frames (pntAB) of pyridine nucleotide transhydrogenase subunit A and B are knocked out and replaced with the expression frames of sucrose permease gene (cscB) and sucrose hydrolase gene (cscA).

[0026] Furthermore, the xylitol 5-phosphate dehydrogenase gene (LzxpdH) may be derived from Lactobacillus zeae.

[0027] Furthermore, the xylitol 5-phosphate phosphatase gene (BsaraL) may be derived from Bacillus subtilis.

[0028] Furthermore, the sucrose permease gene (cscB) may be derived from Escherichia coli.

[0029] Furthermore, the sucrose hydrolase gene (cscA) may be derived from Escherichia coli.

[0030] In a second aspect, the present application provides a method for constructing recombinant E. coli with improved xylitol production, comprising the following steps: performing the modification according to the modification modes (1)-(16) in claim 1.

[0031] In a third aspect, the present application provides a method for producing or improving xylitol production, comprising the following steps: culturing the recombinant E. coli of the first aspect or the second aspect with glucose or / and sucrose as carbon source, collecting the culture to obtain xylitol.

[0032] In a fourth aspect, the present application provides the recombinant E. coli of the first aspect or the second aspect for use in the production or improvement of xylitol production.

[0033] In a fifth aspect, the present application provides a product for producing or improving xylitol production, wherein the active ingredient is the recombinant E. coli of the first aspect or the second aspect.

[0034] The product can be a bacterial agent containing the recombinant bacteria or / and a culture of the recombinant bacteria.

[0035] The term "culture" refers to a collective term for liquid or solid products (i.e. fermentation products) that have been inoculated and cultured by humans, i.e. products obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites or other components produced during the culture process.

[0036] In specific embodiments of the present application, the components and final concentrations of the glucose culture medium are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, glucose: 10% (g / 100 mL).

[0037] In specific embodiments of the present application, the components and final concentrations of the sucrose culture medium are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, sucrose: 10% (g / 100 mL).

[0038] In specific embodiments of the present application, the starting E. coli can be E. coli MG1655, E. coli BW25113, or E. coli MC02.

[0039] In the present application, the nucleotide sequence of the P119 promoter is SEQ ID No. 3.

[0040] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 6-phosphofructokinase 1 (pfkA) is NP_418351.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 948412 (2025.6.25).

[0041] The NCBI Reference Sequence number of the 6-phosphofructokinase 2 (pfkB) is NP_416237.3, and the NCBI Reference Sequence number of the gene encoding the pfkB is Gene ID: 946230 (2025.6.25).

[0042] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the phosphoenolpyruvate carboxylase (ppc) is NP_418391.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the phosphoenolpyruvate carboxylase (ppc) is Gene ID: 948457 (2025.6.25).

[0043] The NCBI Reference Sequence number of the KHG / KDPG aldolase (eda) is NP_416364.1, and the NCBI Reference Sequence number of the gene encoding the KHG / KDPG aldolase (eda) is Gene ID: 946367 (2025.6.25).

[0044] The NCBI Reference Sequence number (NCBI Reference Sequence) of the phosphogluconate dehydratase (edd) is NP_416365.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946362 (2025.6.25).

[0045] The NCBI Reference Sequence Number (NCBI Reference Sequence) of the phosphoenolpyruvate synthase (ppsA) is NP_416217.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946209 (2025.6.25).

[0046] The NCBI Reference Sequence of the transketolase I (tktA) is YP_026188.1, and the NCBI Reference Sequence of the encoding gene is Gene ID: 947420 (2025.6.25).

[0047] The NCBI Reference Sequence of the transketolase II (tktB) is NP_416960.1, and the NCBI Reference Sequence of the encoding gene is Gene ID: 945865 (2025.6.25).

[0048] The NCBI Reference Sequence of the 6-phosphogluconate dehydrogenase (gnd) is NP_416533.1, and the NCBI Reference Sequence of the encoding gene is Gene ID: 946554 (2025.6.25).

[0049] The NCBI Reference Sequence of the soluble pyridine nucleotide transhydrogenase (sthA) is NP_418397.2, and the NCBI Reference Sequence of the encoding gene is Gene ID: 948461 (2025.6.25).

[0050] The NCBI Reference Sequence of the pyridine nucleotide transhydrogenase A subunit (pntA) is NP_416120.1, and the NCBI Reference Sequence of the encoding gene is Gene ID: 946628 (2025.6.25).

[0051] The NCBI Reference Sequence of the pyridine nucleotide transhydrogenase B subunit (pntB) is NP_416119.1, and the NCBI Reference Sequence of the encoding gene is Gene ID: 946144 (2025.6.25).

[0052] The xylitol 5-phosphate dehydrogenase (LzxpdH) is derived from Lactobacillus zeae, and its NCBI Reference Sequence Number is WP_070651242.1, and the NCBI Reference Sequence Number of its encoding gene is LS991421.1 (2754636-2755682 (-), 2020.8.3).

[0053] The xylitol 5-phosphate phosphatase (BsaraL) is derived from Bacillus subtilis, and its NCBI Reference Sequence Number is WP_413154961.1. The NCBI Reference Sequence Number of the encoding gene is CP010314.1 (2923680-2924498 (-), 2015.3.24).

[0054] The sucrose permease (cscB) is derived from Escherichia coli, and its NCBI Reference Sequence Number is CAA57217.1. The NCBI Reference Sequence Number of the encoding gene is X81461.2 (3171-4418 (-), 2015.3.24).

[0055] The sucrose hydrolase (cscA) is derived from Escherichia coli, and its NCBI Reference Sequence Number is CAA57219.1. The NCBI Reference Sequence Number of the encoding gene is X81461.2 (5619-7052(-), 2015.3.24).

[0056] The NCBI Reference Sequence number (NCBI Reference Sequence) of the myristoyltransferase (lpxM) is NP_416369.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding the myristoyltransferase (lpxM) is Gene ID: 945143 (2025.6.25).

[0057] The beneficial technical effects achieved by the present invention are as follows:

[0058] The present invention provides a recombinant Escherichia coli that can synthesize xylitol at a high level by using glucose and sucrose as raw materials, thereby providing a novel biotechnology route for synthesizing xylitol and can be used for mass production of xylitol.

[0059] Preservation Instructions

[0060] (1) Bacteria species: Escherichia coli

[0061] Latin name: Escherichia coli

[0062] Strain ID: XY10

[0063] Depository: General Microbiology Center of China Culture Collection Administration

[0064] Abbreviation of depository institution: CGMCC

[0065] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0066] Deposit date: July 8, 2025

[0067] CGMCC registration number: CGMCC No.35136 BRIEF DESCRIPTION OF THE DRAWINGS

[0068] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0069] 图1 This is the HPLC peak diagram of xylitol (sample). DETAILED DESCRIPTION

[0070] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0071] The liquid LB medium (pH 7.0) in the following examples contained 1 g / 100 mL NaCl, 1 g / 100 mL tryptone, 0.5 g / 100 mL yeast extract, and the balance was water. Solid culture medium is obtained by adding agarose to liquid culture medium.

[0072] The starting E. coli in the following examples can specifically be one of E. coli MG1655, BW25113, or MC02. E. coli MG1655 (CGSC#: 6300), BW25113 (CGSC#: 76376), and plasmid pKD46 (CGSC#: 7739) are products of the Yale University Genetic Collection of E. coli (CGSC). E. coli MC02 was purchased from the China General Microbiological Culture Collection (CGMCC) (No. 34378). The pKD46 plasmid contains the temperature-sensitive origin of replication, oriR101, which replicates normally at 30°C but is automatically lost at temperatures above 37°C. E. coli carrying the pKD46 plasmid are cultured at 30°C and, upon induction with arabinose, efficiently express Gam, Exo, and Beta. Once exogenous dsDNA is electroporated into the cells, it undergoes homologous recombination with the genomic target sequence. The plasmid also carries an ampicillin resistance gene as a selection marker. The gene sequence of the pSCre plasmid is shown in SEQ ID NO.1, and the public can obtain it through gene synthesis: Escherichia coli carrying the pSCre plasmid can express the recombinase (Cre) gene when cultured at 30°C, causing the lox66 sequence and lox71 sequence on the chromosome to recombine, thereby eliminating the DNA sequence located between the lox66 sequence and lox71 sequence. In this patent, the kanamycin resistance gene located between the lox66 sequence and lox71 sequence in the sequence of SEQ ID NO.2 can be eliminated; Escherichia coli carrying the pSCre plasmid will automatically lose the pSCre plasmid when cultured at 42°C; and the streptomycin resistance gene is carried as a selection marker.

[0073] Table 1. List of sequence fragments

[0074] 序列号 片段名称 序列(5’-3’) SEQ IDNO.1 pSCre aatgtgcctgtcaaatggacgaagcagggattctgcaaaccctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgttttttgggctaacaggaggaattaaccatgggatccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaccctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattagctcgagggtagatctggtactagtggtgaattcggtgagctcggtctgcagctggtgccgcgcggcagccaccaccaccaccaccactaatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtcgaccagacccgccataaaacgccctgagaagcccgtgacgggcttttcttgtattatgggtagtttccttgcatgaatccataaaaggcgcctgtagtgccatttacccccattcactgccagagccgtgagcgcagcgaactgaatgtcacgaaaaagacagcgactcaggtgcctgatggtcggagacaaaaggaatattcagcgatttgcccgagcttgcgagggtgctacttaagcctttagggttttaaggtctgttttgtagaggagcaaacagcgtttgcgacatccttttgtaatactgcggaactgactaaagtagtgagttatacacagggctgggatctattctttttatctttttttattctttctttattctataaattataaccacttgaatataaacaaaaaaaacacacaaaggtctagcggaatttacagagggtctagcagaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaaggactagtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgagatgtatgtctgaattagttgttttcaaagcaaatgaactagcgattagtcgctatgacttaacggagcatgaaaccaagctaattttatgctgtgtggcactactcaaccccacgattgaaaaccctacaaggaaagaacggacggtatcgttcacttataaccaatacgttcagatgatgaacatcagtagggaaaatgcttatggtgtattagctaaagcaaccagagagctgatgacgagaactgtggaaatcaggaatcctttggttaaaggctttgagattttccagtggacaaactatgccaagttctcaagcgaaaaattagaattagtttttagtgaagagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaaaacaaatactctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaaggcaaatatagagattagccttgatgaatttaagttcatgttaatgcttgaaaataactaccatgagtttaaaaggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattggtggttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctcgtaaccgaacttgagaacaaccagataaaaatgaatggtgacaaaataccaacaaccattacatcagattcctacctacgtaacggactaagaaaaacactacacgatgctttaactgcaaaaattcagctcaccagttttgaggcaaaatttttgagtgacatgcaaagtaagcatgatctcaatggttcgttctcatggctcacgcaaaaacaacgaaccacactagagaacatactggctaaatacggaaggatctgaggttcttatggctcttgtatctatcagtgaagcatcaagactaacaaacaaaagtagaacaactgttcaccgttagatatcaaagggaaaactgtccatatgcacagatgaaaacggtgtaaaaaagatagatacatcagagcttttacgagtttttggtgcatttaaagctgttcaccatgaacagatcgacaatgtaacagatgaacagcatgtaacacctaatagaacaggtgaaaccagtaaaacaaagcaactagaacatgaaattgaacacctgagacaacttgttacagctcaacagtcacacatagacagcctgaaacaggcgatgctgcttatcgaatcaaagctgccgacaacacgggagccagtgacgcctcccgtggggaaaaaatcatggcaattctggaagaaatagcgctttcagccggcaaacctgaagccggatctgcgattctgataacaaactagcaacaccagaacagcccgtttgcgggcagcaaaacccgcggccgcctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataatgtctaacaattcgttcaagccgaggggccgcaagatccggccacgatgacccggtcgtcggttcagggcagggtcgttaaatagccgcttatgtctattgctggtttaccggtttattgactaccggaagcagtgtgaccgtgtgcttctcaaatgcctgaggtttcaggcatgc SEQ IDNO.2 LKL aaaaatgatttgtcgttagtgttatacctagccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatgggaaatttactgagccaatccc SEQ IDNO.3 P119 atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaacc SEQ IDNO.4 Ptrc ttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagacc SEQ IDNO.5 RBS aggaggaattaacc SEQ IDNO.6 TrrnB tgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt SEQ IDNO.7 tktAup tcgacgctcagtctcagtataaggaaaagcgcagcggacgggcgagtagattgcgcaacatgcgagcatg SEQ IDNO.8 tktAdown atgtcctcacgtaaagagcttgccaatgctattcgtgcgctgagcatggacgcagtacagaaagccaaat SEQ IDNO.9 tktBup cattcgtctgttcgccgttgatcaacgcaaactggaagatcttcttgccgccaaactataaaccagccac SEQ IDNO.10 tktBdown atgtcccgaaaagaccttgccaatgcgattcgcgcactcagtatggatgcggtacaaaaagccaactctg SEQ IDNO.11 edaup tgaattattcagcgccttgcgtgaaaaactgtccggtgccgaacagggcgcaacctgtatcactttttaa SEQ IDNO.12 edadown atgaaaaactggaaaacaagtgcagaatcaatcctgaccaccggcccggttgtaccggttatcgtggtaa SEQ IDNO.13 eddup tgatcttgcgcagattgtagaacaatttttacactttcaggcctcgtgcggattcacccacgaggctttt SEQ IDNO.14 edddown atgaatccacaattgttacgcgtaacaaatcgaatcattgaacgttcgcgcgagactcgctctgcttatc SEQ IDNO.15 ppsAup atgaaccttcaattttattttttatgaaaacagcatttcatttttatggtttcgtttataccgatggttt SEQ IDNO.16 ppsAdown atgtccaacaatggctcgtcaccgctggtgctttggtataaccaactcggcatgaatgatgtagacaggg SEQ IDNO.17 sthAup tccaataaaacgtcagggcaaaagtaagaaacagacaaagcaaaggccgctcaggatatagccagataaa SEQ IDNO.18 sthAdown atgccacattcctacgattacgatgccatagtaataggttccggccccggcggcgaaggcgctgcaatgg SEQ ID19 pntABup tacatgagcagcttgtgtggctcctgacacaggcaaaccatcatcaataaaaccgatggaagggaatatc SEQ ID20 pntABdown ccctgacggcctctgctgaggccgtcactctttattgagatcgcttaacagaacggcgatgctttgacct SEQ ID21 pfkAup gatcacttcgatgtgcaagaagacttccggcaacagatttcattttgcattccaaagttcagaggtagtc SEQ ID22 pfkAdown tgatttcggaaaaaggcagattcctttaccctgaaaccgatgacagaagcaaaaatgcctgatgcgcttc SEQ ID23 pfkBup atcatattgttaatttcttcactttccgctgattcggtgccagactgaaatcagcctataggaggaaatg SEQ ID24 pfkBdown caaaaacattccccagcattgggggaatcatcaccaacctgtcggcaacgcgtttctcgactatgctc SEQ ID25 life gtatacttatttgcgaacattccaggccgcgagcattcagcgcggtgatcacacctgacaggagtatgta SEQ ID26 gnddown tctgatttaaccaaataaattgaggcccggcgtatattgcaccgggctttttttgccaaatatctt SEQ ID27 lpxMup agttcaacagatttcgaatattctgaagcaaacttgaacttatcatcaggcgaaggcctctctcgcgag SEQ ID28 lpxMdown tctggtgatagtgtagggcgcaacttgccccgcaccaaataaaaaagccggtactgactgcgtaccgg LzxpdH GenBank: LS991421.1(2754636-2755682 (-),2020.8.3)。 BsaraL GenBank: CP010314.1(2923680-2924498 (-),2015.3.24)。 cscB GenBank: X81461.2(3171-4418 (-),2015.3.24)。 cscA GenBank: X81461.2(5619-7052(-),2015.3.24)。

[0075] Table 2 Primer sequences

[0076] 引物或序列名称 核苷酸序列(5'至3') can-R tcgtcaagaaggcgatagaa tktA-1 tcgacgctcagtctcagtataaggaaaagc tktA-2 atttggctttctgtactgcgtccatgctca tktA-3 tattctaaaaatgcgccgtttgcaggtgaa tktB-1 cattcgtctgtcgccgttgatcaacgcaa tktB-2 cagagtggctttttgtaccgcatccatac tktB-3 tgcgatggcggtagaaaaactgtctgaagg ppsA-1 atgaaccttcaattttattttttatgaaaa ppsA-2 cccgtctacatcattcatgccgagtggt ppsA-3 aagcgtagaacgttatgtctggtttataaa eda-1 tgaattattcagcgccttgcgtgaaaaact eda-2 ttaccacgataaccggtacaaccgggccgg eda-3 cctgagcgcgtcacgcgtgggaacaggacg edd-1 tgatcttgcgcagattgtagaacaattttt edd-2 gataagcagagcgagtctcgcgcgaacgtt edd-3 ttatcctttatggttattttaccggtaaca sthA-1 tccaataaaacgtcagggcaaaagtaagaa sthA-2 ccattgcagcgccttcgccgccggggccgg sthA-3 cgcttaaacggagagtatcgtcgataaaaa pntAB-1 tacatgagcagcttgtgtggctcctgacac pntAB-2 aggtcaaagcatcgccgttctgttaagcga pntAB-3 atttattttaacggagtaacatttagctcg pfkA-1 gatcacttcgatgtgcaagaagacttccgg pfkA-2 gaagcgcatcaggcatttttgcttctgtca pfkA-3 gtgattgttatactatttgcacattcgttg pfkB-1 atcatattgttaatttcttcactttccgct pfkB-2 gagcatagtcggagaaacgcgttgccgaca pfkB-3 tctgcaaaattttaaataaagctccaataa gnd-1 gtatacttatttgcgaacattccaggccgc gnd-2 aagatatttggcaaaaaaaagcccggtgca gnd-3 ataagctatttatactttaataagtacttt lpxM-1 agttcaacagatttcgaatattctgaagca lpxM-2 ccggtacgcagtcagtaccggcttttttta lpxM-3 aacgccacatccggcctacagttcaatgat

[0077] Example 1. Construction of Escherichia coli strain XY00-10

[0078] The preparation method of the relevant strains is obtained according to the following steps (1)-(2):

[0079] (1) Starting from Escherichia coli MG1655, the promoter of the gene tktA encoding transketolase I in the strain was replaced with the P119 promoter to obtain the XY00 strain.

[0080] The specific steps are as follows:

[0081] (1-a) Preparation of targeting fragment XY-0

[0082] A gene-synthesized DNA fragment (GenScript) was prepared as follows: from 5' to 3', it consisted of: tktAup, LBL (from 5' to 3', it consisted of lox66, the Kan resistance gene, and lox71), and tktAdown. PCR amplification was performed using primers tktA-1 / tktA-2 and the gene-synthesized DNA fragment as a template to generate the target fragment XY-0.

[0083] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0084] The pKD46 plasmid was transformed into the starting E. coli MG1655 using the calcium chloride method. After overnight culture at 30°C on LB plates containing ampicillin, colonies were selected to obtain recombinant E. coli MG1655 / pKD46 containing the plasmid pKD46. After induction with arabinose, MG1655 / pKD46 expressed the three recombinant proteins of phage λ, conferring homologous recombination capability. Competent MG1655 / pKD46 cells were then prepared by washing with 10% glycerol.

[0085] (1-c) Homologous recombination

[0086] The target fragment XY-0 prepared in (1-a) was electroporated into the MG1655 / pKD46 competent cells prepared in (1-b) and incubated overnight at 37°C on LB plates containing kanamycin (50 µg / ml). Genomic DNA was extracted from selected clones and amplified using PCR with primers tktA-3 / Kan-R. A positive clone was identified by amplifying a target band of approximately 1000 bp. Sequencing analysis confirmed that the target sequence on the genome of XY00-kan was correct, and the promoter region of the tktA gene had been replaced with the P119 promoter. XY00-kan was cultured overnight at 42°C to eliminate the temperature-sensitive plasmid pKD46.

[0087] (1-d) Elimination of resistance

[0088] The pSCre plasmid was transformed into the XY00-kan strain, which had been depleted of pKD46, using the calcium chloride method. The strain was cultured overnight at 30°C on LB plates containing 50 mg / L streptomycin and 0.2% L-arabinose. The kanamycin resistance fragment was eliminated using the Cre recombinase on the pSCre plasmid. The temperature-sensitive plasmid pSCre was eliminated by culturing overnight at 42°C. The resulting strain was named XY00.

[0089] (2) Obtaining strains XY01, XY02, XY03, XY04, XY05, XY06, XY07, XY08, XY09, XY10, and XY11

[0090] Using the same method as in Example 1 (1), starting from strain XY00, strains XY01, XY02, XY03, XY04, XY05, XY06, XY07, XY08, XY09, and XY10 were obtained in sequence. Starting from strain MG1655, strain XY11 was obtained. The difference between the construction process of each strain and that of Example 1 (1) was that different starting strains, different target fragments, and different primers were used. The starting strains, target fragments (the specific sequences of the sequence fragments are shown in Table 1), primers, modified targets, and obtained strain information used in each step are shown in Table 3.

[0091] Table 3. XY00-XY11 construction process

[0092] Step number Starting strain Target practice clip name The targeting fragment contains the sequence fragment (5'-3') Modified targets Amplification primers Identification primers Obtain strains 1 MG1655 XY-0 tktAup, LKL, P119, tktAdown Replace the promoter of the transketolase I (tktA) gene with the P119 promoter tktA-1 / tktA-2 tktA-3 / KanR XY00 2 XY00 XY-1 tktBup、LKL、P119、tktBdown Replace the promoter of the transketolase II (tktB) gene with the P119 promoter tktB-1 / tktB-2 tktB-3 / KanR XY01 4 XY01 XY-2 edaup、LKL、P119、edadown Replace the promoter of the KHG / KDPG aldolase (eda) gene with the P119 promoter eda-1 / eda-2 eda-3 / KanR XY02 5 XY02 XY-3 eddup, LKL, P119, edddown Replace the promoter of the phosphogluconate dehydratase (edd) gene with the P119 promoter edd-1 / edd-2 edd-3 / KanR XY03 6 XY03 XY-4 ppsAup, LKL, P119, ppsAdown Replace the promoter of the phosphoenolpyruvate synthase (ppsA) gene with the P119 promoter ppsA-1 / ppsA-2 ppsA-3 / KanR XY04 7 XY04 XY-5 sthAup, LKL, P119, sthAdown The promoter of the soluble pyridine nucleotide transhydrogenase (sthA) gene was replaced with the P119 promoter. sthA-1 / sthA-2 sthA-3 / KanR XY05 8 XY05 XY-6 pntABup, LKL, Ptrc, cscB, RBS, cscA, TrrnB, pntABdown The pyridine nucleotide transhydrogenase A subunit (pntA) and pyridine nucleotide transhydrogenase B subunit (pntB) genes were knocked out and replaced with the expression cassettes of sucrose permease (cscB) and sucrose hydrolase (cscA). pntAB-1 / pntAB-2 pntAB-3 / KanR XY06 9 XY06 XY-7 lpxMup, LKL, lpxMdown Knockout of the myristoyltransferase gene (lpxM) lpxM-1 / lpxM-2 lpxM-3 / KanR XY07 9 XY07 XY-8 pfkAup, LKL, Ptrc, LzxpdH, RBS, BsaraL, TrrnB, pfkAdown The 6-phosphofructokinase 1 (pfkA) gene was knocked out and replaced with the expression cassettes of xylitol-5-phosphate dehydrogenase (LzxpdH) and xylitol-5-phosphate phosphatase (BsaraL). pfkA-1 / pfkA-2 pfkA-3 / KanR XY08 10 XY08 XY-9 pfkBup, LKL, Ptrc, LzxpdH, RBS, BsaraL, TrrnB, pfkBdown The 6-phosphofructokinase 2 (pfkB) gene was knocked out and replaced with the expression cassettes of xylitol-5-phosphate dehydrogenase (LzxpdH) and xylitol-5-phosphate phosphatase (BsaraL). pfkB-1 / pfkB-2 pfkB-3 / KanR XY09 11 XY09 XY-10 gndup, LKL, Ptrc, LzxpdH, RBS, BsaraL, TrrnB, gnddown The 6-phosphogluconate dehydrogenase (gnd) gene was knocked out and replaced with the expression cassettes of xylitol-5-phosphate dehydrogenase (LzxpdH) and xylitol-5-phosphate phosphatase (BsaraL). gnd-1 / gnd-2 gnd-3 / KanR XY10 12 MG1655 XY-8 pfkAup, LKL, Ptrc, LzxpdH, RBS, BsaraL, TrrnB, pfkAdown The 6-phosphofructokinase 1 (pfkA) gene was knocked out and replaced with the expression cassettes of xylitol-5-phosphate dehydrogenase (LzxpdH) and xylitol-5-phosphate phosphatase (BsaraL). pfkA-1 / pfkA-2 pfkA-3 / KanR XY011

[0093] The recombinant bacterium XY10 was deposited on July 16, 2025 at the General Microbiology Center of China Culture Collection Administration (CGMCC), located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit number is CGMCC No. 35136, and the classification name is Escherichia coli.

[0094] Example 2: Production of xylitol using recombinant Escherichia coli XY10

[0095] The test bacteria were: recombinant Escherichia coli XY08, XY09, XY10; the control bacteria were: MG1655, XY07, XY11.

[0096] The components and final concentrations of the conversion glucose medium used are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, glucose: 10% (g / 100 mL).

[0097] The components and final concentrations of the transformation sucrose medium used are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, sucrose: 10% (g / 100 mL).

[0098] (1) Inoculate the recombinant bacteria XY08, XY09, XY10, MG1655, XY07, and XY11 grown overnight into a shake flask containing 200 ml of LB medium at a 1% inoculum size. Cultivate at 37°C for 3-4 h until the OD600nm reaches 0.6-0.8. Then add arabinose at a final concentration of 0.2 g / L. Continue culturing at 37°C for 12 h. Centrifuge at 8000 rpm for 10 min to collect the bacteria.

[0099] (2) The collected cells were resuspended in a shake flask containing 10 mL of glucose conversion medium and incubated at 200 rpm and 37°C for 24 h. The supernatant was centrifuged and filtered. The xylitol content was determined by HPLC. The yield was converted to xylitol per liter in the shake flask (g / L). HPLC was performed using a Bio-Rad Aminex HPX-87H column (300 mm × 7.8 mm, 9 μm); the mobile phase was aqueous solution at a flow rate of 0.6 mL / min; and the column temperature was 80°C. Xylitol standards were purchased from Shanghai Yuanye Biotechnology (Cat. No. B20885). The retention time of the xylitol standard was 20 min.

[0100] The results showed that the xylitol production of the control strains MG1655 and XY07 was zero, and that of the control strain XY11 was 0.67±0.03 g / L. In contrast, the xylitol production of strains XY08, XY09, and XY10 was 45.38±3.41, 65.44±5.25, and 75.81±6.09 g / L, respectively. The constructed strains were able to efficiently utilize glucose to synthesize xylitol.

[0101] (3) The cells collected in Example 2 (1) were resuspended in shake flasks containing 10 mL of conversion sucrose medium. The cells were transformed at 200 rpm and 37°C for 24 h. The supernatant was collected by centrifugation and filtered. The xylitol content was determined using the HPLC method described in Example 2 (2).

[0102] The results showed that the xylitol production of the control strains MG1655 and XY07 was zero, and that of the control strain XY11 was 0.56±0.02 g / L. In contrast, the xylitol production of strains XY08, XY09, and XY10 was 40.38±3.88, 56.28±6.12, and 67.86±6.30 g / L, respectively. The constructed strains were able to efficiently utilize sucrose to synthesize xylitol.

[0103] The production characteristics of related strains are shown in Table 6.

[0104] Table 6 Comparison of yield of each strain

[0105]

Claims

1. A recombinant Escherichia coli comprising the following modifications: (12) Introduction of xylitol 5-phosphate dehydrogenase gene (LzxpdH); (13) Introducing the xylitol 5-phosphate phosphatase gene (BsaraL).

2. The recombinant Escherichia coli according to claim 1, wherein the introduced xylitol 5-phosphate dehydrogenase gene (LzxpdH) is derived from Lactobacillus zeae; and the xylitol 5-phosphate phosphatase gene (BsaraL) is derived from Bacillus subtilis.

3. The recombinant Escherichia coli according to claim 1-2, further comprising the following modifications: (1) Knockout of the gene encoding 6-phosphofructokinase 1 (pfkA); (2) Knockout of the gene encoding 6-phosphofructokinase 2 (pfkB); (3) Knockout of the gene encoding 6-phosphogluconate dehydrogenase (gnd); (4) Knockout of the gene encoding pyridine nucleotide transhydrogenase A subunit (pntA); (5) Knockout of the gene encoding pyridine nucleotide transhydrogenase B subunit (pntB); (6) Enhance the expression of KHG / KDPG aldolase gene (eda); (7) Enhance the expression of phosphogluconate dehydratase gene (edd); (8) Enhance the expression of phosphoenolpyruvate synthase gene (ppsA); (9) Enhance the expression of transketolase I gene (tktA); (10) Enhance the expression of transketolase II gene (tktB); (11) Enhance the expression of soluble pyridine nucleotide transhydrogenase gene (sthA); (14) Introduction of sucrose permease gene (cscB); (15) Introduction of sucrose hydrolase gene (cscA); (16) Knockout of the gene encoding myristoyltransferase (lpxM).

4. The recombinant Escherichia coli according to claims 1-3, wherein the recombinant Escherichia coli is characterized in that the Escherichia coli strain is XY10, and its preservation number is CGMCC NO.35136.

5. A method for constructing a recombinant Escherichia coli with improved xylitol production, comprising the following steps: performing the transformation according to the transformation (1) to (16) in claims 1-4.

6. A method for producing or increasing the yield of xylitol, comprising the following steps: culturing the recombinant Escherichia coli according to claims 1 to 4 using glucose and / or sucrose as carbon sources, collecting the culture, and obtaining xylitol.

7. Use of the recombinant Escherichia coli according to claims 1 to 4 in producing or increasing the yield of xylitol.

8. A product for producing or increasing the yield of xylitol, wherein the active ingredient is the recombinant Escherichia coli according to claims 1-4.

Images