A glycosyltransferase mutant and its application in synthesis of rebaudioside m
By directing the evolution of glycosyltransferases and constructing recombinant strains, the problems of low activity and poor stability of wild-type glycosyltransferases were solved, achieving efficient catalytic synthesis of rebaudioside M and reducing production costs and time.
Patent Information
- Application Number
- CN202511284709.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-09-10
AI Technical Summary
In existing technologies, wild-type glycosyltransferases have low enzyme activity and poor stability, resulting in high industrial-scale production costs for steviol glycosides. Furthermore, the synthesis cost of rebaudioside M is too high, making large-scale production difficult.
Wild-type glycosyltransferases were modified using directed evolution theory to obtain glycosyltransferase mutants. Recombinant strains were constructed and retinoic acid M was synthesized in a one-pot process. The co-expression of the glycosyltransferase mutant and sucrose synthase gene from the recombinant strain improved catalytic efficiency and stability.
It significantly improved the yield and conversion rate of rebaudioside M, increased the catalytic efficiency by 18 times, achieved a yield of 130 g/L and a conversion rate of 97.5%, and greatly shortened the synthesis time.
Smart Images

Figure CN120758477B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a glycosyltransferase mutant and its application in the synthesis of rebaudioside M. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Steviol glycosides are sweeteners extracted from stevia (Steviarebaudiana Bertoni). They have advantages such as high sweetness (e.g., 250 to 450 times sweeter than sucrose), low calories (e.g., only 1 / 300 the calories of white sugar), economical use (only one-third the price of sucrose), stability (heat-resistant, acid-resistant, alkali-resistant, and not easily decomposed), safety (no toxic side effects), and non-participation in lipid metabolism in the human body. They also have antihypertensive, anti-inflammatory, and anti-tumor effects. Therefore, they have a wide range of uses and high commercial value.
[0004] Steviosides share a common steviol unit. By adding different numbers and types of sugar groups at the C-13 and C-19 positions of this steviol unit, various steviol glycosides with different flavors and physicochemical properties are formed. Because steviol glycosides and rebaudioside A have a bitter aftertaste, rebaudioside D and rebaudioside M are considered more ideal sweeteners. However, based on sweetness and mouthfeel, rebaudioside M is superior to rebaudioside D and rebaudioside A.
[0005] Because rebaudioside M is present in extremely low amounts in plants, it cannot be extracted using plant extraction methods. Furthermore, chemical synthesis methods are complex, energy-intensive, and environmentally harmful, hindering large-scale production. Bioconversion of steviol glycosides is currently the most economical and effective way to achieve industrial-scale production. Bioconversion methods include enzyme-catalyzed synthesis; however, most publicly available enzyme-catalyzed synthesis methods use rebaudioside D as a substrate, but the content of rebaudioside D in stevia leaves is very low, resulting in excessively high costs. Rebaudioside A, on the other hand, is the most abundant steviol glycoside in commercial stevia leaves. Therefore, using rebaudioside A as a raw material for enzyme-catalyzed synthesis of rebaudioside M could significantly reduce production costs. In addition, the enzymes currently used for enzyme-catalyzed synthesis of steviol glycosides are mainly wild-type enzymes derived from plant cells; these wild-type enzymes typically have low enzyme activity and poor stability, leading to high costs for industrial-scale production of steviol glycosides. Therefore, it is necessary to improve glucosyltransferases to obtain modified enzymes with higher enzyme activity and better stability, so as to better serve industrial-scale production. Summary of the Invention
[0006] To overcome the above problems, the present invention provides a glycosyltransferase mutant and its application in the synthesis of rebaudioside M.
[0007] To achieve the above technical objectives, the present invention adopts the following technical solution:
[0008] In a first aspect, the present invention provides a glycosyltransferase mutant obtained by mutating aspartic acid at position 66 to glutamic acid, asparagine at position 134 to serine, cysteine at position 167 to isoleucine, isoleucine at position 216 to valine, and asparagine at position 316 to glycine in the wild-type glycosyltransferase shown in SEQ ID NO. 2.
[0009] A second aspect of the invention provides a gene encoding a glycosyltransferase mutant as described in the first aspect.
[0010] A third aspect of the invention provides an expression cassette comprising the gene described in the second aspect.
[0011] A fourth aspect of the present invention provides a recombinant expression vector comprising the gene described in the second aspect.
[0012] A fifth aspect of the present invention provides a recombinant bacterium comprising the genes described in the second aspect.
[0013] A sixth aspect of the present invention provides a transgenic cell line comprising the genes described in the second aspect.
[0014] A seventh aspect of the present invention provides the use of the glycosyltransferase mutant described in the first aspect, the gene described in the second aspect, or the recombinant bacteria described in the fifth aspect in the catalytic synthesis of rebaudioside D and rebaudioside M.
[0015] An eighth aspect of the present invention provides a method for the catalytic synthesis of rebaudioside D, comprising the following steps:
[0016] Using the wet bacterial cells obtained by induced culture of the recombinant bacteria described in the fifth aspect, or the crude enzyme solution extracted from the broken wet bacterial cells, as a catalyst, and using rebaudioside A and uridine diphosphate glucose (UDP-glucose) as substrates, rebaudioside D is synthesized.
[0017] In one or more embodiments, the reaction conditions include: the reaction solution is a phosphate buffer solution with a pH of 7-8, preferably with a pH of 7.5; the reaction temperature is 35-45 °C, preferably 40 °C; and the reaction speed is 400-600 rpm, preferably 500 rpm.
[0018] In one or more embodiments, the amount of catalyst used is 5-45 g / L based on the total weight of wet bacterial cells; the final concentration of rebaudioside A is 80-120 g / L; and the final concentration of UDP-glucose is 50-70 g / L.
[0019] A ninth aspect of the present invention provides a method for the catalytic synthesis of rebaudioside M, comprising the following steps:
[0020] (1) The recombinant expression vector containing the gene described in the second aspect, the recombinant expression vector containing the second glycosyltransferase gene, and the recombinant expression vector containing the sucrose synthase gene are jointly transferred into the introduced host bacteria to obtain recombinant bacteria; the amino acid sequence of the second glycosyltransferase gene is shown in SEQ ID NO.8, and the amino acid sequence of the sucrose synthase gene is shown in SEQ ID NO.10.
[0021] (2) Using the wet bacterial cells obtained by induction culture of the recombinant bacteria constructed in step (1) or the crude enzyme solution extracted by breaking the wet bacterial cells as a catalyst, and using rebaudioside A as a substrate and sucrose as a co-substrate, rebaudioside M is synthesized by reaction.
[0022] In one or more embodiments, the reaction conditions include: the reaction solution is a phosphate buffer solution with a pH of 7-8, preferably with a pH of 7.5; the reaction temperature is 35-45 °C, preferably 40 °C; and the reaction speed is 200-500 rpm, preferably 300 rpm.
[0023] In one or more embodiments, the amount of catalyst used is 5-60 g / L based on the total weight of wet bacterial cells; the final concentration of rebaudioside A is 50-120 g / L; and the final concentration of sucrose is 50-150 g / L.
[0024] The beneficial effects of this invention are as follows:
[0025] (1) In this invention, wild-type glycosyltransferase was modified by directed evolution theory to obtain glycosyltransferase mutant, which effectively improved the efficiency of the reaction to synthesize rebaudidine D using rebaudidine A and UDP-glucose as substrates. Specifically, the catalytic efficiency of the glycosyltransferase mutant was increased by 18 times.
[0026] (2) In this invention, a recombinant bacterium simultaneously expressing a glycosyltransferase mutant, a second glycosyltransferase gene, and a sucrose synthase gene was constructed. Using wet bacterial cells obtained through induced culture of the recombinant bacteria or crude enzyme solution extracted from broken wet bacterial cells as a catalyst, and rebaudioside A as the substrate and sucrose as the co-substrate, a one-pot catalytic synthesis of rebaudioside M was achieved. The glycosyltransferase mutant catalyzes the synthesis of rebaudioside D from rebaudioside A, and the second glycosyltransferase gene catalyzes the synthesis of rebaudioside M from rebaudioside D. The sucrose synthase constructs a sucrose synthase-UDP glucose coenzyme cycle system, providing glucose glycosyl groups for the synthesis of rebaudioside D from rebaudioside A and the synthesis of rebaudioside M from rebaudioside D. Complete catalysis of the production of rebaudioside M from 100 g / L rebaudioside A takes only 24 h, with a conversion rate of 97.5% and a rebaudioside M yield of 130 g / L, effectively improving the raw material conversion rate and the yield of rebaudioside M while shortening the synthesis time. Attached Figure Description
[0027] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0028] Picture 1 A flowchart illustrating the reaction process of rebaudioside RA synthesized into rebaudioside RM catalyzed by the co-expression strain. Detailed Implementation
[0029] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0030] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0031] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0032] The culture medium formulations and high-performance liquid chromatography (HPLC) detection methods used in the following examples are as follows:
[0033] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, water as solvent, pH 7.4.
[0034] LB plates: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 18 g / L agar, water as solvent, pH 7.4.
[0035] The concentration of product rebaudioside M was determined by high performance liquid chromatography (HPLC). The analytical method was as follows: column type: QS-C18, 5μm, 4.6×250 mm; mobile phase: A (water):B (acetonitrile) = 68:32; injection volume: 10 μL; detection wavelength: 210 nm; detection time: 18 min; flow rate: 0.5 mL / min; column temperature: 40 ℃.
[0036] Example 1
[0037] The glycosyltransferase derived from Solanum tuberosum (potato) was extracted from the NCBI database (NCBI accession number NP_001274852.1), with the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.2. The entire genome was then synthesized by Nanjing Genscript Biotech Co., Ltd.
[0038] Primers F1, R1, F2, and R2 were designed based on the nucleotide sequence shown in SEQ ID NO.1 and the pET-28a vector sequence; the nucleotide sequence of F1 is shown in SEQ ID NO.3, the nucleotide sequence of R1 is shown in SEQ ID NO.4, the nucleotide sequence of F2 is shown in SEQ ID NO.5, and the nucleotide sequence of R2 is shown in SEQ ID NO.6.
[0039] F1 (SEQ ID NO.3):
[0040] ctttaagaaggagatataccATGAATACACATAAAGCTCACTGTCTAATAC;
[0041] R1 (SEQ ID NO.4):
[0042] tggtggtggtggtgctcgagTTACTTCGGAGAGATGGTGACCA;
[0043] F2 (SEQ ID NO.5): CTCGAGCACCACCACCACC;
[0044] R2 (SEQ ID NO.6): GGTATATCTCCTTCTTAAAGTTAAACAAAAT;
[0045] Using pET-28a plasmid as an expression vector, Escherichia coli was constructed E. coli BL21(DE3) / pET-28a-StUGT.
[0046] Construction of expression plasmid: Under the initiation of primers F1 / R1 and F2 / R2, the nucleotide sequence shown in SEQ ID NO.1 was used as a template and amplified with high-fidelity Pfu DNA polymerase to obtain the glycosyltransferase gene sequence with homologous arms. Using pET-28a plasmid as a template, it was amplified with high-fidelity Pfu DNA polymerase to obtain the linearized vector sequence. The target gene was then homologously recombinated with the linearized vector using homologous recombination enzyme to construct plasmid pET-28a-StUGT.
[0047] Preparation of competent cells: Glycerol tubes were obtained from a -80 °C freezer and stored in a glycerol tube. E. coli Strawberry strain BL21(DE3) was streaked onto antibiotic-free LB agar plates and incubated at 37 °C for 10 h to obtain single colonies. A single colony from the LB agar plate was picked and inoculated into a test tube containing 5 mL of LB liquid medium, and incubated at 37 °C and 180 rpm for 9 h. 200 μL of the bacterial culture from the test tube was then inoculated into 50 mL of LB liquid medium and incubated at 37 °C and 180 rpm for OD... 600 Adjust the concentration to 0.4-0.6; pre-cool the bacterial culture on ice, transfer the culture to a sterile centrifuge tube, place on ice for 10 min, centrifuge at 4 ℃ and 5000 rpm for 10 min; discard the supernatant, taking care to prevent contamination, resuspend the precipitated cells in pre-cooled 0.1 mol / L CaCl2 aqueous solution, and place on ice for 30 min; centrifuge at 4 ℃ and 5000 rpm for 10 min, discard the supernatant, resuspend the precipitated cells in pre-cooled 0.1 mol / L CaCl2 aqueous solution containing 15% (v / v) glycerol, aliquot 100 μL of the resuspended cells into sterile 1.5 mL centrifuge tubes, and store at -80 ℃. Remove as needed.
[0048] Construction of recombinant *E. coli*: First, competent *E. coli* cells stored at -80 °C were incubated at 0 °C on ice for 10 min. Then, 5 µL of the ligation product was added in a clean bench, incubated at 0 °C on ice for 30 min, heat-shocked in a 42 °C water bath for 90 s, and incubated at 0 °C on ice for 2 min. 600 µL of LB medium was added, and the cells were cultured at 37 °C and 200 rpm for 1 h. The cultured cells were then plated on LB agar plates containing 50 μg / mL kanamycin and cultured at 37 °C for 8–12 h. Clones were randomly picked, plasmids were extracted, and sequenced for identification. Recombinant *E. coli* cells containing the recombinant plasmid expression were screened for identification. E. coli BL21(DE3) / pET-28a-StUGT.
[0049] Example 2: Induced expression of glycosyltransferase
[0050] The recombinant Escherichia coli obtained in Example 1 were respectively... E. coli BL21(DE3) / pET-28a-StUGT was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37 ℃ and 200 rpm for 12 h. Then, it was inoculated at a 1% (v / v) inoculation rate into fresh LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37 ℃ and 200 rpm until the bacterial OD reached the target cell count. 600 When the concentration reached 0.6–0.8, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.1 mM. After induction culture at 25 °C for 16 h, the mixture was centrifuged at 4 °C and 8000 rpm for 20 min. The supernatant was discarded, and the precipitate was collected to obtain recombinant strains containing glycosyltransferase and sucrose synthase, respectively. E. coli Wet cells of BL21(DE3) / pET-28a-StUGT were obtained. The wet cells were resuspended in 100 mM phosphate buffer (pH 7.5) and sonicated on an ice-water mixture for 5 min. The sonication conditions were: 200 W power, 1 s sonication, 2 s pause, to obtain crude enzyme solution.
[0051] Example 3: Establishment of a glycosyltransferase gene mutant library
[0052] (1) Site-directed mutagenesis: The material constructed in Example 1 E. coli The BL21(DE3) / pET-28a-StUGT strain was used as the starting strain. It was modified using the theory of directed evolution. Site-directed mutagenesis was performed at the R33G / F44V / D66E / D67G / F82L / N134S / C167I / I205C / I216V / H242E / I268K / N316G / T324K / I371G / S454E sites. The primer designs are shown in Tables 1 and 2.
[0053] The mutant PCR system (100 μL) consisted of: 25 μL 2×PhantaMax buffer, 1 μL dNTPs, 1 μL each of the upstream and downstream mutant primers, 1 μL template (starting strain), 0.5 μL Pfu DNA polymerase, and ddH2O added to a final volume of 50 μL. The PCR conditions were: 95℃ pre-denaturation for 3 min, followed by 30 cycles: 95℃ for 15 s, 60℃ for 15 s, 72℃ for 7 min 20 s, and a final extension at 72℃ for 10 min. PCR results were verified by DNA agarose gel electrophoresis. The PCR product was digested with DpnI enzyme, inactivated at 37℃ for 1 h, 200 rpm, and 65℃ for 1 min. The PCR product was then transformed by heat shock into *E. coli*. E. coli BL21(DE3) was activated, incubated at 37 ℃ and 200 rpm for 1 h, spread on LB plates containing 50 μg / mL kanamycin resistance, and incubated upside down at 37 ℃ overnight.
[0054] Table 1. Primer design for site-directed mutagenesis of glycosyltransferases
[0055]
[0056] Table 2. Primer design for site-directed mutagenesis of glycosyltransferases
[0057]
[0058] Example 4 Screening of Glycosyltransferase Gene Mutant Library
[0059] Single colonies were picked from the plates obtained in Example 3 and inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance. The culture was incubated at 37 °C and 200 rpm for 12 h. The culture was preserved and sent to a sequencing company for sequencing verification. After successful sequencing verification, the preserved culture was inoculated at a rate of 0.2% (v / v) into LB liquid medium containing 50 μg / mL kanamycin resistance and incubated at 37 °C and 200 rpm for 12 h. Then, at a rate of 1% (v / v), it was inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance and incubated at 37 °C and 200 rpm until the bacterial OD reached the target cell count. 600The concentration of the glycosyltransferase gene mutant library was increased to 0.6-0.8. IPTG was added to a final concentration of 0.1 mM, and the cells were induced and cultured at 25 °C for 16 h. After centrifugation at 4 °C and 8000 rpm for 20 min, the supernatant was discarded, and the precipitate was collected to obtain the wet cells of the glycosyltransferase gene mutant library. The wet cells were resuspended in 100 mM phosphate buffer (pH 7.5) and sonicated on an ice-water mixture for 5 min. The sonication conditions were: 200 W power, 1 s of sonication followed by a 2 s pause, to obtain the crude StUGT enzyme solution.
[0060] (1) StUGT initial screening: Preparation of reaction solution (200 μL): The final concentration of substrate rebaudioside A was 50 g / L, the final concentration of UDP-glucose was 30 g / L, the amount of catalyst was 10 g / L based on the total weight of wet cells before lysis, and the reaction medium was phosphate buffer at pH 7.5. Reaction conditions: After reacting for 3 h in a reactor at 40 ℃ and 500 rpm, 20 μL of the reaction-completed sample was taken, diluted 10 times, and 16 μL of 2 M H2SO4 solution and 160 μL of 60% (volume fraction) methanol solution were added to terminate the reaction. The sample was filtered through a 0.22 μm filter membrane and analyzed by HPLC. The results are shown in Table 3.
[0061] Table 3 Initial screening reaction results
[0062]
[0063] (2) StUGT secondary screening: The strains obtained from the initial screening were secondary screened, and the combined mutants were sent to a sequencing company for sequencing verification. After the sequencing verification was correct, the viability was verified. The secondary screening reaction solution (5 mL) was prepared as follows: the final concentration of substrate rebaudioside A was 100 g / L, the final concentration of UDP-glucose was 60 g / L, the amount of catalyst was 10 g / L based on the total weight of wet cells before lysis, and the reaction medium was phosphate buffer at pH 7.5. Reaction conditions: After reacting for 2 h in a reactor at 40 ℃ and 500 rpm, 20 μL of the sample after the reaction was completed was taken, diluted 20 times, and 16 μL of 2M H2SO4 solution and 160 μL of 60% (volume fraction) methanol solution were added to terminate the reaction. The sample was filtered through a 0.22 μm filter membrane and detected by HPLC. The detection results are shown in Table 4. The strain with the highest viability was obtained. E. coli BL21(DE3) / Pet-28a-StUGT-D66E-N134S-C167I-I216V-N316G.
[0064] Table 4 Results of the secondary screening reaction
[0065]
[0066] Example 5: Construction of co-expression strains - one-pot catalytic synthesis of rebaudioside M
[0067] A co-expression strain was constructed, and rebaudioside A was used as a substrate to catalyze the one-pot synthesis of rebaudioside M under the action of the co-expression strain.
[0068] (1) Construction of expression vector and engineered bacteria:
[0069] Gene Acquisition: Through gene library mining, a diglycosyltransferase derived from Stevia rebaudiana (SrUGT, catalyzing the synthesis of rebaudioside M from rebaudioside D) was screened (accession number ACM47734.1). A high-activity strain, SrUGT-L85G-S136K-R140P-L175D-A239V-Y422E, was obtained through directed evolution. The nucleotide sequence of the SrUGT mutant is shown in SEQ ID NO.7, and the amino acid sequence is shown in SEQ ID NO.8. A sucrose synthase derived from Methylocaldum szegediense (NCBI accession number WP_317963626.1) was also identified. A high-activity strain, MsSUS-G61D-V112A-T225R-F324R-Q459K-T549P-T733C, was obtained through directed evolution. The nucleotide sequence of the MsSUS mutant is shown in SEQ ID NO.7. As shown in NO.9, the amino acid sequence is shown in SEQ ID NO.10.
[0070] Plasmid construction: To achieve the highest catalytic efficiency of the co-expression strains, multiple co-expression strains were constructed. Specific plasmid combinations are shown in Table 5. All expression plasmids were constructed using homologous recombination; primers are shown in Table 6.
[0071] Combination 1 plasmid construction: Under the initiation of primers 11 and 12, the target gene MsSUS mutant was amplified using high-fidelity Pfu DNA polymerase to obtain the NmXI target gene sequence containing the homologous arm of the first multiple cloning site (NcoI-NotI) of PACduet. Simultaneously, under the initiation of primers 13 and 14, the plasmid vector PACduet was amplified using high-fidelity Pfu DNA polymerase to obtain the linearized vector sequence of the first multiple cloning site of PACduet. Homologous recombination was then performed between the target gene and the linearized vector using homologous recombination enzyme to construct the recombinant plasmid PACduet-MsSUS mutant, which was then sequenced for verification.
[0072] Initiated by primers 15 and 16, the MsSUS mutant target gene was amplified using high-fidelity Pfu DNA polymerase as a template to obtain the MsSUS mutant target gene sequence containing the homologous arm of the second multiple cloning site (NdeI-XhoI) of PACduet. Initiated by primers 17 and 18, the plasmid vector PACduet-MsSUS mutant was amplified using high-fidelity Pfu DNA polymerase to obtain the linearized vector sequence of the second multiple cloning site of PACduet. Homologous recombination was then performed between the target gene and the linearized vector using homologous recombination enzyme to construct the recombinant plasmid PACduet-MsSUS mutant-MsSUS mutant, which was then sequenced for verification.
[0073] Initiated by primers 19 and 20, the StUGT mutant target gene was amplified using high-fidelity Pfu DNA polymerase to obtain the StUGT mutant target gene sequence containing the homologous arm of the first multiple cloning site (NcoI-NotI) of pETduet. Simultaneously, initiated by primers 21 and 22, the pETduet plasmid vector was amplified using high-fidelity Pfu DNA polymerase to obtain the linearized vector sequence of the first cloning site of pETduet. Homologous recombination was then performed between the target gene and the linearized vector using homologous recombination enzyme to construct the recombinant plasmid pETduet-StUGT mutant, which was then sequenced for verification. Sequencing yielded the plasmid pETduet-StUGT mutant, which was verified to be correct. Using primers 23 and 24 as a template, the target gene was amplified with high-fidelity Pfu DNA polymerase to obtain the SrUGT mutant target gene sequence containing the homologous arm of the second multiple cloning site (NdeI-XhoI) of pETduet. Simultaneously, using primers 25 and 26 as a template, the plasmid vector pETduet-StUGT mutant was amplified with high-fidelity Pfu DNA polymerase to obtain the linearized vector sequence containing the second multiple cloning site of pETduet containing the SrUGT mutant. Homologous recombination was then performed between the target gene and the linearized vector using homologous recombination enzyme to construct the recombinant plasmid pETduet-StUGT mutant-SrUGT mutant, which was then verified by sequencing.
[0074] Construction of plasmids 2-3: Refer to the construction method of plasmid 1, and the primers are shown in Table 6.
[0075] Table 5 Recombinant plasmid construction combination table
[0076]
[0077] Table 6 Primer Design
[0078]
[0079] Construction of recombinant co-expression strains: First, the strains stored at -80 ℃... E. coli BL21(DE3) competent cells were incubated on ice at 0°C for 10 min, then 5 µL of recombinant plasmid was added in a clean bench, incubated on ice at 0°C for 30 min, heat-shocked in a water bath at 42°C for 90 s, incubated on ice at 0°C for 2 min, and then 600 µL of LB liquid medium was added. The cells were cultured at 37°C and 200 rpm for 1 h. The cells were then plated on LB plates containing the corresponding antibiotics (Table 7) and cultured at 37°C for 8–12 h. Clones were randomly selected, plasmids were extracted, and sequenced for identification. Recombinant E. coli BL21(DE3)-recombinant plasmid combinations 1, 2, and 3 containing the recombinant plasmid expression were obtained.
[0080] Table 7 Resistance of different co-expressed strains
[0081]
[0082] Screening of co-expression strains: The total wet cell weight of the three co-expression strains before high-pressure homogenization was 50 g / L, the final concentration of rebaudioside A was 100 g / L, and the final concentration of sucrose was 160 g / L. The total volume of the reaction solution was 10 mL using phosphate buffer (pH 7.5) as the reaction medium. Reaction conditions: 40 ℃, 500 rpm for 12 h. After the reaction, 20 μL of the final sample was taken, diluted 20 times, and 16 μL of 2M H2SO4 solution and 160 μL of 60% (v / v) methanol solution were added to terminate the reaction. The solution was filtered through a 0.22 μm filter and analyzed by HPLC. Rebaudioside M was detected after the reaction. The results are shown in Table 8. Considering all factors, strain No. 2 was finally selected for co-expression.
[0083] Table 8 Catalytic results of different co-expression strains
[0084]
[0085] Example 6 Application of co-expressed strains in the catalytic synthesis of rebaudioside M
[0086] The co-expression strain E. coli BL21(DE3) / pACduet-MsSUS-G61D-V112A-T225R-F324R-Q459K-T549P-T733C (first multiple cloning site)-MsSUS-G61D-V112A-T225R-F324R-Q459K-T549P-T733C (second multiple cloning site)+pETduet-SrUGT-L85G-S136K-R140P-L175D-A239V-Y422E (first multiple cloning site)-StUGT-D66E-N134S-C167I-I216V-N316G (second multiple cloning site) obtained in Example 5 was inoculated into a solution containing a final concentration of 25 μg / mL ampicillin and 25 μg / mL ampicillin. The culture was incubated in LB liquid medium containing μg / mL chloramphenicol at 37°C for 9 h to obtain a seed culture. This seed culture was then inoculated into a 5 L fermenter containing 3 L of fermentation medium at a volume concentration of 3.5%. After incubation at 37°C and 500 rpm for approximately 3–4 h until the bacterial density (OD) reached 6–8, the fermenter temperature was lowered to 25°C. Lactose at a final concentration of 5 g / L was added as an inducer, and the culture was then incubated at 25°C and 500 rpm for another 12 h. The fermentation broth was centrifuged at 8000 rpm for 10 min to obtain wet cells containing the mutant co-expressing strain. The obtained wet cells were then homogenized using a high-pressure homogenizer.
[0087] The fermenter culture medium consists of: 45 g tryptone, 36 g yeast extract, 30 g sodium chloride, 4.08 g potassium dihydrogen phosphate, 45 g glycerol, 6.84 g dipotassium hydrogen phosphate trihydrate, 15 g ammonium sulfate, 1.125 g magnesium sulfate, and 4 g defoamer, which are dissolved in distilled water to a final volume of 3 L.
[0088] The catalyst dosage was 50 g / L of the total wet bacterial cell weight before high-pressure homogenization, the final concentration of the substrate rebaudioside RA was 100 g / L, and the final concentration of sucrose was 150 g / L. The reaction medium was phosphate buffer (pH 7.5), and the total volume of the reaction solution was 1 L. The reaction conditions were: 40 ℃, 500 rpm for 24 h. After the reaction, 20 μL of the final sample was taken, diluted 20-fold, and 16 μL of 2M H₂SO₄ solution and 160 μL of 60% (v / v) methanol solution were added to terminate the reaction. The solution was filtered through a 0.22 μm filter membrane and analyzed by HPLC. The reaction progress curve is shown below. Picture 1 As shown, after the reaction, the concentration of rebaudioside RM reached 130 g / L, and the conversion rate reached 97.5%.
[0089] Comparative Example: The original co-expression strain *E. coli* BL21(DE3) / pACduet-MsSUS-MsSUS-pETduet-SrUGT-StUGT (where MsSUS, SrUGT, and StUGT are wild-type enzymes, without mutations), catalyst dosage was 50 g / L (total wet cell weight before high-pressure homogenization), substrate rebaudioside RA concentration was 150 g / L, and sucrose concentration was 100 g / L. The reaction medium was phosphate buffer (pH 7.5), with a total reaction volume of 1 L. Reaction conditions: 40 ℃, 500 rpm for 24 h. After the reaction, 20 μL of the final sample was diluted 20-fold, and 16 μL of 2M H₂SO₄ solution and 160 μL of 60% (v / v) methanol solution were added to terminate the reaction. The sample was filtered through a 0.22 μm filter and analyzed by HPLC. The concentration of rebaudioside RM reached 15.2% after the reaction. g / L, with a conversion rate of 11.4%.
[0090] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A glycosyltransferase mutant, characterized in that, It was obtained by mutating aspartic acid at position 66 to glutamic acid, asparagine at position 134 to serine, cysteine at position 167 to isoleucine, isoleucine at position 216 to valine, and asparagine at position 316 to glycine in the wild-type glycosyltransferase shown in SEQ ID NO.
2.
2. The gene encoding the glycosyltransferase mutant of claim 1.
3. An expression box, characterized in that, It contains the gene described in claim 2.
4. A recombinant expression vector, characterized in that, It contains the gene described in claim 2.
5. A recombinant bacterium, characterized in that, It contains the gene described in claim 2.
6. A transgenic cell line, characterized in that, It contains the gene described in claim 2.
7. The use of the glycosyltransferase mutant of claim 1, the gene of claim 2, or the recombinant bacteria of claim 5 in the catalytic synthesis of rebaudioside D and rebaudioside M.
8. A method for the catalytic synthesis of rebaudioside D, characterized in that, Includes the following steps: Using the wet bacterial cells obtained by induced culture of the recombinant bacteria as described in claim 5 or the crude enzyme solution extracted by breaking up the wet bacterial cells as a catalyst, and using rebaudioside A and UDP-glucose as substrates, rebaudioside D was synthesized by reaction. The reaction conditions include: the reaction solution is a phosphate buffer solution with a pH of 7-8; the reaction temperature is 35-45 ℃; and the reaction speed is 400-600 rpm. The amount of catalyst used is 5~45 g / L based on the total weight of wet bacterial cells; the final concentration of rebaudioside A is 80~120 g / L, and the final concentration of UDP-glucose is 50~70 g / L.
Citation Information
Patent Citations
Production of steviol glycosides in recombinant hosts
CN109477128A
Glycosyl transferase mutant and method for catalytically synthesizing rebaudioside M by using glycosyl transferase mutant
CN113462670A