A fusion protein expressing novel duck reovirus σC protein and duck-derived goose parvovirus VP1 protein, a recombinant duck viral enteritis virus, a vaccine, its construction method, and its applications.

Abstract

This invention discloses a fusion protein expressing novel duck reovirus σC protein and duck-derived goose parvovirus VP1 protein, a recombinant duck viral enteritis virus, a vaccine, its construction method, and its applications, belonging to the field of recombinant virus technology. The nucleotide sequence of the fusion protein is shown in positions 300-3568 of SEQ ID NO:1. The fusion protein of this invention can simultaneously express protective antigen proteins of novel duck reovirus (NDRV) and duck-derived goose parvovirus (DGPV). Using CRISPR / Cas9 gene editing technology, the fusion protein is recombined into the US3 gene of duck viral enteritis virus. The resulting recombinant duck viral enteritis virus not only provides protection against virulent duck viral enteritis virus challenge but also provides good protection against NDRV and DGPV, achieving a multi-protection effect with a single injection.

Description

Technical Field

[0001] This invention belongs to the field of recombinant virus technology, and particularly relates to a fusion protein expressing a novel duck reovirus σC protein and duck-derived goose parvovirus VP1 protein, a recombinant duck viral enteritis virus, a vaccine, its construction method, and its application. Background Technology

[0002] Duck viral enteritis, also known as duck plague, is an acute, febrile, septicemic infectious disease of ducks, geese, and various other anseriformes birds caused by duck enteritis virus (DEV). This disease spreads rapidly, with high morbidity and mortality rates, and is one of the most important pathogens seriously threatening the development of the waterfowl industry. DEV belongs to the Herpesviridae family, Marek's virus genus. Due to its large genome and numerous non-essential replication regions, it is a good live viral vector. Novel duck orthoreovirus (NDRV) and duck-derived gooseparvovirus (DGPV) are emerging pathogens in ducks, causing spleen necrosis and short-beaked dwarfism syndrome, severely affecting duck growth and even causing death, thus seriously restricting the development of the waterfowl farming industry. Currently, there are no vaccines available for these two diseases. Therefore, there is an urgent need to develop an efficient, safe, and effective prevention and control technology that can simultaneously combat NDRV and DGPV infections to curb their harm to the poultry farming industry. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to provide a fusion protein that expresses a novel duck reovirus σC protein and a duck-derived goose parvovirus VP1 protein, which can simultaneously express the protective antigen proteins of the novel duck reovirus (NDRV) and the duck-derived goose parvovirus (DGPV).

[0004] Another object of the present invention is to provide the application of the fusion protein in the construction of recombinant duck viral enteritis virus.

[0005] Another object of the present invention is to provide a recombinant duck viral enteritis virus.

[0006] Another object of the present invention is to provide a method for constructing the recombinant duck viral enteritis virus.

[0007] Another object of the present invention is to provide the use of the fusion protein or the recombinant duck viral enteritis virus or the recombinant duck viral enteritis virus constructed by the construction method in the preparation of products for the prevention and / or treatment of diseases caused by viral infection.

[0008] Another object of the present invention is to provide a vaccine.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0010] This invention provides a fusion protein expressing a novel duck reovirus σC protein and a duck-derived goose parvovirus VP1 protein, the nucleotide sequence of which is shown in positions 300-3568 of SEQ ID NO:1.

[0011] The present invention also provides the application of the fusion protein in the construction of recombinant duck viral enteritis virus.

[0012] The present invention also provides a recombinant duck viral enteritis virus, wherein an expression cassette containing the fusion protein is inserted into the US3 gene of the duck viral enteritis virus genome.

[0013] Preferably, the expression box includes the CMV promoter and PloyA.

[0014] Preferably, the nucleotide sequence of the expression cassette is as shown in SEQ ID NO:1.

[0015] This invention also provides a method for constructing the recombinant duck viral enteritis virus, the method comprising: designing two pairs of primers targeting the gRNAs upstream and downstream of the EGFP expression cassette in the US3 gene of duck viral enteritis virus; annealing and ligating the two pairs of primers into a vector to obtain two gRNA-Cas9 plasmids; amplifying the upstream and downstream genes at the expression cassette insertion site respectively; fusing the upstream gene, the expression cassette with a nucleotide sequence as shown in SEQ ID NO:1, and the downstream gene to obtain a homologous recombination fragment; transfecting the two gRNA-Cas9 plasmids and the homologous recombination fragment into chicken embryo fibroblasts to infect them with duck viral enteritis virus; collecting the viral fluid, purifying it, and obtaining the recombinant duck viral enteritis virus.

[0016] Preferably, the duck viral enteritis virus is a duck viral enteritis virus with an EGFP expression cassette inserted into the US3 gene; the nucleotide sequence of the EGFP expression cassette is shown in SEQ ID NO:2; the insertion position of the EGFP expression cassette in the US3 gene is to replace bases 595-618 of the US3 gene.

[0017] The present invention also provides the use of the fusion protein, the recombinant duck viral enteritis virus, or the recombinant duck viral enteritis virus constructed by the construction method in the preparation of products for the prevention and / or treatment of diseases caused by viral infection.

[0018] Preferably, the virus includes one or more of duck viral enteritis virus, novel duck reovirus, and duck-derived goose parvovirus.

[0019] The present invention also provides a vaccine containing the fusion protein or the recombinant duck viral enteritis virus or the recombinant duck viral enteritis virus constructed by the construction method.

[0020] The beneficial effects of this invention are:

[0021] This invention utilizes a 2A peptide fusion to express the σC gene of NDRV and the VP1 gene of DGPV, resulting in a fusion protein that simultaneously expresses protective antigenic proteins of both NDRV and DGPV. Using CRISPR / Cas9 gene editing technology, the fusion protein is recombined into the US3 gene of duck viral enteritis virus (DPV). The resulting recombinant DPV not only provides protection against virulent DPV challenge but also offers good protection against both NDRV and DGPV, achieving a multi-protection effect with a single injection. Attached Figure Description

[0022] Figure 1 The results are as follows: Indirect immunofluorescence detection results in Experiment 1; where A is the detection result of σC protein in chicken embryo fibroblasts infected with recombinant duck viral enteritis virus rDEV-σC-P2A-VP1, B is the detection result of σC protein in chicken embryo fibroblasts infected with parental virus DEV, C is the detection result of VP1 protein in chicken embryo fibroblasts infected with recombinant duck viral enteritis virus rDEV-σC-P2A-VP1, and D is the detection result of VP1 protein in chicken embryo fibroblasts infected with parental virus DEV.

[0023] Figure 2 The results of Western blot analysis in Example 1;

[0024] Figure 3 The survival curves for the highly virulent DEV AV1221 strain in Experiment Example 2 are shown. Detailed Implementation

[0025] This invention provides a fusion protein expressing a novel duck reovirus σC protein and a duck-derived goose parvovirus VP1 protein, the nucleotide sequence of which is shown in positions 300-3568 of SEQ ID NO:1.

[0026] In this invention, the fusion protein is a fusion protein of the σC gene of novel duck reovirus (NDRV) and the VP1 gene of duck-derived goose parvovirus (DGPV), linked by a 2A peptide; in SEQ ID NO:1, positions 300-1265 are the σC gene, positions 1281-1337 are the 2A peptide, and positions 1370-3568 are the VP1 gene.

[0027] The present invention also provides the application of the fusion protein in the construction of recombinant duck viral enteritis virus.

[0028] The present invention also provides a recombinant duck viral enteritis virus, wherein an expression cassette containing the fusion protein is inserted into the US3 gene of the duck viral enteritis virus genome.

[0029] In this invention, the expression cassette preferably further includes a CMV promoter and PloyA; the nucleotide sequence of the expression cassette is preferably as shown in SEQ ID NO:1; in SEQ ID NO:1, positions 1-204 are the CMV promoter, positions 300-3568 are the fusion protein, and positions 3611-3835 are PloyA.

[0030] In this invention, the method for constructing the expression cassette can be conventionally selected according to actual needs. In some embodiments, the preferred method for constructing the expression cassette includes: amplifying the σC gene of NDRV by PCR and adding Nhe I and BamHI restriction sites; amplifying the VP1 gene of DGPV by PCR and adding Not I and Xho I restriction sites; and after restriction digestion, sequentially ligating the cassette into the similarly digested pcDNA3.1(+)-P2A vector, and obtaining the expression cassette by PCR amplification. The ligation enzyme preferably includes T4 DNA ligase. The primers for amplifying the σC gene preferably include primers shown in SEQ ID NO:7~SEQ ID NO:8; the primers for amplifying the VP1 gene preferably include primers shown in SEQ ID NO:9~SEQ ID NO:10; and the primers for amplifying the expression cassette preferably include primers shown in SEQ ID NO:17~SEQ ID NO:18.

[0031] This invention also provides a method for constructing the recombinant duck viral enteritis virus, wherein the preferred method includes: designing two pairs of primers targeting the gRNAs upstream and downstream of the EGFP expression cassette in the US3 gene of duck viral enteritis virus; annealing and ligating the two pairs of primers into a vector to obtain two gRNA-Cas9 plasmids; amplifying the upstream and downstream genes at the expression cassette insertion site, respectively; fusing the upstream gene, the expression cassette with a nucleotide sequence as shown in SEQ ID NO:1, and the downstream gene to obtain a homologous recombination fragment; transfecting the two gRNA-Cas9 plasmids and the homologous recombination fragment into chicken embryo fibroblasts to infect them with duck viral enteritis virus; collecting the viral fluid, purifying it, and obtaining the recombinant duck viral enteritis virus.

[0032] In this invention, the duck viral enteritis virus is preferably a duck viral enteritis virus with an EGFP expression cassette inserted into the US3 gene; the nucleotide sequence of the EGFP expression cassette is shown in SEQ ID NO:2; the sequence of the US3 gene is preferably as shown in Genebank: KF263690.1; the insertion position of the EGFP expression cassette in the US3 gene is preferably position 595-618; that is, the EGFP expression cassette preferably replaces the bases at positions 595-618 of the US3 gene.

[0033] In this invention, the sequences of the two primer pairs are preferably as shown in SEQ ID NO:3~SEQ ID NO:6. The two primer pairs preferably contain enzyme cleavage sites; the enzyme cleavage sites preferably include BbsI cleavage sites.

[0034] In this invention, the annealing system, in 10 μL, preferably includes: 100 pmol of forward primer, 100 pmol of reverse primer, 1 μL of 10×T4 Ligation Buffer, 1 μL of T4 PNK, and ddH2O added to bring the total to 10 μL.

[0035] In this invention, the annealing conditions preferably include: 95°C for 5 minutes, decreasing by 5°C per minute until the temperature drops to 25°C.

[0036] In this invention, after annealing, the DNA is preferably ligated into a PX458 vector; the PX458 vector is preferably ligated after being digested with BbsI enzyme; the ligation enzyme preferably includes T4 DNA ligase.

[0037] In this invention, the preferred construction method further includes: annealing two pairs of primers and ligating them into a vector to obtain two ligation products; transforming the two ligation products into Stbl3 competent cells; selecting monoclonal plasmids; and verifying the sequencing results to obtain two correctly sequenced gRNA-Cas9 plasmids.

[0038] In this invention, the nucleotide sequence of the upstream gene is preferably as shown in SEQ ID NO:11; the nucleotide sequence of the downstream gene is preferably as shown in SEQ ID NO:12; the primer sequence for amplifying the upstream gene is preferably as shown in SEQ ID NO:13~SEQ ID NO:14; and the primer sequence for amplifying the downstream gene is preferably as shown in SEQ ID NO:15~SEQ ID NO:16.

[0039] This invention uses the upstream and downstream genes of the EGFP expression cassette insertion site as the upper and lower arms of homologous recombination. The upper arm, the expression cassette with nucleotide sequences as shown in SEQ ID NO:1, and the lower arm are fused by fusion PCR to obtain the homologous recombination fragment.

[0040] In some embodiments of the present invention, the transfection system preferably includes: 1 μg each of two gRNA-Cas9 plasmids and 1 μg of homologous recombination fragment.

[0041] In this invention, the chicken embryo fibroblasts are preferably confluent monolayer chicken embryo fibroblasts; the transfection time is preferably 10-14 h, for example 10, 11, 12, 13 or 14 h; and the infection is preferably with duck viral enteritis virus with an MOI of 0.1-0.5, for example 0.1, 0.2, 0.3, 0.4 or 0.5.

[0042] In this invention, it is preferable to wait until 70% of the cells show obvious lesions, then repeatedly freeze and thaw the cells three times to collect the virus fluid.

[0043] In this invention, the purification method preferably includes limiting dilution and plaque assay until completely pure recombinant duck viral enteritis virus is obtained.

[0044] This invention enables recombinant duck viral enteritis virus to simultaneously express the NDRV protective antigen protein σC and the DGPV protective antigen protein VP1 by inserting a fusion protein into the genome of duck viral enteritis virus.

[0045] The present invention also provides the use of the fusion protein, the recombinant duck viral enteritis virus, or the recombinant duck viral enteritis virus constructed by the construction method in the preparation of products for the prevention and / or treatment of diseases caused by viral infection.

[0046] In this invention, the virus preferably includes one or more of duck viral enteritis virus, novel duck reovirus, and duck-derived goose parvovirus.

[0047] In this invention, the type of product is not specifically limited, but preferably includes pharmaceuticals; the product preferably also includes acceptable excipients or adjuvants.

[0048] The present invention also provides a vaccine containing the fusion protein or the recombinant duck viral enteritis virus or the recombinant duck viral enteritis virus constructed by the construction method.

[0049] In this invention, the vaccine is preferably administered to poultry; the poultry preferably include Anseriformes, such as ducks, geese, or swans.

[0050] In this invention, the preferred dosage of the vaccine is 10. 4 ~10 6 TCID 50 For example, 10 4 10 5 Or 10 6 TCID50 .

[0051] The vaccine of this invention has excellent protective effects against virulent strains of duck viral enteritis virus, novel duck reovirus, and duck-derived goose parvovirus. After vaccination, the morbidity rate is 0 within 14 days after challenge. It has good prevention and control effects against duck viral enteritis virus, novel duck reovirus, and duck-derived goose parvovirus, and is a good trivalent vaccine that can simultaneously prevent duck viral enteritis virus, novel duck reovirus, and duck-derived goose parvovirus.

[0052] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0053] Unless otherwise specified, the following embodiments are all conventional methods.

[0054] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0055] Example 1

[0056] 1. Insertion of the duck viral enteritis virus (DEV) EGFP expression cassette

[0057] Using CRISPR Cas9 technology and homologous recombination technology, the EGFP expression frame (SEQ ID NO:2) was inserted into the US3 gene (Genebank: KF263690.1) of the duck viral enteritis virus attenuated vaccine strain C-KCE. The insertion position was positions 595-618 of the US3 gene. This duck viral enteritis virus with the inserted EGFP expression frame was used as the experimental material for subsequent experiments. The duck viral enteritis virus attenuated vaccine strain C-KCE was purchased from the China Institute of Veterinary Drug Control.

[0058] 2. Construction of PX458-gRNA-US3 plasmid

[0059] Following the design of EuPaGDT (http: / / grna.ctegd.uga.edu / ), gRNA primers gRNA-US3-F1\R1 and gRNA-US3-F2\R2 were designed for the upstream and downstream of the EGFP expression cassette in the US3 gene of duck viral enteritis virus. BbsI restriction sites were added. 100 pmol of each of the F and R single strands of the corresponding gRNA primers were added, along with 1 μL of 10×T4 Ligation Buffer and 1 μL of T4 PNK. ddH2O was added to a final volume of 10 μL, and the mixture was thoroughly mixed before being placed in a PCR instrument. The PCR was incubated at 95℃ for 5 min, decreasing the temperature by 5℃ per minute until it reached 25℃, to synthesize US3-gRNA1 and US3-gRNA2, respectively.

[0060] After digestion with BBSI, the PX458 vector was ligated with US3-gRNA1 and US3-gRNA2 using T4 ligase. The ligation system consisted of 2 μL of 10× ligation buffer, 50 ng of PX458 vector, 1 μL of either US3-gRNA1 or US3-gRNA2 (1:100 dilution), 1 μL of T4 DNA ligase, and ddH2O to a final volume of 20 μL. The ligation conditions were 16℃ for 5 h. The ligation products were transformed into Stbl3 competent cells, and single-clone plasmids were selected and sequenced to obtain the correct sequences of PX458-gRNA-US3-1 and PX458-gRNA-US3-2.

[0061] The primer sequences are as follows:

[0062] gRNA-US3-F1:CACCGTCTGATCGGAAGAATCACAC (SEQ ID NO:3)

[0063] gRNA-US3-R1:AAACGTGTGATTCTTCCGATCAGAC (SEQ ID NO:4)

[0064] gRNA-US3-F2:CACCGAAAGCAGATCGTCTGCCGT (SEQ ID NO:5)

[0065] gRNA-US3-R2:AAACACGGCAGACGATCTGCTTTC (SEQ ID NO:6)

[0066] 3. Construction of recombinant plasmids and homologous fragments

[0067] The σC gene of a novel duck reovirus (NDRV) was amplified by PCR using primers NDRV-σC-F / R, with NheI and BamHI restriction sites added. The VP1 gene of duck-derived goose parvovirus (DGPV) was amplified by PCR using primers DGPV-VP1-F / R, with NotI and XhoI restriction sites added. After restriction enzyme digestion, the gene was ligated into the pcDNA3.1(+)-P2A vector, which had been digested by the same restriction enzymes, using T4 DNA ligase. Then, the expression cassette CMV-σC-P2A-VP1-PloyA (SEQ ID NO:1) was cloned by PCR using primers CMV-σC-P2A-VP1-PloyA-F / R.

[0068] Using the duck viral enteritis virus genome as a template, the upstream DEV gene (SEQ ID NO:11) and downstream DEV gene (SEQ ID NO:12) of the expression cassette insertion site were amplified using primers DEV-LF / R and DEV-RF / R, respectively, serving as the upper and lower arms for homologous recombination. The upper arm, expression cassette CMV-σC-P2A-VP1-PloyA, and lower arm were fused by fusion PCR to obtain the homologous recombination fragment.

[0069] The primer sequences are as follows:

[0070] NDRV-σC-F:CTAGCTAGCATGGATCGCAACGAGGTGAT (SEQ ID NO:7)

[0071] NDRV-σC-R:CGCGGATCCCTAGCCCGTGGCGACGGTGA (SEQ ID NO:8)

[0072] DGPV-VP1-F:ATAAGAATGCGGCCGCATGTCTACTTTTTAGATT (SEQ ID NO:9)

[0073] DGPV-VP1-R:CCGCTCGAGTTACAGATTTTGAGTTAGAT (SEQ ID NO:10)

[0074] DEV-LF:CTAACAGGCTATACAACAGG (SEQ ID NO:13)

[0075] DEV-LR:ACCGCATCACTCTTCCGATCAGACGTGTCG (SEQ ID NO:14)

[0076] DEV-RF:GGCTCTATGGCAGACGATCTGCTTTCGCTT (SEQ ID NO:15)

[0077] DEV-RR:TTGCGTTCATCCCAAGACTC (SEQ ID NO:16)

[0078] CMV-σC-P2A-VP1-PloyA-F:GATCGGAAGAGTGATGCGGTTTTGGCAGTA (SEQ ID NO: 17)

[0079] CMV-σC-P2A-VP1-PloyA-R:AGATCGTCTGCCCCATAGAGCCCACCGCATCC (SEQ ID NO: 18)

[0080] 4. Rescue and purification of recombinant viruses

[0081] Following the transfection procedure of the TransIT-X2 Dynamic Delivery System, 1 μg each of PX458-gRNA-US3-1 and PX458-gRNA-US3-2 plasmids and homologous recombinant fragments were mixed and transfected into confluent monolayer chicken embryo fibroblast (CEF) cells. Twelve hours after transfection, the cells were infected with duck viral enteritis virus (rDEV) at an MOI of 0.2. Once 70% of the cells showed obvious cytopathic effects, the cells were subjected to three freeze-thaw cycles, and the viral fluid was collected. The recombinant virus was purified using limiting dilution and plaque purification until all cytopathic plaques were non-fluorescent and detected by PCR without any extraneous bands. Sequencing confirmed that the inserted fragment was correct and the recombinant duck viral enteritis virus (rDEV-σC-P2A-VP1) was free of mutations.

[0082] Example 1: Identification of expression of σC and VP1 proteins in recombinant duck viral enteritis virus

[0083] The recombinant duck viral enteritis virus rDEV-σC-P2A-VP1 obtained in Example 1 and the parental strain DEV (the duck viral enteritis virus with an inserted EGFP expression cassette in Example 1) were inoculated into the next generation of CEF cells. When 80% of the cells showed cytopathic effects, the expression of σC and VP1 proteins was detected by indirect immunofluorescence and Western blotting.

[0084] (1) Indirect immunofluorescence detection method: When 80% cytopathic effect was observed in the second-generation CEF of recombinant duck viral enteritis virus rDEV-σC-P2A-VP1 and parental strain DEV, cells were fixed with 4% paraformaldehyde, washed 3 times with PBS, and blocked with 1% BSA for 1 hour. Then, rabbit anti-σC protein antibody or rabbit anti-VP1 protein antibody diluted at a ratio of 1:500 was added and incubated at 37°C for 1 hour. The cells were washed 3 times with PBS for 10 minutes each time. Cy3-labeled goat anti-rabbit secondary antibody (Beyotime) was diluted at a ratio of 1:1000 and incubated at 37°C for half an hour. The cells were washed 3 times with PBS, observed, and photographed. The results are as follows: Figure 1 As shown.

[0085] The results showed that plaques infected with recombinant duck viral enteritis virus rDEV-σC-P2A-VP1 could emit red fluorescence in response to anti-σC protein antibodies or anti-VP1 protein antibodies, while plaques of the parental strain DEV could not emit red fluorescence.

[0086] (2) Western blot detection method: When 80% cytopathic effect was observed in the second-generation CEF cells infected with recombinant duck viral enteritis virus rDEV-σC-P2A-VP1 and the parental strain DEV, cells were collected (referred to as rDEV-σC-P2A-VP1 and DEV, respectively) and subjected to SDS-PAGE electrophoresis. Proteins were transferred to a methanol-soaked PVDF membrane using a semi-dry transfer method, blocked with 5% skim milk at room temperature for 2 hours, and incubated overnight at 4°C with rabbit anti-σC protein antibody or rabbit anti-VP1 protein antibody as the primary antibody. The membrane was washed three times with PBST for 10 minutes each time. HRP-labeled goat anti-rabbit secondary antibody (Beyotime) was used for incubation at room temperature for 1 hour. The membrane was washed three times with PBST for 10 minutes each time. Finally, ECL chromogenic solution (Beyotime) was used for color development and photographs were taken. The results are shown below. Figure 2 As shown.

[0087] The results showed that σC and VP1 proteins were detected after cells were infected with recombinant duck viral enteritis virus rDEV-σC-P2A-VP1, while no σC or VP1 proteins were detected in the parental strain DEV.

[0088] Experiment Example 2: Protective Test Against Recombinant Duck Viral Enteritis Virus by Immunization

[0089] The recombinant duck viral enteritis virus rDEV-σC-P2A-VP1 obtained in Example 1 and the parental strain DEV (the duck viral enteritis virus with an inserted EGFP expression cassette in Example 1) were respectively administered at 10... 5 TCID 50 Thirty SPF ducks were immunized with a single dose (designated as the recombinant duck viral enteritis virus rDEV-σC-P2A-VP1 immunization group and the parental strain DEV immunization group, respectively). Fourteen days after immunization, the two groups of SPF ducks were divided into three subgroups of 10 ducks each, and each subgroup was treated with 100 LD50. 50 DEV AV1221, NDRV, and DGPV virulent strains were used to challenge ducks, with 10 unimmunized SPF ducks serving as a control group. Ducks were observed for 14 days post-challenge, and morbidity and mortality were recorded. Results are shown in Tables 1-2 and 3. Figure 3 As shown. Among them, the highly virulent strain DEV AV1221 was purchased from the China Veterinary Microbiology Culture Collection Center; the highly virulent strains NDRV and DGPV were isolated and preserved in our laboratory.

[0090] Table 1. Incidence rate of infection with virulent NDRV strains

[0091]

[0092] Table 2. Incidence rate of infection with virulent DGPV strains

[0093]

[0094] The results showed that both recombinant duck viral enteritis virus rDEV-σC-P2A-VP1 and the parental DEV strain provided complete protection against DEV AV1221 virulent strain challenge, with all SPF ducks surviving healthily within 14 days; in the unimmunized control group, all ducks died within 5 days. Figure 3 For challenges with virulent NDRV strains, the recombinant duck viral enteritis virus (rDEV)-σC-P2A-VP1 immunization group provided complete protection. During the 14-day observation period, all SPF ducks remained healthy and disease-free. The SPF incidence rate was 80% in both the parental DEV immunization group and the unimmunized control group (Table 1). For challenges with virulent DGPV strains, the recombinant duck viral enteritis virus (rDEV)-σC-P2A-VP1 immunization group provided complete protection. During the 14-day observation period, all SPF ducks remained healthy and disease-free. The SPF incidence rate was 90% in both the parental DEV immunization group and the unimmunized control group (Table 2).

[0095] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A fusion protein expressing a novel duck reovirus σC protein and a duck-derived goose parvovirus VP1 protein, characterized in that, The nucleotide sequence of the fusion protein is shown in positions 300-3568 of SEQ ID NO:

1.

2. The use of the fusion protein of claim 1 in the construction of recombinant duck viral enteritis virus.

3. A recombinant duck viral enteritis virus, characterized in that, An expression cassette containing the fusion protein of claim 1 is inserted into the US3 gene of the duck viral enteritis virus genome.

4. The recombinant duck viral enteritis virus according to claim 3, characterized in that, The expression box contains the CMV promoter and PloyA.

5. The recombinant duck viral enteritis virus according to claim 4, characterized in that, The nucleotide sequence of the expression cassette is shown in SEQ ID NO:

1.

6. The method for constructing recombinant duck viral enteritis virus according to any one of claims 3 to 5, characterized in that, The construction method includes: designing two pairs of primers targeting the gRNAs upstream and downstream of the EGFP expression cassette in the US3 gene of duck viral enteritis virus; annealing and ligating the two pairs of primers into a vector to obtain two gRNA-Cas9 plasmids; amplifying the upstream and downstream genes at the expression cassette insertion site; fusing the upstream gene, the expression cassette with nucleotide sequences as shown in SEQ ID NO:1, and the downstream gene to obtain a homologous recombination fragment; transfecting the two gRNA-Cas9 plasmids and the homologous recombination fragment into chicken embryo fibroblasts to infect them with duck viral enteritis virus; collecting and purifying the viral fluid to obtain recombinant duck viral enteritis virus; The duck viral enteritis virus is a duck viral enteritis virus with an EGFP expression cassette inserted into the US3 gene; the nucleotide sequence of the EGFP expression cassette is shown in SEQ ID NO:

2.

7. The use of the fusion protein of claim 1, or the recombinant duck viral enteritis virus of any one of claims 3 to 5, or the recombinant duck viral enteritis virus constructed by the construction method of claim 6, in the preparation of products for preventing diseases caused by viral infection; The virus is one or more of duck viral enteritis virus, novel duck reovirus, and duck-derived goose parvovirus.

8. A vaccine, characterized in that, The vaccine contains the fusion protein of claim 1, or the recombinant duck viral enteritis virus of any one of claims 3 to 5, or the recombinant duck viral enteritis virus constructed by the construction method of claim 6.

Images