WTAP as clinical diagnosis marker for rheumatoid arthritis and application of WTAP

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to WTAP as a clinical diagnosis marker for rheumatoid arthritis and application of the WTAP. Experiments prove that the WTAP level in rheumatoid arthritis involved parts such as serum and synovial tissues of rheumatoid arthritis patients is remarkably higher than that of normal people, the WTAP and the rheumatoid arthritis are positively correlated, and the WTAP gene or WTAP protein can be used as a molecular marker for screening or diagnosis or prognosis evaluation of the rheumatoid arthritis; the CIA mouse with the WTAP gene knocked out shows that the illness state is relieved, and the symptoms are relieved, so that the WTAP can be used as an effective target for treating rheumatoid arthritis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and particularly relates to WTAP as a clinical diagnostic marker for rheumatoid arthritis and its application. Technical Background

[0002] Rheumatoid arthritis (RA) is a chronic, systemic autoimmune disease. It can affect all synovial joints, most commonly in peripheral joints such as the hands and feet. It is often characterized by a symmetrical, persistent, and progressive chronic inflammatory process. Its pathological features are primarily synovial hyperplasia, synovial inflammation, and the proliferation of inflammatory tissue (angiogranulomas) that destroys adjacent joints and periarticular tissues, ultimately causing joint deformity, dysfunction, and even loss of function.

[0003] The etiology of RA is complex, and most RA patients are difficult to cure. Clinical treatment can only aim to control disease activity and improve patients' quality of life. Early diagnosis and treatment are crucial for improving the prognosis of patients with rheumatoid arthritis, helping to reduce mortality, minimize complications, and improve patients' quality of life.

[0004] In recent years, autoantibodies such as rheumatoid factor (RF) and anti-citrullinated protein antibodies (ACPA) have been proposed as laboratory diagnostic markers for rheumatoid arthritis. However, laboratory testing of serum autoantibodies is subject to a certain degree of false negatives. Furthermore, patients with systemic lupus erythematosus and hepatitis C also harbor a certain amount of rheumatoid factor, leading to a high misdiagnosis rate. Several studies have also proposed various novel RA diagnostic markers. For example, patent CN113881764A proposes that Jmjd1c gene expression is closely associated with rheumatoid arthritis and can be used as an RA diagnostic marker. Patents also identify RPN2 mRNA or RPN2 protein as RA diagnostic markers. However, these markers are still in the early stages of exploration. Given the complex etiology of RA, the development of novel detection markers remains necessary. Summary of the Invention

[0005] One of the purposes of the present invention is to provide the use of WTAP gene or WTAP protein as a molecular marker for screening, diagnosis or prognosis evaluation of rheumatoid arthritis.

[0006] A second object of the present invention is to provide a use of the WTAP gene or WTAP protein in the preparation of a product for screening, diagnosis or prognosis evaluation of rheumatoid arthritis.

[0007] Preferably, the product includes reagents and kits.

[0008] The third object of the present application is to provide a product for screening, diagnosing or prognosis evaluating rheumatoid arthritis, characterized in that the product is a reagent for detecting the mRNA expression level and / or protein expression level of WTAP, or the product comprises a reagent for detecting the mRNA expression level and / or protein expression level of WTAP.

[0009] Preferably, the detection object is peripheral blood, synovial tissue or synovial fluid.

[0010] Preferably, when the detection result shows that the mRNA expression level and / or protein expression level of WTAP is significantly higher than the preset threshold of the healthy control group, it indicates that the corresponding detection subject has the risk of rheumatoid arthritis, and further diagnosis is needed in combination with other clinical indicators.

[0011] The fourth object of the present application is to provide a method for treating rheumatoid arthritis by inhibiting the expression or activity of WTAP gene in fibroblast-like synoviocytes or synovial tissue of rheumatoid arthritis.

[0012] Preferably, an inhibitory element targeting the WTAP gene is introduced into the target cell or synovial tissue, and the inhibitory element comprises an RNA interference molecule targeting the WTAP gene or the inhibitory element is a CRISPR gene editing system targeting the WTAP gene.

[0013] Preferably, the RNA interference molecule targeting the WTAP gene is siRNA or shRNA.

[0014] Preferably, the shRNA comprises shRNA1, shRNA2 and shRNA3, the sense strand and antisense strand sequences of the shRNA1 are shown in SEQ ID NO. 1 and SEQ ID NO. 2, the sense strand and antisense strand sequences of the shRNA2 are shown in SEQ ID NO. 3 and SEQ ID NO. 4, and the sense strand and antisense strand sequences of the shRNA3 are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0015] Preferably, the CRISPR gene editing system targeting the WTAP gene comprises a gRNA specifically recognizing the WTAP gene, a Cas9 protein combined with the gRNA, and a pharmaceutically acceptable delivery carrier.

[0016] Compared with the prior art, the present application has the following beneficial effects:

[0017] WTAP (Wilms' Tumor 1 Associated Protein) is a protein associated with the Wilms' Tumor 1 (WT1) protein. It is involved in RNA splicing and modification, and has a significant impact on cell growth and development. Abnormal expression of WTAP is thought to be associated with various cancers (such as renal and breast cancer) and may affect the occurrence and progression of tumors. WTAP also plays an important role in normal development, and its functional impairment may lead to developmental abnormalities.

[0018] This application experimentally confirms that WTAP levels in the serum, synovial tissue, and other RA-affected areas of rheumatoid arthritis patients are significantly higher than those in healthy controls. WTAP is positively correlated with rheumatoid arthritis and can be used as a molecular marker for screening, diagnosis, or prognostic assessment of rheumatoid arthritis. CIA mice with WTAP gene knockout showed reduced disease progression and symptom relief, indicating that WTAP can be an effective target for the treatment of rheumatoid arthritis. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figures 1-4 is the expression of WTAP in OA patients and RA patients, Figure 1 RT-PCR detection of m 6 A. mRNA expression levels of related enzymes; Figure 2 Immunohistochemical detection of WTAP expression in synovial tissues of OA patients, RA patients, K / BxN serum-induced arthritis mice (K / BXN STA), and KRN serum-induced arthritis mice (KRN STA). Scale bars: 200 μm (20×), 50 μm (63×); Figure 3 Immunofluorescence double staining (IF) was used to detect the expression of WTAP and TNF-α in synovial tissues of OA and RA patients; Figure 4 The left side in the middle shows the expression of WTAP in synovial tissues of OA patients and RA patients and in synoviocytes activated by TNF-α detected by Western blot. The right side shows the expression of WTAP in peripheral blood of normal subjects and RA patients detected by qRT-PCR.

[0020] Figures 5-6 is the correlation analysis of WTAP, where Figure 5 Figure 3 Correlation between WTAP expression and RA disease activity in peripheral blood mononuclear cells of RA patients. Figures a and b represent the results of DAS28, RF, ESR, CRP, and Anti-CCP, respectively. Figure 6 Figure 3 shows the correlation between WTAP expression and inflammatory factors and chemokines in peripheral blood mononuclear cells of RA patients. Figures a and b show the results of TNF-α, IL-1β, IL-6, CCL8, IL-8, and CCL3, respectively.

[0021] Figures 7-13 The results show that overexpression of WTAP can promote the activation and inflammatory response of FLS. Figure 7 Western blot was used to detect the expression of inflammatory factors in FLS activated by TNF-α by adenovirus overexpressing WTAP. Figure 8 RT-qPCR was used to detect the effect of TNF-α knockdown on the expression of inflammatory factors in FLS; Figure 9 ELISA was used to detect the effect of TNF-α knockdown on the expression of inflammatory factors in FLS; Figure 10 Western blot was used to detect the expression of metalloproteinases in FLS activated by TNF-α by adenovirus overexpressing WTAP; Figure 11 RT-qPCR was used to detect the expression of TNF-α-activated FLS metalloproteinases after knockdown of WTAP; Figure 12 The scratch assay was used to detect the migration ability of TNF-α-activated FLS by adenovirus overexpressing WTAP. Scale bar: 1000 μm. Figure 13 Transwell assay to detect the invasion ability of WTAP-overexpressing adenovirus on TNF-α-activated FLS. Scale bar: 200 μm.

[0022] Figures 14-17 The results show that knockdown of WTAP in myeloid cells can alleviate joint inflammation in K / BxN STA mice. Figure 14 Schematic diagram of mouse modeling; Figure 15 Western blot was used to detect the expression of WTAP before and after WTAP knockout; Figure 16 Representative photographs of mouse ankle swelling, micro-CT images, X-rays, and HE images are shown. Scale bars: 1000 μm (5×), 200 μm (20×), and 50 μm (63×). Figure 17 Joint score (right) and swelling (left) were detected with Wtap f / f -Comparison with the KRN STA group: ## P < 0.01; f / f -K / BxN STA group comparison: **P < 0.01. DETAILED DESCRIPTION

[0023] The technical solution of this application is described in more detail below with reference to experiments and drawings.

[0024] Unless otherwise specified, the terms used herein have the meanings commonly understood by those skilled in the art.

[0025] Introduction and full comparison:

[0026] WTAP: Wilms' tumor 1-associating protein, Wilms tumor binding protein.

[0027] m6A: n6-methyladenosine, N6-methyladenosine.

[0028] IL-1β: interleukin-1β, interleukin 1β.

[0029] IL-6: interleukin 6, interleukin 6.

[0030] MMP2: matrix Metallopeptidase 2, matrix metalloproteinase-2

[0031] MMP9: matrix metallopeptidase 9, matrix metalloproteinase-9.

[0032] TNF-α: tumor necrosis factor-α, tumor necrosis factor.

[0033] RA: Rheumatoid Arthritis.

[0034] OA: Osteoarthritis.

[0035] HE staining: hematoxylin-eosin staining, hematoxylin-eosin staining.

[0036] IF: immunofluorescence.

[0037] IHC: immunohistochemistry.

[0038] The KRN STA and K / BxN STA mouse models used in the examples of this application are serum-induced arthritis mouse models and can be used as RA animal models. With the consent of Professors Christophe Benoist and Diane Mathis of Harvard Medical School, KRN mice (transgenic mice carrying T cell receptors) were introduced for the construction of K / BxN mice. NOD mice (non-obese diabetic mice) were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. KRN mice are selected and hybridized with NOD mice to obtain K / BxN mice. K / BxN mice can spontaneously develop arthritis 100% in 4-5 weeks. The serum of K / BxN mice was collected and stored at -80°C for the construction of K / BxN STA mice.

[0039] 1. Study on the difference of WTAP expression in synovial tissue of RA and OA patients

[0040] Patients from the Department of Rheumatology at the First Affiliated Hospital of Anhui Medical University, along with 23 patients with typical clinical manifestations of OA and RA, were enrolled. RNA was extracted using conventional methods, and WTAP mRNA expression was evaluated by qRT-PCR. Protein was extracted using conventional methods, paraffin-embedded, and Western blot, qRT-PCR, immunohistochemistry, and immunofluorescence were used to evaluate WTAP expression in the synovial tissue of RA and OA patients. RA synoviocytes were isolated and cultured, and after induction with TNF-α, cells were harvested for protein extraction. WTAP expression was then measured 48 hours after induction.

[0041] qRT-PCR results showed that the expression of WTAP was most significantly upregulated in RA patients. Figure 1 ; Immunohistochemistry results showed that the positive staining degree of synovial tissue in RA patients was significantly higher than that in OA patients, indicating that the expression of WTAP in RA patients was significantly higher than that in OA patients (P<0.05). Figure 2 Immunofluorescence results showed that WTAP was highly expressed in RA synovial tissue, and partially overlapped with the expression of TNF-α, showing the same trend; further findings showed that TNF-α could promote the expression of WTAP in synovial cells. Figure 3 ; Western blot results showed that the expression of WTAP in the synovium of RA patients was significantly higher than that in OA patients (P<0.01). 48 hours after TNF-α (tumor necrosis factor-α) induction of RA synovial cells, the expression of WTAP increased and was significantly higher than that in the uninduced group. Figure 4 ;

[0042] 2. Differential expression of WTAP in synovial tissues of KRN-STA mice and K / BxN-STA mice

[0043] Establishment of the KRN-STA and K / BxN-STA mouse models: KRN mice were imported with the permission of Professors Christophe Benoist and Diane Mathis of Harvard Medical School. NOD mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., and K / BxN mice were bred from the two. KRN-STA and K / BxN-STA mouse models were induced by intraperitoneal injection of KRN and K / BxN mouse sera into naive C57 mice. The ankle joints were harvested and paraffin-embedded using conventional methods. Immunohistochemistry was used to evaluate the expression of WTAP in the synovial tissue of the KRN-STA and K / BxN-STA mice.

[0044] Immunohistochemistry results showed that the positive staining degree of synovial tissue in K / BxN-STA mice was significantly higher than that in KRN-STA mice, indicating that the expression of WTAP in K / BxN-STA mice was significantly higher than that in KRN-STA mice (P<0.05). Figure 2 .

[0045] 3. Analysis of the clinical correlation between WTAP and RA

[0046] Peripheral blood samples from patients with RA and OA in the Department of Rheumatology at the First Affiliated Hospital of Anhui Medical University were collected to analyze the correlation between WTAP and RA clinical disease activity and synovial inflammatory factors. Clinical information of RA patients was collected, and qRT-PCR and SPSS were used to analyze the correlation between WTAP and patient-assessed RA disease activity, rheumatoid factor, erythrocyte sedimentation index, C-reactive protein, and WTAP with inflammatory factors and chemokines.

[0047] qRT-PCR results showed that the expression of WTAP mRNA was positively correlated with DAS28 and RF, and the correlation analysis was statistically significant; it was positively correlated with ESR, CRP and Anti-CCP, but there was no statistical significance. Figure 5 ; Correlation analysis with RA synovial inflammatory factors found that WTAP mRNA expression was positively correlated with TNF-α, IL-1β, IL-6, CCL8, IL-8 and CCL3, and the correlation was statistically significant. Figure 6 .

[0048] 4. In vitro study of the effect of WTAP on the inflammatory response of TNF-α-activated FLS cells

[0049] RA synovial cells were isolated and cultured, and Ad-WTAP adenovirus was used to overexpress WTAP in FLS, and Sh-WTAP adenovirus was used to knock down WTAP in FLS. After TNF-α induction (to simulate the inflammatory microenvironment of FLS cells in the synovium) for 48 hours, the cell supernatant was collected, and protein and RNA were extracted. Western blot, qRT-PCR and ELISA experiments were used to evaluate the expression of inflammatory factors (IL-Iβ, IL-6) in FLS.

[0050] Western blot results showed that overexpression of WTAP could significantly increase the expression of IL-Iβ and IL-6, while knockdown of WTAP could significantly reduce the expression of IL-Iβ and IL-6. Figure 7 ; qRT-PCR results showed that the expression of IL-Iβ and IL-6 mRNA was significantly reduced after knockdown of WTAP. Figure 8; ELISA results showed that the inflammatory factors IL-Iβ and IL-6 in the cell supernatant were significantly reduced after knockdown of WTAP. Figure 9 .

[0051] 5. In vitro study of the effect of WTAP on the migration and invasion ability of TNF-α activated FLS cells

[0052] RA synovial cells were isolated and cultured, and Ad-WTAP adenovirus was constructed to overexpress WTAP in FLS, and Sh-WTAP adenovirus was constructed to knock down WTAP in FLS. After TNF-α induction (simulating the inflammatory microenvironment of FLS cells in the synovium) for 48 hours, proteins and RNA were extracted, and Western blot and qRT-PCR experiments were used to evaluate the expression of metalloproteinases (IL-Iβ, IL-6) in FLS. The scratch test was used to evaluate the migration ability of FLS; and the transwell assay was used to evaluate the invasive ability of FLS.

[0053] Among them, Adeasy22-h-WTAP-Kpn / Kpn was designed to overexpress WTAP, and the forward primer sequence was agatccgctagagatctggtaccgccaccATGACCAACGAAGAAC; the reverse primer sequence was tcatcgtcatccttgtagtcggtaccCAAAACTGAACCCTGTACATTTAC.

[0054] The following three Sh-WTAP adenovirus sequences were used to knock down WTAP in FLS:

[0055] shRNA1 sequence:

[0056] Justice Chain:

[0057] AATTCGTCGATTGAGTGAAACAGACTTCAAATTCAAGAGATTTGAAGTCTGTTTCACTCAATCGATTTTTTG (SEQ ID NO. 1);

[0058] Antisense strand:

[0059] GATCCAAAAAATCGATTGAGTGAAACAGACTTCAAATCTCTTGAATTTGAAGTCTGTTTCACTCAATCGACG (SEQ ID NO. 2);

[0060] shRNA2 sequence:

[0061] Justice Chain:

[0062] AATTCGGCAAGTACACAGATCTTAACTCTATTCAAGAGATAGAGTTAAGATCTGTGTACTTGCCTTTTTTG (SEQ ID NO. 3);

[0063] Antisense strand:

[0064] GATCCAAAAAAGGCAAGTACACAGATCTTAACTCTATCTCTTGAATAGAGTTAAGATCTGTGTACTTGCCG (SEQ ID NO. 4);

[0065] shRNA3 sequence:

[0066] Justice Chain:

[0067] AATTCGCGTTGCCCAACTGAGATCAACAATGTTCAAGAGACATTGTTGATCTCAGTTGGGCAACGTTTTTTG (SEQ ID NO. 5);

[0068] Antisense strand:

[0069] GATCCAAAAAACGTTGCCCAACTGAGATCAACAATGTCTCTTGAACATTGTTGATCTCAGTTGGGCAACGCG (SEQ ID NO. 6).

[0070] Western blot results showed that overexpression of WTAP could significantly increase the expression of MMP2 and MMP9, while knockdown of WTAP could significantly reduce the expression of MMP2 and MMP9. Figure 10 ; qRT-PCR results showed that the expression of MMP2 was significantly reduced after knocking down WTAP. Figure 11 The results of the wound healing assay showed that overexpression of WTAP significantly promoted the migration of FLS cells, while knockdown of WTAP significantly inhibited the migration of FLS cells. Figure 12 The results of Transwell experiments showed that overexpression of WTAP could significantly promote the invasion ability of FLS cells, while knockdown of WTAP significantly inhibited the invasion ability of cells. Figure 13 .

[0071] 6. Effects of myeloid knockout of WTAP on the condition and bone destruction in serum-induced arthritis mice

[0072] C57BL / 6 WT mice and WTAP myeloid knockout (Wtap f / f Lyz+) mice were randomly divided into 2 groups, 10 in the control group (KRN STA mouse model), 10 in the model group (K / BxN STA mouse model), namely Wtap f / f - KRN STA group, Wtap f / f - K / BxN STA group, Wtap f / f Lyz+ - KRN STA group, Wtap f / fLyz+ - K / BxN STA group. The model group was prepared (K / BxN STA mouse model), and the following indicators were observed after immunization: observation of joint redness and deformity of animals, and photography for preservation.

[0073] Clinical score: The forelimb score was 0-3, 0 for no swelling, 1 for mild redness, 2 for moderate redness, and 3 for severe redness or even deformity; the hindlimb score was 0-4, 0 for no swelling, 1 for only redness, 2 for mild redness, 3 for moderate redness, and 4 for severe redness or even deformity.

[0074] The sum of the scores of the four limbs of each animal was its clinical score, and the total score of the four limbs was 14. From the 0th day of the first immunization, the clinical score was evaluated, and the score was recorded every 2 days.

[0075] Swelling degree: The diameter value at 0.5mm below the ankle joint of the left and right hind feet of mice in each group was measured with a vernier caliper. From the 0th day of the first immunization, the swelling degree was measured every 2 days. The mouse was considered to have developed the disease if it had a clinical score of 1 or more for one paw. On the 42nd day after the first immunization, the left and right hind knee joints and the left and right hind ankle joints of some mice were taken, the fur was removed, and 4% paraformaldehyde was used for fixation, followed by X-rays and CT examination of bone destruction; paraffin embedding, sectioning, and HE staining were used for histopathology. The synovial tissue of the right hind knee joint and the right hind ankle joint of the remaining mice was extracted, frozen in liquid nitrogen, and stored in a -80℃ refrigerator for subsequent extraction of protein and RNA by homogenization.

[0076] See Figure 14 , 0.1ml KRN mouse serum and K / BxN serum were injected intraperitoneally into mice on the 0th day and the 2nd day, and the modeling was completed on the 10th day, during which joint scoring and swelling degree were performed every 2 days; Western blot results verified that Wtap f / f Lyz+ WTAP knockout in mice was successful, see Figure 15 ; WTAP gene myeloid knockout can reduce the joint redness of K / BxN STA model mice, on the 2nd day after the second immunization, Wtap f / f- K / BxN STA group mice began to appear polydactylous joint redness, and gradually spread to the foot pad and ankle joint, sometimes involving the forelimb, with time the degree of joint redness gradually decreased and appeared symptoms of deformity and stiffness. At the same time point, Wtap f / f Lyz+ - K / BxN STA group mice were lighter than Wtap f / f - K / BxN STA group, see Figure 16 ; WTAP gene knockout can significantly down-regulate the clinical score of K / BxN STA model mice, Wtap f / f - K / BxN STA group mice began to appear joint swelling on the second immunization 2d, with time, the clinical score, joint swelling gradually increased, and reached a peak on the 10d, under the same conditions, Wtap f / f Lyz + - K / BxN STA group clinical score, joint swelling was lower than Wtap f / f - K / BxN STA group, see Figure 16 ; (4) WTAP gene knockout reduces the pathological score of K / BxN STA model mice: KRN STA group mice joint tissue sections joint space, synovial membrane no hyperplasia, bone surface complete smooth. K / BxN STA mice joint tissue sections appeared a large number of inflammatory cell infiltration, synovial hyperplasia, a large number of pannus formation, accompanied by cartilage erosion and bone tissue destruction (P<0.01). Under the same conditions, TMCO1+ / --CIA group mice histological score value was significantly lower than WT-CIA group (P<0.01), see Figure 17 .

[0077] The above embodiments are only used to illustrate the technical solutions of the present application, and are not limited to the present application; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modification, equivalent replacement and improvement made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. Application of WTAP gene or WTAP protein as a molecular marker for screening, diagnosis or prognosis assessment of rheumatoid arthritis.

2. Use of the WTAP gene or WTAP protein in the preparation of products for screening, diagnosis or prognosis assessment of rheumatoid arthritis.

3. The use according to claim 2, characterized in that The products include reagents and kits.

4. A product for screening, diagnosis or prognosis assessment of rheumatoid arthritis, characterized in that: The product is a reagent for detecting the mRNA expression level and / or the WTAP protein expression level of WTAP, or the product contains a reagent for detecting the mRNA expression level and / or the WTAP protein expression level of WTAP.

5. A product for screening, diagnosis or prognosis assessment of rheumatoid arthritis according to claim 4, characterized in that: The object of detection is at least one of peripheral blood, joint synovial tissue or joint cavity synovial fluid.

6. A product for screening, diagnosis or prognosis assessment of rheumatoid arthritis according to claim 5, characterized in that: When the test results show that the WTAP mRNA expression level and / or WTAP protein expression level is significantly higher than the preset threshold of the healthy control group, it indicates that the corresponding test subject is at risk of rheumatoid arthritis.

7. A method for treating rheumatoid arthritis, characterized in that: Inhibit the expression or activity of WTAP gene in rheumatoid arthritis fibroblast-like synoviocytes or synovial tissue.

8. The method according to claim 7, wherein An inhibitory element targeting the WTAP gene is introduced into the target cells or synovial tissue, wherein the inhibitory element includes an RNA interference molecule targeting the WTAP gene or the inhibitory element is a CRISPR gene editing system targeting the WTAP gene.

9. The method according to claim 8, wherein The RNA interference molecule targeting the WTAP gene is siRNA or shRNA.

10. The method according to claim 8, wherein The CRISPR gene editing system targeting the WTAP gene includes a gRNA that specifically recognizes the WTAP gene, a Cas9 protein bound to the gRNA, and a pharmaceutically acceptable delivery vector.

Images