Use of S100A9 inhibitors in treatment of neuropathic pain

The development of S100A9 inhibitors, particularly ABR-238901, has solved the treatment challenge of peripheral neuropathic pain. By inhibiting S100A9 protein activity and gene expression, it regulates inflammatory factors and neuronal function, significantly alleviating pain symptoms and neutrophil infiltration, and providing a new therapeutic target.

CN120789262APending Publication Date: 2025-10-17TIANJIN FIRST CENT HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511116044.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-11
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Due to its complex pathogenesis, peripheral neuropathic pain currently lacks effective treatments, especially for persistent or paroxysmal spontaneous pain, hyperalgesia, and paresthesia caused by damage to the peripheral somatosensory nervous system.

Method used

Develop S100A9 inhibitors, including substances that inhibit or silence S100A9 gene expression, such as ABR-238901. By inhibiting S100A9 protein activity or promoting its degradation, these inhibitors can regulate related inflammatory factors and neuronal function. They can also target the S100A9 gene using substances such as antisense oligonucleotides, siRNA, miRNA, peptides, and proteins, and intervene using gene editing tools such as CRISPR/Cas9 technology.

Benefits of technology

It significantly alleviated neuropathic pain symptoms, reduced mechanical hyperalgesia, regulated the expression of inflammatory factors, reduced neutrophil infiltration, weakened neuro-immune-glial cell interactions, and provided new therapeutic targets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120789262A_ABST
    Figure CN120789262A_ABST
Patent Text Reader

Abstract

The invention discloses an application of an S100A9 inhibitor in treatment of neuropathic pain. The research finds that the neuropathic pain induced by CCI can be obviously relieved by knocking out the S100A9 or inhibiting the activity of the S100A9h. Therefore, the invention provides a new target for treating neuropathic pain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to the use of S100A9 inhibitors in treating neuropathic pain. Background Art

[0002] Peripheral neuropathic pain is caused by damage or lesions of the peripheral somatosensory nervous system, and is characterized by persistent or paroxysmal spontaneous pain, hyperalgesia and paresthesia. This condition seriously affects the quality of life of patients, and the prevalence in the general population is 7%-10%. Despite the significant harm, there is still a lack of effective treatment due to its complex pathogenesis. Studies have shown that peripheral nerve injury triggers a series of cellular and molecular cascade reactions, including gene regulation, glial cell activation, and infiltration of inflammatory cells such as neutrophils and macrophages into damaged dorsal root ganglia (DRG). These processes together promote the occurrence of pain. Neuro-immune-glial cell interactions within sensory ganglia and dysfunction of DRG neurons are considered to be key factors in the occurrence and persistence of neuropathic pain. Immune cells participate in the pathological process of pain by directly activating or sensitizing damaged sensory receptors.

[0003] This study aims to elucidate its function and mechanism in chronic constriction injury (CCI)-induced neuropathic pain, hoping to provide new insights into the pathogenesis of neuropathic pain and identify potential targets for therapeutic intervention. Summary of the Invention

[0004] The present invention provides use of an S100A9 inhibitor in preparing a medicament for preventing or treating neuropathic pain.

[0005] Furthermore, S100A9 inhibitors include substances that inhibit or silence S100A9 gene expression and substances that inhibit S100A9 protein activity.

[0006] Furthermore, the substance that inhibits the activity of S100A9 protein includes a substance that inhibits the synthesis of S100A9 protein, a substance that promotes the degradation of S100A9 protein, or a substance that inhibits the function of S100A9 protein.

[0007] Furthermore, the inhibitor for inhibiting the activity of S100A9 protein is ABR-238901.

[0008] Furthermore, the substance that inhibits or silences the expression of the S100A9 gene includes a substance that interferes with the expression of the S100A9 gene, a substance that knocks out the S100A9 gene, or a substance that mutates the S100A9 gene.

[0009] Furthermore, the substances include synthetic small molecules, chemical reagents, antisense oligonucleotides, siRNA, miRNA, ribozymes, polypeptides, and proteins.

[0010] The term "antisense oligonucleotide" refers to a short chain of nucleic acid (comprising about 15-25 nucleotides) which has been chemically modified and whose base sequence is complementary to a specific target sequence, and which, when introduced into a cell, forms a double-stranded structure with the target sequence according to the principle of Watson-Crick base pairing.

[0011] In the present invention, "complementary" means that two nucleotides can pair under hybridization conditions, for example, the relationship between adenine (A) and thymine (T) or uracil (U), and the relationship between cytosine (C) and guanine (G).

[0012] The term "ribozyme" refers to an RNA molecule having the function of catalyzing a specific biochemical reaction.

[0013] The term "siRNA" refers to a ribonucleic acid (RNA) capable of inhibiting the expression of a target gene, comprising a sense RNA fragment region and an antisense RNA fragment region.

[0014] The term "miRNA" refers to a ribonucleic acid (RNA) molecule about 21 to 23 nucleotides long that is widely present in eukaryotes and regulates the expression of other genes.

[0015] In the present invention, the antisense oligonucleotide, ribozyme, siRNA or miRNA can be designed to target a gene or regulatory sequence of interest, such as a gene or regulatory sequence whose expression needs to be inhibited, so as to inhibit or reduce its expression. The gene or regulatory sequence targeted can be any gene or regulatory sequence whose expression needs to be inhibited or reduced. The antisense oligonucleotide, ribozyme, siRNA or miRNA of the present invention can be designed according to conventional methods.

[0016] The conventional design method of siRNA can refer to the literature (e.g., Reynolds A et al., Nature Biotechnology, 2004, Vol. 22: 326-330) or the public information on the website of Amhion, Qiagen, etc. The conventional design method of miRNA can refer to the literature (Lo HL et al., Gene Therapy, 2007, Vol. 14: 1503-1512) and the method for selecting a target sequence is similar to the design method of siRNA. For example, the designed sense strand and the corresponding antisense strand containing the target sequence can be replaced on the pri-microRNA, so that the constructed miRNA can prevent the expression of the mRNA containing the target sequence. The conventional design method of ribozyme can refer to the literature (Haseloff J et al., Nature, 1988, Vol. 334: 585-591) and, for example, the nucleotide sequence complementary to the sequence before and after the target sequence can be respectively arranged before and after the sequence of the conserved core of the ribozyme (e.g., hammerhead structure), so that the constructed ribozyme can cut the nucleic acid containing the target sequence at the target sequence. The conventional design method of antisense oligonucleotide can refer to the literature (Matveeva OV et al., Nucleic Acids Research, 2003, Vol. 31: 4989-4994).

[0017] The term "sense strand" refers to a nucleotide strand having the same sequence as the coding strand of a gene.

[0018] The term "antisense strand" refers to a strand of siRNA that comprises a region that is fully or substantially complementary to a target sequence. The term "complementary region" refers to a region of the antisense strand that is fully or substantially complementary to the sequence of the target mRNA. Where the complementary region is not fully complementary to the target sequence, the mismatches can be located in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are located in the terminal regions, e.g., within 5, 4, 3, 2, or 1 nucleotides of the 5' and / or 3' end. The portion of the antisense strand that is most sensitive to mismatches is referred to as the "seed region".

[0019] The antisense oligonucleotide, ribozyme, siRNA or miRNA of the present application includes a modified product of the chemical modification of the constituent parts of the antisense oligonucleotide, ribozyme, siRNA or miRNA, such as the phosphate backbone and / or ribose and / or base, and the modification method is known in the art, and the modification suitable for the present application can be selected from the group comprising locked nucleic acid (LNA), unlocked nucleic acid (UNA), 2'-methoxyethyl, 2'-O-alkyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, phosphate backbone, fluorescent probe, ligand modification or a combination thereof.

[0020] Further, the polypeptide or protein includes a hormone, a cytokine, an antibody and a fragment thereof.

[0021] The term "antibody" describes a class of immunoglobulin molecules and is used in its broadest sense herein. Antibodies specifically include monoclonal antibodies, polyclonal antibodies, intact antibodies, and antibody fragments. Antibodies comprise at least one antigen binding domain. Antigen binding domains include those formed by a VH-VL dimer. The VH and VL regions can be further subdivided into regions of hypervariability, termed "hypervariable regions" (HVRs), also referred to as "complementarity determining regions" (CDRs), interspersed with regions that are more conserved, termed framework regions (FR). Each VHand VL generally comprises three CDRs and four FRs, arranged in the following order (from N-terminus to C-terminus): FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. The CDRs are involved in antigen binding and confer antigen specificity and binding affinity to the antibody. The light chain from any vertebrate species can be assigned to one of two types, called kappa and lambda, based on the sequence of constant domain. The heavy chain from any vertebrate species can be assigned to one of five different classes (or subtypes), based on the sequence and function: IgA, IgD, IgE, IgG, and IgM. These classes are also designated alpha, delta, epsilon, gamma, and mu, respectively. The IgG and IgA classes are further divided into subclasses based on sequence and function. Humans express the following subclasses: IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2.

[0022] The term "monoclonal" refers to the nature of the antibodies obtained, derived from a population of essentially identical antibodies (i.e., the individual antibodies comprising the population are identical except for natural occurring mutations that can be present in minor amounts).

[0023] Further, the substance for knocking out the S100A9 gene also includes a gene editing tool for knocking out the S100A9 gene.

[0024] Further, the gene editing tool includes a Cre-lox recombination technique, a zinc finger nuclease (ZFN) technique, a transcription activator-like effector nuclease technique (TALENs), and a CRISPR / Cas9 technique.

[0025] The Cre-Lox recombination technique is a site-specific recombinase technique for performing deletion, insertion, translocation, and inversion operations at specific sites of cell DNA, characterized by enabling DNA modification to be performed on a specific cell population or triggered by a specific external stimulus. The recombination system of this technique consists of a single enzyme, Cre recombinase, which enables recombination of a pair of short target sequences called Lox sequences, without the need for insertion of additional proteins or sequences.

[0026] Zinc finger nucleases (ZFNs) are engineered restriction enzymes composed of a fusion of a zinc finger DNA-binding domain and a DNA-degrading domain. Genetic engineering can modify the zinc finger domain to target specific DNA sequences within complex genomes. By leveraging endogenous DNA repair mechanisms, zinc finger nucleases can precisely modify the genomes of higher animals.

[0027] Transcription activator-like effector nuclease technology (TALENs) is a gene editing technology that targets and binds TALEN elements to specific DNA sites through DNA recognition modules, then completes the cleavage of specific sites under the action of FokI nuclease, and uses the inherent homology-directed repair (HDR) or non-homologous end joining (NHEJ) repair process in the cell to complete the insertion (or inversion), deletion and gene fusion of specific sequences.

[0028] CRISPR / Cas9 is a technology that uses RNA to guide the nuclease Cas9 protein to perform specific DNA modifications on targeted genes. The technology works by binding crRNA (CRISPR-derived RNA) to tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA / crRNA complex. This complex guides the nuclease Cas9 protein to cleave double-stranded DNA at the target sequence site paired with the crRNA, thereby editing the genomic DNA sequence.

[0029] Furthermore, the gene editing tool is CRISPR / Cas9 technology.

[0030] Furthermore, the neuropathic pain is induced by chronic constriction injury of the sciatic nerve.

[0031] Furthermore, the neuropathic pain includes mechanical hyperalgesia.

[0032] Furthermore, the prevention or treatment of neuropathic pain includes regulating the expression of inflammatory factors IL-6, IL-1β, TNF-α, regulating the expression of GPR153, Kcnk16, regulating the expression of CSF-1, and activating spinal cord microglia.

[0033] Furthermore, the S100A9 is derived from infiltrating neutrophils.

[0034] The present invention also provides a method for constructing a mechanical hyperalgesia animal model, which comprises administering an S100A9 promoter.

[0035] The promoter includes any substance that can increase the expression of nucleic acid encoding S100A9, increase the level of S100A9 protein or promote the activity of S100A9.

[0036] Further, the promoter includes S100A9 overexpression system.

[0037] Further, the S100A9 overexpression system includes a selection expression vector, including a plasmid or a viral vector or a transposon vector, which is constructed by a chemical transfection method or a physical transfection method or a viral infection method.

[0038] Further, the plasmid includes a pCDNA series vector, the viral vector includes a lentivirus vector, an adeno-associated virus (AAV) vector or an adenovirus vector, and the transposon vector includes a PiggyBac transposon vector or a Sleeping Beauty transposon vector.

[0039] Further, the viral vector is selected from a lentivirus vector.

[0040] Further, the chemical transfection method includes liposome transfection, cationic polymer transfection, and the physical transfection method includes electroporation, gene gun method.

[0041] In a specific embodiment of the present application, the method includes intrathecal injection of recombinant S100A9 protein.

[0042] The gene ID of human S100A9 in the present application is 6280, and the protein sequence is P06702. The gene ID of mouse S100A9 is 20202, and the protein sequence is P31725.

[0043] The recombinant mouse S100A9 protein sequence is P31725. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1 The results of showing that S100A9 is up-regulated in the DRGs of CCI mice, wherein, Figure 1 a: a schematic diagram of CCI mouse model; the injury perception is evaluated using von Frey measurement after operation; the DRGs (L4-6) and the lumbar spinal cord are collected for qPCR, Western blot and immunofluorescence detection; Figure 1 b: the time course of mechanical pain hypersensitivity induced by CCI in each group compared with the contralateral and sham operation groups, n=10, the data is represented as mean SEM. ***P<0.001 and ****P<0.0001 represent significant differences between WT contralateral and ipsilateral paws, Bonferroni test after two-way ANOVA; Figure 1 c: expression of S100aA9 protein in L4-6 DRG; Figure 1 d: protein quantification map of S100A9; Figure 1 e: mRNA expression of S100A9 in L4-6 DRG; Figure 1f: mRNA expression of IL-6 in L4-6 DRG; Figure 1 g: mRNA expression of IL-1 b in L4-6 DRG; Figure 1 h: mRNA expression of TNF-a in L4-6 DRG; Figure 1 I: S100A9 mRNA expression in spinal cord, **P<0.01, ***P<0.001, and ****P<0.0001 indicate significant differences between CCI mice and sham-operated mice;

[0045] Figure 2 Graphs showing results related to the involvement of S100A9 in the development and progression of the pain behavior and inflammatory response, wherein, Figure 2 a: mRNA expression of S100A9 in L4-6 DRG; Figure 2 b: Duration of CCI-induced mechanical hyperalgesia compared to the contralateral group and sham-operated group, 10 mice per group; Figure 2 c: Mechanical pain sensitivity in WT mice treated with ABR-238901 after CCI (n=5 per group); Figure 2 d: WT mice injected with S100A9 recombinant protein to induce mechanical hyperalgesia, 5 mice per group; data are expressed as mean SEM; ****P<0.0001 indicates significant differences between WT and S100A9- / - CCI in ipsilateral hindpaw mice, *P<0.05, **P<0.01, ***P<0.001, and ***P<0.0001 indicate significant differences between WT and CCI ipsilateral hindpaw mice treated with excipient or paqinimod (10 mg / kg); **P<0.01 and ***P<0.001 indicate significant differences between WT mice treated with saline or S100A9, followed by Bonferroni post-hoc test after two-way ANOVA; Figure 2 e: mRNA expression of IL-6 in L4-6 DRG; Figure 2 f: mRNA expression of IL-1 b in L4-6 DRG; Figure 2 g: mRNA expression of TNF-a in L4-6 DRG, ***P<0.001 indicates significant differences between WT and S100A9- / - mice after CCI surgery; Figure 3 Graphs showing related results of infiltrating neutrophils expressing high levels of S100A9 in DRG of CCI model mice, wherein, Figure 3 a: Ly6G immunohistochemical detection, Figure 3 b: CD11b immunohistochemical detection, each group consisting of five DRG sections, five sections per experiment. ***P<0.001 and ****P<0.0001 indicate significant differences between contralateral and ipsilateral DRGs on WT;Figure 3 c: Representative images of DRG sections of WT mice 7 days after CCI; each group included five animals and five DRG sections per experiment; S100A9 cells (red), Ly6G cells (green) and DAPI cells (blue).

[0046] Figure 4 Graph showing the results of transcriptome sequencing and bioinformatics analysis, wherein Figure 4 a: Heatmap of differentially expressed genes in DRGs after CCI between WT mice treated with S100A9 inhibitor (PAQ) and control group mice;

[0047] Figure 4 b: Venn (c) volcano plot showing all differentially expressed genes in both DRG experiments, highlighting the top 20 significantly upregulated genes (yellow) and significantly downregulated genes (blue) in the intervention group;

[0048] Figure 5 Graph showing the results related to the involvement of S100A9 in CCI-induced neuropathic pain through the increase of GPR153 / Kcnk16 expression, wherein, Figure 5 a: Representative images of DRG sections from WT and S100A9 KO mice, n = 5 animals and five DRG sections per group per experiment; gpr153 (red), Kcnk16 (green) and DAPI (blue); Figure 5 b, Figure 5 c, Figure 5 d: Protein expression of GPR153 and Kcnk16 in DRGs; Figure 5 e: mRNA levels of DRG GPR 153; Figure 5 f: mRNA levels of DRG Kcnk16; **P < 0.01 indicates significant difference between DRGs from WT mice and S100A9 KO mice; Figure 5 g: Representative images of DRG sections from WT and S100A9 KO mice, n = 5 animals and five DRG sections per group per experiment; ATF3 (red) and DAPI (blue); Figure 6 h: ATF3 mRNA levels in DRGs, **P < 0.01 indicates significant difference between DRGs from WT mice and S100A9 KO mice;

[0049] Figure 6 Graph showing the results related to the production of CSF-1 by Gpr153+ cells triggering spinal cord microglia activation, wherein, Figure 6a: Representative images of DRG sections from WT and S100A9 KO mice, n = 5 animals per group and five DRG sections per experiment, gpr153 (red), CSF-1 (green) and DAPI (blue); Figure 6 b: CSF-1 mRNA levels in DRGs, **P < 0.01 indicates significant difference between DRGs from WT mice and S100A9 KO mice; Figure 6 c: Representative images of DRG sections from WT and S100A9 KO mice, n = 5 animals per group and five DRG sections per experiment, iba-1 (red) and DAPI (blue); Figure 7 d: IBA-1 positive cell counts in DRG sections, **P < 0.01 indicates significant difference between DRGs from WT mice and S100A9 KO mice;

[0050] Gene Schematic diagram showing the role of S100A9 in the development of peripheral neuropathic pain, nerve injury triggers sensory ganglion neuroimmunological response, characterized by neutrophil infiltration, elevated S100A9 expression in DRG dorsal membrane; S100A9 increases the excitability of DRG neurons by regulating GPR153-coupled TALK-1 and up-regulates CSF1, thereby further activating microglia in SDH and promoting the development of neuropathic pain. DETAILED DESCRIPTION

[0051] The application will be further described below in conjunction with specific examples. However, these examples are only limited to illustrate the application and are not used to limit the scope of the application. The test methods in the following examples without specific experimental conditions are usually carried out according to the conventional conditions or according to the conditions recommended by the manufacturer.

[0052] Example Correlation between S100A9 and CCI-induced neuropathic pain and the corresponding mechanism

[0053] I. Materials and methods

[0054] 1. Animal experiments

[0055] In this study, wild-type C57BL / 6 mice (8 weeks old, Beijing Huafukang Biotechnology Co., Ltd.) and S100A9 systemic knockout mice (purchased from Jiangsu Saiye Biotechnology Co., Ltd.) were selected. All experimental protocols were approved by the Animal Management Ethics Committee and strictly followed the relevant experimental animal guidelines. Experimental mice were raised in standard animal rooms (2-5 per cage, temperature 23±1℃, 12-hour light / dark cycle), with free access to food and water. 8-12 week-old male mice were selected for behavioral tests, and a random grouping design was used.

[0056] 2. Reagents and drugs

[0057] RIPA lysis buffer, protease inhibitor and phosphatase inhibitor were purchased from Elabscience. BCA protein quantification kit was purchased from Thermo Fisher Scientific. All reagents were prepared according to the manufacturer's instructions. S100A9 inhibitor, paquinimod (ABR-238901) was provided by Glpbio.

[0058] 3. CCI model establishment

[0059] The chronic constriction injury model of sciatic nerve was established according to previous studies. After the mice were anesthetized by 2%-3% isoflurane inhalation, the hair on the left thigh of the middle part was shaved. The left sciatic nerve was carefully separated at the middle and lower segments of the femur, and three loose ligations were performed at intervals of 1 mm using 5-0 chromium catgut. The operation was terminated immediately after observing a short muscle twitch. The sham operation group was only exposed to the sciatic nerve without ligation. The animals recovered for 2 days after the operation before behavioral testing.

[0060] 4. Behavioral test

[0061] Adult male mice were adapted to the environment for at least 2 days before testing. All behavioral tests were performed using a blind method. The mechanical pain threshold test used the Von Frey fiber method: before testing, the mice were placed in an acrylic cage (9x7x11 cm) with a metal mesh bottom for 30 minutes. A 0.16-2.0g gauge fiber was used to vertically stimulate the left hind foot bottom to bend the fiber for 6 seconds. Foot flexion reflex or obvious withdrawal response was considered positive. The stimulation intensity was increased from 0.16g, and the minimum fiber weight that induced a positive response was the mechanical injury threshold (expressed in mg logarithm). All tests were completed at different time points before and after the operation.

[0062] 5. Sample preparation and RNA sequencing

[0063] On the 7th day after the operation, 10 mice from each group were taken for the left L4-6 segment DRG tissue (about 20mg). The DRG samples were placed in RNAlater stabilizing solution (Solarbio) at room temperature for 24 hours, then stored at -20℃ until RNA extraction, library construction, and sequencing were completed. The transcriptome sequencing service was provided by Zhongke Xinsheng Biotechnology Co., Ltd.

[0064] 6. RNA extraction and real-time quantitative PCR

[0065] The mouse lumbar DRG (L4-6) and spinal cord dorsal horn tissue 20 mg was taken, and the RNA was extracted by RNeasy VR Plus Mini Kit according to the standard process. Reverse transcription was performed using a cDNA synthesis kit (EZ Bioscience). The quantitative PCR reaction system was 20 μL (containing 2 μL cDNA, 0.4 μL forward / reverse primer, and 10 μL SYBR dye), and was performed in a 96-well plate. The PCR primer sequence is shown in Table 1.

[0066] Table 1 primer list

[0067] Forward (5'-3') Reverse (5'-3') GAPDH CCTCGTCCCGTAGACAAAATG TGAGGTCAATGAAGGGGTCGT S100a9 GCATAACCACCATCATCGACAC TGCCATCAGCATCATACACTCC IL-1β GCTTCAGGCAGGCAGTATCA AATGGGAACGTCACACACCA IL-6 CCCCAATTTCCAATGCTCTCC CGCACTAGGTTTGCCGAGTA TNF-α ACCCTCACACTCACAAACCA ATAGCAAATCGGCTGACGGT Gpr153 TCCCGACTACGAGTGGAACGA CCGACAGGATGAAGGACACC Kcnk16 CCTGGCTCTGTTCCTGACCTT GGTCTGTGCCAACAACATAGTCC Csf1 CAGGAGTATTGCCAAGGAGGTG AGCGCATGGTCTCATCTATTATGTC Atf3 ACCTCCTGGGTCACTGGTATTTG TTCTTGTTTCGACACTTGGCA Figure 1

[0068] 7、Western Blot

[0069] After the experimental animals were anesthetized with sevoflurane, the L4-6 segment dorsal root ganglion (DRG) was quickly separated. The tissue sample was homogenized in RIPA lysis buffer containing protease / phosphatase inhibitor (Solarbio), and the protein concentration was determined by BCA method. 10 μg of protein was loaded per lane, and after 10% SDS-PAGE electrophoresis, it was transferred to a PVDF membrane (Merck Millipore). The membrane was blocked with Tris buffer containing 0.05% Tween-20 and 5% skim milk powder at room temperature for 1 hour, and then incubated at 4°C with the first antibody: S100A9 (1:1000, SAB 29664), IL-6 (1:1000, Immunoway YT5348), GPR153 (1:1000, BIOSS bs-16281R), and kcnk16 (1:1000, Affinity DF14438). After washing, the secondary antibody (goat anti-rabbit IgG 1:5000, SAB L3012) was added and incubated at room temperature for 1 hour, and the enhanced chemiluminescence substrate (Cell Signaling Technology) was used for development, and the band gray value was analyzed by Image J software.

[0070] 8、Paquinimod compound intervention (S100A9 inhibitor)

[0071] The CCI model mice were treated with S100A9 inhibitor ABR-238901 (Paquinimod, PAQ). This compound can block the binding of S100A9 to molecular targets, and the preparation is referred to the literature and instructions: 10% DMSO + 40% polyethylene glycol (PEG300) + 5% Tween 80 + 45% normal saline mixed solvent (solvent mixture). From the 3rd day after CCI modeling, ABR-238901 (10 mg / kg / day) was injected intraperitoneally for 5 consecutive days, and the control group was injected with the same volume of solvent mixture. Pain behavior was evaluated daily before and after treatment.

[0072] 9. Administration of recombinant mouse S100A9

[0073] The recombinant mouse S100A9 protein used in this experiment was constructed by Pujian Biotechnology (Wuhan) Co., Ltd., expressed in E. coli, and endotoxin-free (<1.0 EU / mg protein). Following the methods described in the literature, mice were anesthetized with sevoflurane. A 30G needle was inserted into the L5-L6 intervertebral space, and 5 μL of recombinant mouse S100A9 (100 ng) was slowly injected over 10 seconds. A control group was injected with an equal volume of PBS. Changes in nociceptive behavior were observed 3, 5, 7, and 24 hours after injection.

[0074] 10. Immunohistochemistry

[0075] L4-6 DRG were fixed with 4% paraformaldehyde in PBS at 4°C for 24 hours and then transferred to 30% sucrose in PBS at 4°C. After OCT embedding, 20 μm frozen sections were prepared and mounted on gelatin-coated slides. At least five animals were included in each group, and five DRG sections were obtained per mouse. All sections were blocked with 0.1% Triton X100 and 1% BSA at room temperature for 1 hour and incubated at 4°C with the following primary antibodies: S100A9 (1:100), Ly6G (1:100), GPR153 (1:200), KCNK16 (1:100), ATF3 (1:100, Immunoway YT0378), IBA1 (1:100, SAB 49668), and CSF-1 (1:100, Immunoway YT5553). After washing, secondary antibodies (1:400, green AF488-conjugated goat anti-rabbit SAB#L35193; 1:400, red AF405-conjugated goat anti-rabbit SAB#L35150) were added and incubated for 2 hours at room temperature in the dark. Slides were then mounted with DAPI anti-fluorescence quenching mounting medium (Solarbio). Double-labeled fluorescence images were acquired using a confocal microscope (Nikon) and quantitatively analyzed using ImageJ software.

[0076] 11. Statistical analysis

[0077] All experiments were randomized, and data are presented as mean ± standard error of the mean (SEM). Sample size was estimated based on previous experience with similar experiments, and power analysis was performed to verify its rationality. Normality was assessed using the Shapiro-Wilk test, and homogeneity of variance was assessed using the Levene test. Comparisons between two or more groups were performed using one-way analysis of variance (ANOVA) or the Kruskal-Wallis test, with post hoc testing for multiple comparisons. Two-way analysis of variance with the Bonferroni post hoc test was used to investigate two-factor effects. Mechanical pain threshold data were log-transformed to meet the assumptions of analysis of variance. Analyses were performed using GraphPad 10.1.2 software, and P < 0.05 was considered statistically significant.

[0078] II. Results

[0079] 1. Upregulation of S100A9 expression in DRG of CCI mice

[0080] Firstly, the development of mechanical allodynia, a core feature of neuropathic pain, was analyzed by using the chronic constriction injury (CCI) model of the sciatic nerve. Figure 1 a). There was no significant difference in the baseline mechanical threshold between the sham and CCI groups before operation. The CCI group showed a significant mechanical hypersensitivity compared with the sham group after operation, which reached a peak at day 7 ( Figure 1 b). The ipsilateral hind paw of CCI mice showed mechanical allodynia from day 3 to day 14, while the contralateral hind paw was not affected ( Figure 1 b). The mechanical threshold of the sham group remained unchanged, which ruled out the possibility that the hypersensitivity was caused by surgical trauma itself. These behavioral results confirmed the success of the CCI model.

[0081] We found that the mechanical pain sensitivity of mice reached a peak at day 7 after CCI operation ( Figure 1 b). Therefore, we chose to detect the expression of S100A9 and inflammatory factors in DRG and spinal cord tissues at day 7 after operation. Western blot results showed that the expression of S100A9 protein in L4-6 DRG was significantly increased ( Figure 1 c、 Figure 1 d), and qPCR detection confirmed that the mRNA level was synchronously upregulated ( Figure 1 e). At the same time, the expression of various inflammatory factors (TNF-a, IL-1b and IL-6) in DRG was also significantly increased ( Figure 1 f、 Figure 1 h). Notably, there was no obvious change in the expression of S100A9 mRNA in spinal cord tissue ( Figure 2 i). These results suggest that S100A9 may be involved in the regulation of neuropathic pain through peripheral ganglion (rather than central).

[0082] 2. Role of S100A9 in the development of pain

[0083] After observing the significant increase in S100A9 mRNA and protein expression in DRG of CCI mice, we further analyzed whether S100A9 was involved in the development of CCI-induced neuropathic pain. First, we established a CCI model in S100A9 knockout mice and detected the expression level of S100A9 gene in DRG. The results showed that compared with wild-type (WT) mice, the expression of S100A9 in L4-6 DRG of S100A9 knockout mice was significantly reduced at day 7 after CCI operation, which confirmed the effectiveness of gene knockout ( Figure 2 a).

[0084] Subsequently, we tested the changes of mechanical allodynia in S100A9 knockout and WT mice after CCI by Von Frey filament. Notably, the mechanical allodynia response in S100A9 knockout mice was significantly attenuated compared with WT mice after CCI Figure 2 b) To verify this finding, we treated WT mice with S100A9 inhibitor ABR-238901 after CCI, and the pain behavior was significantly improved in the treatment group compared with the placebo group Figure 2 c).

[0085] To further confirm this, we tested the ability of intrathecal injection of recombinant S100A9 protein (rS100A9) to induce mechanical allodynia. The results showed that rS100A9 could promote mechanical allodynia in untreated mice in a time- and dose-dependent manner Figure 2 d). Significant mechanical allodynia was observed 1-7 hours after a single injection, but there was no significant difference between the 100 ng and 300 ng doses.

[0086] In addition, we found that the inflammatory response was significantly attenuated in S100A9 knockout mice Figure 2 e, Figure 2 f, Figure 3 g). Specifically, the mRNA expression levels of IL-6, IL-1β, and TNF-α in the DRG of knockout mice were significantly lower than those in WT mice on day 7 after CCI. These results suggest that S100A9 is involved in CCI-induced mechanical allodynia by regulating inflammatory factors.

[0087] 3. S100A9 is mainly derived from neutrophils infiltrating the DRG

[0088] We performed Ly6G and CD11b immunohistochemical staining on the DRG sections of WT mice on day 7 after CCI. The results showed that a large number of myeloid cells (neutrophils and macrophages) infiltrated the DRG tissue after CCI Figure 3 a, Figure 3 b).

[0089] We performed double-label immunofluorescence staining of Ly6G and S100A9 on the DRG sections of WT mice on day 7 after CCI. The immunofluorescence results were consistent with the Western blotting results, and the expression of S100A9 in the ipsilateral DRG was significantly higher than that in the contralateral DRG in the model group Figure 3 c). Almost all S100A9-positive cells also expressed Ly6G, indicating that neutrophils are the main myeloid cell source of S100A9 Figure 4 c).

[0090] 4. S100A9 may participate in CCI-induced neuropathic pain by activating GPR153 / Kcnk16 pathway

[0091] To explore the role of S100A9 in CCI-induced neuropathic pain model and find other pathways involved in pain regulation, we analyzed the differential gene expression of the transcriptome in DRG of CCI model mice and S100A9 inhibitor treatment group mice Figure 4 a). There were 1046 differentially expressed genes in ipsilateral DRG compared with contralateral DRG of model mice at 7 days after CCI, of which 156 genes were up-regulated; while after treatment with S100A9 inhibitor ABR-238901, there were 799 significantly different genes compared with the placebo group, of which 372 genes were down-regulated. There were 48 genes showing opposite expression trends in the sequencing results of the two groups Figure 4 b). After screening, Figure 5 c shows the 20 genes with the most significant expression differences.

[0092] Our sequencing results showed that GPR153 expression in DRG of WT mice treated with ABR-238901 was significantly reduced (Table 2), indicating that GPR153 may be involved in S100A9-related neuropathic pain development. By double immunofluorescence staining of DRG tissue sections Figure 5 a), it was found that GPR153 and Kcnk16 had good colocalization in damaged DRG, and the protein expression levels of the two Figure 5 b, Figure 5 c, Figure 5 d) and mRNA transcription levels Figure 5 e, Figure 5 f) were significantly increased in damaged DRG. Further research found that GPR153 and Kcnk16 expression in DRG of S100A9 knockout mice after CCI was significantly reduced Figure 6 a-f). It was also detected that the expression of DRG injury marker ATF3 was increased in WT model group, while significantly reduced in S100A9 knockout mice, which was consistent with the sequencing data of S100A9 inhibitor treatment group (Table 2). These results suggest that S100A9 may participate in CCI-induced neuropathic pain process by activating GPR153 and Kcnk16 encoded ion channel TALK-1.

[0093] Table 2 Differential gene expression of DRGs between CCI model mice treated with S100A9 inhibitor ABR-238901 and placebo group CCI model mice

[0094]

[0095] 5. Activation of the GPR153 / Kcnk16 pathway can enhance pain responses by triggering spinal microglia activation

[0096] It is known that CSF-1 can activate spinal microglia. In this study, we found that CSF-1 expression was reduced in mice treated with S100A9 inhibitors (Table 2). From this we hypothesized that immune cells infiltrating the DRG enhance pain responses by secreting S100A9, possibly via activation of spinal microglia pathways. To this end, we evaluated the effect of S100A9 knock-out on CSF1 expression and spinal microglia activation.

[0097] In the DRG of S100A9 knock-out mice, CCI-induced upregulation of CSF-1 protein ( Figure 6 a) and mRNA ( Figure 6 b) expression was significantly attenuated. At the same time, CCI-induced upregulation of the microglia marker IBA1 in the spinal cord was also significantly suppressed ( Figure 6 c). By double-label immunofluorescence staining, we observed a significant colocalization of CSF-1 production with GPR153-positive cells ( Figure 7 a). These data suggest that activation of the GPR153 / Kcnk16 pathway in DRG neurons can further trigger spinal microglia activation, thus participating in the generation of neuropathic pain ( ​ ).

[0098] The above description of the embodiments is only used to understand the method of the present application and its core idea. It should be noted that for those skilled in the art, without departing from the principles of the present application, several improvements and modifications can be made to the present application, and these improvements and modifications will also fall within the scope of protection of the claims of the present application.

Claims

1. Use of S100A9 inhibitors in the preparation of drugs for preventing or treating neuropathic pain.

2. The use according to claim 1, characterized in that The neuropathic pain is induced by chronic constriction injury of the sciatic nerve.

3. The use according to claim 1, characterized in that The neuropathic pain includes mechanical hyperalgesia.

4. The use according to claim 1, characterized in that S100A9 inhibitors are agents that knock down the expression of the S100A9 gene.

5. The use according to claim 4, characterized in that The reagents for knocking out S100A9 gene expression include reagents used in Cre-lox recombination technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, and CRISPR / Cas9 technology.

6. The use according to claim 4, characterized in that The S100A9 inhibitor is an agent that inhibits the binding of S100A9 to a molecular target. Preferably, the S100A9 inhibitor is an inhibitor that inhibits the activity of the S100A9 protein.

7. The use according to claim 6, characterized in that The inhibitor for inhibiting the activity of S100A9 protein is ABR-238901.

8. The use according to claim 6, characterized in that The prevention or treatment of neuropathic pain includes regulating the expression of inflammatory factors IL-6, IL-1β, and TNF-α, regulating the expression of GPR153 and Kcnk16, regulating the expression of CSF-1, and activating spinal cord microglia.

9. The use according to claim 6, characterized in that The S100A9 is derived from infiltrating neutrophils.

10. A method for constructing an animal model of mechanical hyperalgesia, comprising intrathecal injection of recombinant S100A9 protein.