KASP primer group for distinguishing pinus parviflora and pinus bungeana as well as detection method and application of KASP primer group

Abstract

The invention provides a KASP primer group for distinguishing pinus parviflora and pinus bungeana as well as a detection method and application of the KASP primer group, and belongs to the technical field of gene detection. The method comprises the following steps: re-sequencing popular samples of pinus pumila and pinus bungeana, carrying out variation condition analysis on a sequence subjected to quality control, screening to obtain two SNP (Single Nucleotide Polymorphism) loci with distinction degree, and designing specific KASP primer groups aiming at the two loci, which are respectively shown as SEQ ID NO.1-3 and SEQ ID NO.4-6. Through verification and comparison of known materials, it is determined that when the KASP primer group is used for distinguishing the pinus parviflora and the pinus bungeana, the detected genotype has 100% consistency with the genotype of a known variety. The primer pair of the two SNP loci can be applied to identification of varieties of pinus parviflora and pinus bungeana independently or in a combined mode.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, in particular to a KASP primer set for distinguishing Pinus squamata and Pinus bungeana and a detection method and application thereof. BACKGROUND

[0002] Pinus squamata, also known as Pinus bungeana var. squamata, is a coniferous tree and a very small population plant of Pinus section Bungeanae in Pinaceae. There are only 35 wild individuals of this species in the world, all of which grow in the territory of Qiaojia County, Zhaotong City, Yunnan Province. As a key object of biodiversity protection, the protection of this species is of great importance. Over the past thirty years, the protection of Pinus squamata has achieved remarkable results through artificial seedling cultivation, ex situ conservation, and original habitat return.

[0003] Pinus bungeana is a tree species endemic to China and a plant of Pinus section Bungeanae in Pinaceae. This species is widely distributed and is widely cultivated as an important landscape tree in most parts of the country.

[0004] In the study of Pinus squamata, the tree species most closely related to it mainly include Pinus bungeana and Pinus wallichiana. It is worth noting that Pinus bungeana, as a widely distributed species, has been artificially planted in Sichuan, Yunnan, Guizhou and other provinces, and its distribution area is adjacent or overlaps with the original habitat and ex situ conservation groups of Pinus squamata in geography. For example, the ex situ conservation group of Pinus squamata is in the same city as the landscape cultivation group of Pinus bungeana, i.e. Kunming. This close coexistence, combined with the high similarity in morphology between the two tree species, makes it easy to confuse them by naked eye observation or traditional botanical identification methods, which poses a potential risk of confusion of the provenance of Pinus squamata, a rare and endangered species, and affects the protection of its genetic resources, management of its germplasm resources, and long-term protection.

[0005] In view of the limitations of the above morphological and traditional identification methods, it is crucial to develop a high-specificity identification method based on the genetic level. At present, although gene sequencing technology can provide species identification at the genetic level, its high cost and relatively long turnaround time make it difficult to provide an efficient, economical and rapid solution in scenarios such as large-scale population investigation, routine monitoring or rapid field identification. Therefore, there is still a lack of a simple, economical and rapid precise identification approach. SUMMARY

[0006] Therefore, the present application provides a KASP primer set for distinguishing Pinus squamata and Pinus bungeana and a detection method and application thereof.

[0007] In order to achieve the above-mentioned purposes, the present application provides the following technical solutions.

[0008] The present application provides a KASP primer set for distinguishing Pinus bungeana and Pinus bionii, which comprises at least one of the following primer sets:

[0009] The first primer set is used for amplifying the first SNP site;

[0010] The second primer set is used for amplifying the second SNP site;

[0011] The first upstream primer of the first SNP primer set is shown as SEQ ID NO. 1, the second upstream primer is shown as SEQ ID NO. 2, and the downstream primer is shown as SEQ ID NO. 3;

[0012] The first upstream primer of the second SNP primer set is shown as SEQ ID NO. 4, the second upstream primer is shown as SEQ ID NO. 5, and the downstream primer is shown as SEQ ID NO. 6;

[0013] The first SNP site is located at >chr04:434506971 on the chromosome, and the second SNP site is located at >chr10:1961560286 on the chromosome.

[0014] Preferably, the 5' end of the first upstream primer is connected with a FAM fluorescent group tag sequence, and the 5' end of the second upstream primer is connected with a HEX fluorescent group tag sequence.

[0015] The present application also provides a kit for distinguishing Pinus bungeana and Pinus bionii, comprising the KASP primer set.

[0016] The present application also provides a detection method for distinguishing Pinus bungeana and Pinus bionii, comprising the following steps:

[0017] S1. Extracting the genomic DNA of the sample to be tested;

[0018] S2. Using the extracted genomic DNA as a template, and using the SNP primer set to perform competitive allele-specific PCR amplification to obtain a PCR product;

[0019] S3. Distinguishing Pinus bungeana and Pinus bionii according to the fluorescence read in the competitive allele-specific PCR process or the genotype determination result of the amplification product:

[0020] If the fluorescence signal of the FAM group is read, it is determined to be Pinus bungeana; if the fluorescence signal of the HEX group is read, it is determined to be Pinus bionii;

[0021] When amplification is performed by using the first primer set, if the genotype of the amplification product is G:G, it is determined as Qiajia Pinus; if the genotype of the amplification product is A:A, it is determined as Pinus bungeana Zucc.

[0022] When amplification is performed by using the second primer set, if the genotype of the amplification product is G:G, it is determined as Qiajia Pinus; if the genotype of the amplification product is T:T, it is determined as Pinus bungeana Zucc.

[0023] Preferably, the reaction system of the competitive allele-specific PCR amplification is 10 μL: 5 μL of 2x v4Flu-ArmsMix, 4.5 μL of the genomic DNA of the sample to be tested, and 0.5 μL of mixed primers; the mixed primers are composed of the first upstream primer, the second upstream primer and the downstream primer.

[0024] Preferably, the initial concentration of the mixed primers is 10 μM; the molar ratio of the first upstream primer, the second upstream primer and the downstream primer is 1:1:3.

[0025] Preferably, the reaction procedure of the competitive allele-specific PCR amplification is as follows:

[0026] (1) pre-denaturation: 95℃, for 10 min;

[0027] (2) touchdown PCR cycle:

[0028] (2.1) 95℃, 15 s;

[0029] (2.2) 61℃, 45 s;

[0030] (2.3) repeat steps (2.1) and (2.2) for 10 cycles, and decrease 0.6℃ for each cycle at 61℃;

[0031] (3) normal PCR cycle:

[0032] (3.1) 95℃, 15 s;

[0033] (3.2) 55℃, 45 s;

[0034] (3.3) repeat steps (3.1) and (3.2) for 36 cycles;

[0035] (4) fluorescence reading: 30℃, for 30 s.

[0036] The application further provides the application of the KASP primer set in at least one of the following:

[0037] (1) in distinguishing or assisting in distinguishing Qiajia Pinus and Pinus bungeana Zucc;

[0038] (2) application in preparation of a kit for distinguishing Pinus strobus and Pinus bungeana;

[0039] (3) application in protection of Pinus dabeshanensis germplasm resources.

[0040] The application further provides application of the kit in at least one of the following:

[0041] (1) application in distinguishing or assisting in distinguishing Pinus dabeshanensis and Pinus bungeana;

[0042] (2) application in preparation of a kit for distinguishing Pinus strobus and Pinus bungeana;

[0043] (3) application in protection of Pinus dabeshanensis germplasm resources.

[0044] By adopting the technical scheme, the application has the following beneficial effects: the application screens two SNP sites with distinguishing degrees by resequencing Pinus dabeshanensis and Pinus bungeana population samples and analyzing variation of sequences that have undergone quality control, and designs specific KASP primer sets for the two sites, which are shown as SEQ ID NO. 1-3 and SEQ ID NO. 4-6 respectively. By comparison and verification of known materials, it is determined that the KASP primer sets of the application have 100% consistency between detected genotypes and genotypes of known varieties when distinguishing Pinus strobus and Pinus bungeana. The primer sets of the two SNP sites can be applied in identification of Pinus dabeshanensis and Pinus bungeana varieties alone or in combination. The KASP primer sets of the application can effectively solve the problem of confused species origin, and provide technical support for accurate protection and sustainable utilization of Pinus dabeshanensis. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 It is a SNP molecular marker genotyping fluorescence scatter plot in Example 2.

[0046] Figure 2 It is a population genotyping fluorescence scatter plot in Example 3. DETAILED DESCRIPTION

[0047] The technical scheme provided by the application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the application.

[0048] Example 1. KASP primer development

[0049] The molecular marker development work used 33 native Qiaojia five-needle pine samples (numbered YS01 to YS33) collected in Qiaojia County, Yunnan Province in February 2023, and white pine tissue samples (numbered BPS01 to BPS10) collected in Shanxi Province in July 2023. The 33 Qiaojia five-needle pine samples and 10 white pine samples were resequenced, and the resulting raw sequences were quality-controlled. The quality-controlled sequences were analyzed for variation, and single-nucleotide polymorphisms (SNPs) were identified, for which primers were designed.

[0050] Primer design principles:

[0051] 1. First, identify the target detection site and design an upstream typing primer on the left side of the site. The upstream typing primer should be about 46 bp in length.

[0052] 2. Add FAM and HEX adapter sequences to the 5' end of the designed upstream typing primer;

[0053] 3. Design the 3' end of the downstream common primer to avoid the SNP site base. The primer length is 29 bp. When synthesizing the downstream common primer, use the reverse complementary sequence.

[0054] 4. The length of the entire amplified product is about 120 bp.

[0055] According to the above principles, two sets of KASP primers were designed as follows:

[0056] The first SNP site is located at chr04:434506971 on the chromosome. The first primer set can detect the first SNP site. The first primer set includes a first upstream primer SNP1-F1, a second upstream primer SNP1-F2, and a common downstream primer SNP1-R. The sequences are as follows:

[0057] SNP1-F1:

[0058] 5'- GAAGGTGACCAAGTTCATGCT GGTTTACGTTTCTGATTGTGTGAG-3' (SEQ ID NO. 1);

[0059] SNP1-F2:

[0060] 5'- GAAGGTCGGAGTCAACGGATT AGGTTTACGTTTCTGATTGTGTGAA-3' (SEQ ID NO. 2);

[0061] SNP1-R: 5'-ATGTATCATCCTTATATCAAATTGCTTCT-3' (SEQ ID NO.3);

[0062] The target fragment to be amplified is:

[0063] SNP1-F1 / R amplified target fragment (with FAM fluorescent group):

[0064] 5'-GGTTTACGTTTCTGATTGTGTGAGTGAGAAGCAATTTGATATAAGGATGATACAT-3' (SEQ ID NO. 7);

[0065] SNP1-F2 / R amplified target fragment (with HEX fluorescent group):

[0066] 5'-AGGTTTACGTTTCTGATTGTGTGAATGAGAAGCAATTTGATATAAGGATGATACAT-3' (SEQ ID NO. 8).

[0067] Qiaojia five-needle pine and white pine can be distinguished based on the genotype of the amplified fragment or the fluorescent color emitted during amplification.

[0068] If the genotype of the amplified fragment is G:G, it is determined to be Pinus koraiensis (Q type); if the genotype of the amplified fragment is A:A, it is determined to be Pinus bungeana (B type).

[0069] If FAM fluorescence (green fluorescence) is emitted during amplification, it is determined to be Pinus koraiensis (Q type); if HEX fluorescence (yellow or orange fluorescence) is emitted during amplification, it is determined to be Pinus bungeana (B type).

[0070] The second SNP site is located at chr10:1961560286 on the chromosome. The second primer set can detect the second SNP site. The second primer set includes a first upstream primer SNP2-F1, a second upstream primer SNP2-F2, and a common downstream primer SNP2-R. The sequences are as follows:

[0071] SNP2-F1:

[0072] 5'- GAAGGTGACCAAGTTCATGCT AAGAATTAAGGGTGGAAATATAGG-3' (SEQ ID NO. 4);

[0073] SNP2-F2:

[0074] 5'- GAAGGTCGGAGTCAACGGATT AAAGAATTAAGGGTGGAAATATAGT-3' (SEQ ID NO. 5);

[0075] SNP2-R: 5'-CACCTAAAATCTTATGAAATTTGATAGCT-3' (SEQ ID NO. 6);

[0076] The target fragment to be amplified is:

[0077] Target fragment amplified by SNP2-F1 / R (with FAM fluorescent group):

[0078] 5'-AAGAATTAAGGGTGGAAATATAGGTATAGCTATCAAATTTCATAAGATTTTAG GTG-3' (SEQ ID NO.9);

[0079] SNP2-F2 / R amplified target fragment (with HEX fluorescent group):

[0080] 5'-AAAGAATTAAGGGTGGAAATATAGTTATAGCTATCAAATTTCATAAGATTTTA GGTG-3' (SEQ ID NO. 10);

[0081] Qiaojia five-needle pine and white pine can be distinguished based on the genotype of the amplified fragment or the fluorescent color emitted during amplification.

[0082] If the genotype of the amplified fragment is G:G, it is determined to be Pinus koraiensis (Q type); if the genotype of the amplified fragment is T:T, it is determined to be Pinus bungeana (B type).

[0083] If FAM fluorescence (green fluorescence) is emitted during amplification, it is determined to be Pinus koraiensis (Q type); if HEX fluorescence (yellow or orange fluorescence) is emitted during amplification, it is determined to be Pinus bungeana (B type).

[0084] Example 2. Verification of known genotypes of Pinus chinensis and Pinus bungeana using KASP primers

[0085] In this embodiment, there are 9 samples in total, numbered XNL01, XNL02, XNL03, XNL04, XNL05, XNL06, SBY01, SBY02 and SBY0, which were collected from Southwest Forestry University (XNL) and World Expo Park (SBY), respectively.

[0086] Genomic DNA was extracted from the above samples, and PCR amplification was performed using the genotyping PCR amplification kit FLU-ARMS for KASP 2XPCR mix V4 (Guangzhou Good Biotechnology Co., Ltd.) using the first primer set and the second primer set in Example 1. The PCR amplification reaction system is shown in Table 1, and the reaction procedure is shown in Table 2.

[0087] Table 1 PCR amplification system

[0088] Reagents Volume Genomic DNA sample to be tested (diluted 30-fold) 4.5 μL 2x v4 Flu-Arms Mix 5 μL Mix primers (Fl : F2 : R = 1 : 1 : 3) (10 μM) 0.5 μL Nuclease-free H2O Supplemented to 10 μL

[0089] Table 2 PCR amplification procedure

[0090]

[0091] The fluorescence type of the sample was read, and the amplified product was sequenced to determine the genotype, and the results are shown in Table 3, and the SNP molecular marker genotyping fluorescence scatter plot is shown in Figure 1 .

[0092] Table 3 Fluorescence type, detected genotype and known species genotype of each sample

[0093]

[0094] Note: Q represents the genotype of Qiaokou five-needle pine, and B represents the genotype of white-bark pine.

[0095] As shown in Table 1 and Figure 1 , the detection results of the KASP primer set of the present application for Qiaokou five-needle pine and white-bark pine genotypes are the same as the actual genotypes, and the consistency is 100%.

[0096] Example 3. Detection of unknown genotype population using KASP primer

[0097] This example uses 56 well-grown plants as the test population, and the sampling time is March 2025. The plant individuals are all from Kunming City. First, the professional personnel perform phenotypic identification, and among the 56 samples, 45 are Qiaokou five-needle pine samples and 11 are white-bark pine samples, which are shuffled and then subjected to genotype detection.

[0098] After extracting the genomic DNA of each sample, the first primer set and the second primer set in Example 1 are used for PCR amplification, and the reaction system and reaction procedure of PCR amplification are the same as in Example 2. The fluorescence type of the sample was read, and the amplified product was sequenced to determine the genotype, and the results are shown in Table 4, and the population genotyping fluorescence scatter plot is shown in Figure 2 .

[0099] Table 4 Identified genotype of unknown sample

[0100]

[0101]

[0102]

[0103] Note: Q represents the genotype of Qiaokou five-needle pine, and B represents the genotype of white-bark pine.

[0104] The results of the present embodiment show that the identification results of the KASP primer set developed in the experiment are completely consistent with the phenotype identification results. It can be seen that the KASP primer set developed in the experiment can effectively distinguish Qiaojia five-needle pine and white bark pine.

[0105] From the above embodiments, the KASP primer set for distinguishing Qiaojia five-needle pine and white bark pine, and the detection method and application thereof are provided. The KASP primer set can effectively distinguish Qiaojia five-needle pine and white bark pine, and the detected genotype has 100% consistency with the genotype of the known variety.

[0106] The above only describes the preferred embodiments of the present application, and it should be noted that for ordinary skilled persons in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A KASP primer set for distinguishing Pinus truncatula from Pinus bungeana, characterized in that: The KASP primer set includes at least one of the following primer sets: A first primer set is used to amplify the first SNP site; A second primer set is used to amplify a second SNP site; The first upstream primer of the first SNP primer set is shown as SEQ ID NO. 1, the second upstream primer is shown as SEQ ID NO. 2, and the downstream primer is shown as SEQ ID NO. 3; The first upstream primer of the second SNP primer set is shown as SEQ ID NO. 4, the second upstream primer is shown as SEQ ID NO. 5, and the downstream primer is shown as SEQ ID NO. 6; The location of the first SNP site on the chromosome is: >chr04:434506971, and the location of the second SNP site on the chromosome is: >chr10:1961560286.

2. The KASP primer set according to claim 1, characterized in that The 5' end of the first upstream primer is connected to a FAM fluorescent group tag sequence, and the 5' end of the second upstream primer is connected to a HEX fluorescent group tag sequence.

3. A kit for distinguishing Pinus truncatula from Pinus bungeana, characterized in that: The method comprises the KASP primer set according to claim 1 or 2.

4. A detection method for distinguishing between Pinus truncatula and Pinus bungeana, characterized in that: The following steps are involved: S1. Extract genomic DNA from the sample to be tested; S2. Using the extracted genomic DNA as a template, competitive allele-specific PCR amplification is performed using the SNP primer set according to claim 1 or 2 to obtain a PCR product; S3. Differentiate between Pinus truncatula and Pinus bungeana based on fluorescence readings or genotyping of amplified products during competitive allele-specific PCR: If the fluorescence signal of the FAM group is read, it is determined to be Qiaojia five-needle pine; If the fluorescence signal of the HEX group is read, it is determined to be white bark pine; When amplification is performed using the first primer set, if the genotype of the amplified product is G:G, it is determined to be Pinus truncatula; if the genotype of the amplified product is A:A, it is determined to be Pinus bungeana. When amplification is performed using the second primer set, if the genotype of the amplified fragment is G:G, it is determined to be Pinus truncatula; if the genotype of the amplified fragment is T:T, it is determined to be Pinus bungeana.

5. The detection method according to claim 4, characterized in that The reaction system for the competitive allele-specific PCR amplification is 10 μL: 5 μL of 2×v4 Flu-Arms Mix, 4.5 μL of genomic DNA of the sample to be tested, and 0.5 μL of mixed primers; the mixed primers consist of a first upstream primer, a second upstream primer, and a downstream primer.

6. The identification method according to claim 5, characterized in that The initial concentration of the mixed primer is 10 μM; the molar ratio of the first upstream primer, the second upstream primer and the downstream primer is 1:1:

3.

7. The identification method according to claim 6, characterized in that The reaction procedure of the competitive allele-specific PCR amplification is: (1) Pre-denaturation: 95°C for 10 min; (2) Touchdown PCR cycle: (2.1)95℃，15s； (2.2)61℃，45s； (2.3) Repeat steps (2.1) and (2.2) for 10 cycles, decreasing the temperature by 0.6°C per cycle at 61°C; (3) Conventional PCR cycle: (3.1)95℃，15s； (3.2)55℃，45s； (3.3) Repeat steps (3.1) and (3.2) for a total of 36 cycles; (4) Fluorescence reading: 30°C, 30 seconds.

8. Use of the KASP primer set according to claim 1 or 2 in at least one of the following: (1) Application in differentiating or assisting in differentiating Qiaojia five-needle pine and white pine; (2) Application in the preparation of a kit for distinguishing five-needle pine from white pine; (3) Application in the protection of Qiaojia five-needle pine germplasm resources.

9. Use of the kit according to claim 3 in at least one of the following: (1) Application in differentiating or assisting in differentiating Qiaojia five-needle pine and white pine; (2) Application in the preparation of a kit for distinguishing five-needle pine from white pine; (3) Application in the protection of Qiaojia five-needle pine germplasm resources.

Images