KASP primer set for distinguishing between Qiaojia five-needle pine and white pine, its detection method and application
By designing a KASP primer set and detection method to distinguish between Qiaojia five-needle pine and white pine, and utilizing competitive allele-specific PCR amplification and fluorescent tagging, we have achieved efficient, economical and rapid identification of the genotypes of the two species, solved the problem of source confusion, and supported the protection of rare species.
Patent Information
- Application Number
- CN202511090021.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2026-05-05
- Estimated Expiration
- 2045-08-05
AI Technical Summary
Existing technologies are insufficient for efficiently, economically, and quickly distinguishing between Qiaojia five-needle pine and white pine in large-scale population surveys, routine monitoring, or rapid field identification. The two are highly similar in morphology and easily confused, which affects the protection of genetic resources and management of germplasm resources of rare and endangered species.
A KASP primer set was designed to distinguish between Qiaojia five-needle pine and white pine. The genotypes of SNP sites were distinguished by competitive allele-specific PCR amplification and FAM and HEX fluorescent tags. Corresponding kits and detection methods were developed.
The system has enabled accurate identification of Qiaojia five-needle pine and white pine, with the test results showing 100% consistency with known varieties in genotype. This has effectively solved the problem of source confusion and provided technical support for the protection of rare species.
Smart Images

Figure CN120796560B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene detection technology, and in particular to a KASP primer set for distinguishing between Qiaojia five-needle pine and white pine, as well as its detection method and application. Background Technology
[0002] Qiaojia five-needle pine (Pinus squamata), scientifically known as Pinus bungeana, is an evergreen tree belonging to the Pinus section of the Pinaceae family. It is a very small population of this species, with only 35 wild individuals remaining worldwide, all located in Qiaojia County, Zhaotong City, Yunnan Province. As a key target for biodiversity conservation, its protection is of paramount importance. Over the past thirty years, significant progress has been made in the conservation of Qiaojia five-needle pine through artificial propagation, ex-situ conservation, and reintroduction to its native habitat.
[0003] Chinese white pine (Pinus bungeana) is a tree species endemic to my country, belonging to the genus Pinus, subgenus Pinus, section Pinus bungeana of the family Pinaceae. This species has a wide distribution and is widely cultivated as an important garden tree in most parts of the country.
[0004] Studies of *Pinus qiaojiaensis* have revealed that its closest relatives include *Pinus bungeana* and *Pinus tibetica*. Of particular concern is that *Pinus bungeana*, a widely distributed species, has been artificially planted in provinces such as Sichuan, Yunnan, and Guizhou. Its distribution area is geographically adjacent to or overlaps with the native habitat and ex-situ conservation populations of *Pinus qiaojiaensis*. For example, ex-situ conservation populations of *Pinus qiaojiaensis* are located in the same city—Kunming—as cultivated *Pinus bungeana*. This close coexistence, coupled with the high morphological similarity between the two species, makes them prone to confusion based solely on visual observation or traditional botanical identification methods. This poses a potential risk of provenance confusion and impacts the genetic resource protection, germplasm resource management, and long-term conservation of this rare and endangered species.
[0005] Given the limitations of morphological and traditional identification methods, developing a highly specific identification method based on the gene level is crucial. Currently, while gene sequencing technology can provide species identification at the gene level, its high cost and relatively long turnaround time make it difficult to provide a solution that is efficient, economical, and rapid in scenarios such as large-scale population surveys, routine monitoring, or rapid field identification. A simple, economical, and rapid accurate identification method is still lacking. Summary of the Invention
[0006] In view of this, the present invention provides a KASP primer set for distinguishing between Qiaojia five-needle pine and white pine, as well as its detection method and application.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] This invention provides a KASP primer set for distinguishing between Qiaojia five-needle pine and white pine, wherein the KASP primer set includes at least one of the following primer sets:
[0009] The first primer set is used to amplify the first SNP site;
[0010] The second primer set is used to amplify the second SNP site;
[0011] The first upstream primer of the first SNP primer set is shown in SEQ ID NO.1, the second upstream primer is shown in SEQ ID NO.2, and the downstream primer is shown in SEQ ID NO.3;
[0012] The first upstream primer of the second SNP primer set is shown in SEQ ID NO.4, the second upstream primer is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6;
[0013] The location of the first SNP locus on the chromosome is: >chr04:434506971, and the location of the second SNP locus on the chromosome is: >chr10:1961560286.
[0014] Preferably, the 5' end of the first upstream primer is connected to a FAM fluorescent tag sequence, and the 5' end of the second upstream primer is connected to a HEX fluorescent tag sequence.
[0015] The present invention also provides a kit for distinguishing between Qiaojia five-needle pine and white pine, including the aforementioned KASP primer set.
[0016] This invention also provides a detection method for distinguishing between Qiaojia five-needle pine and white pine, comprising the following steps:
[0017] S1. Extract genomic DNA from the sample to be tested;
[0018] S2. Using the extracted genomic DNA as a template, competitive allele-specific PCR amplification was performed using the SNP primer set described above to obtain PCR products;
[0019] S3. Differentiate between Qiaojia five-needle pine and white pine based on the genotyping results of the fluorescence or amplification products read during competitive allele-specific PCR:
[0020] If a fluorescence signal of the FAM group is detected, it is identified as Qiaojia five-needle pine; if a fluorescence signal of the HEX group is detected, it is identified as white pine.
[0021] When amplification is performed using the first primer set, if the genotype of the amplified product is G:G, it is identified as Qiaojia five-needle pine; if the genotype of the amplified product is A:A, it is identified as white pine.
[0022] When amplification is performed using the second primer set, if the genotype of the amplified fragment is G:G, it is identified as Qiaojia five-needle pine; if the genotype of the amplified fragment is T:T, it is identified as white pine.
[0023] Preferably, the reaction system for competitive allele-specific PCR amplification is 10 μL: 2×v4Flu-ArmsMix 5 μL, genomic DNA of the sample to be tested 4.5 μL, and mixed primers 0.5 μL; the mixed primers consist of a first upstream primer, a second upstream primer, and a downstream primer.
[0024] Preferably, the initial concentration of the mixed primers is 10 μM; the molar ratio of the first upstream primer, the second upstream primer, and the downstream primer is 1:1:3.
[0025] Preferably, the reaction procedure for the competitive allele-specific PCR amplification is as follows:
[0026] (1) Pre-denaturation: 95℃ for 10 min;
[0027] (2) Landing PCR cycle:
[0028] (2.1) 95℃, 15s;
[0029] (2.2) 61℃, 45s;
[0030] (2.3) Repeat steps (2.1) and (2.2) for 10 cycles, decreasing the temperature by 0.6°C per cycle from 61°C;
[0031] (3) Conventional PCR cycle:
[0032] (3.1) 95℃, 15s;
[0033] (3.2) 55℃, 45s;
[0034] (3.3) Repeat steps (3.1) and (3.2) for a total of 36 cycles;
[0035] (4) Fluorescence reading: 30℃, for 30s.
[0036] This invention also provides the application of the KASP primer set in at least one of the following:
[0037] (1) Application in distinguishing or assisting in the distinction between Qiaojia five-needle pine and white pine;
[0038] (2) Application in the preparation of a kit to distinguish between Japanese white pine and white pine;
[0039] (3) Application in the protection of germplasm resources of Qiaojia five-needle pine.
[0040] The present invention also provides the use of the kit in at least one of the following:
[0041] (1) Application in distinguishing or assisting in the distinction between Qiaojia five-needle pine and white pine;
[0042] (2) Application in the preparation of a kit to distinguish between Japanese white pine and white pine;
[0043] (3) Application in the protection of germplasm resources of Qiaojia five-needle pine.
[0044] By adopting the above technical solution, the present invention has the following beneficial effects: The present invention resequencing samples from Qiaojia five-needle pine and white pine populations, analyzing the variation of sequences that have undergone quality control, and screening for two distinguishable SNP loci. Specific KASP primer sets were designed for these two loci, as shown in SEQ ID NO. 1–3 and SEQ ID NO. 4–6, respectively. Through verification and comparison with known materials, the present invention confirmed that the genotypes detected using the KASP primer sets of the present invention have 100% consistency with the genotypes of known varieties when distinguishing between five-needle pine and white pine. The primer pairs for the two SNP loci of the present invention can be applied individually or in combination to the identification of Qiaojia five-needle pine and white pine varieties. The KASP primer sets of the present invention can effectively solve the problem of provenance confusion, providing technical support for the precise protection and sustainable utilization of Qiaojia five-needle pine. Attached Figure Description
[0045] Figure 1 This is a fluorescence scatter plot of SNP molecular marker gene typing in Example 2.
[0046] Figure 2 This is a scatter plot of fluorescence for population typing in Example 3. Detailed Implementation
[0047] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0048] Example 1. Development of KASP primers
[0049] The experimental materials used in the molecular marker development work were 33 native Qiaojia five-needle pine samples (numbered YS01–YS33) collected in Qiaojia County, Yunnan Province in February 2023, and white pine tissue samples (numbered BPS01–BPS10) collected in Shanxi Province in July 2023. Resequencing was performed on the 33 Qiaojia five-needle pine samples and 10 white pine samples, and the obtained raw sequences underwent quality control. Variation analysis was performed on the quality-controlled sequences to screen for SNP sites, and primers were then designed targeting these SNP sites.
[0050] Primer design principles:
[0051] 1. First, identify the target detection site and design an upstream genotyping primer to the left of the site. The upstream genotyping primer should be about 46 bp in length.
[0052] 2. Add FAM and HEX adapter sequences to the 5' end of the designed upstream typing primers, respectively;
[0053] 3. The 3' end of the downstream common primer is designed to avoid SNP sites, and the primer length is 29 bp. When synthesizing the downstream common primer, the reverse complementary sequence is used.
[0054] 4. The total length of the amplification product is approximately 120 bp.
[0055] Based on the above principles, the two sets of KASP primers designed are shown below:
[0056] The first SNP site is located on the chromosome at >chr04:434506971. The first primer set can detect the first SNP site. The first primer set includes the first upstream primer SNP1-F1, the second upstream primer SNP1-F2, and the common downstream primer SNP1-R, with the following sequences:
[0057] SNP1-F1:
[0058] 5'- GAAGGTGACCAAGTTCATGCT GGTTTACGTTTCTGATTGTGTGAG-3' (SEQ ID NO. 1);
[0059] SNP1-F2:
[0060] 5'- GAAGGTCGGAGTCAACGGATT AGGTTTACGTTTCTGATTGTGTGAA-3' (SEQ ID NO. 2);
[0061] SNP1-R: 5'-ATGTATCATCCTTATATCAAATTGCTTCT-3' (SEQ ID NO.3);
[0062] The target fragment to be amplified is:
[0063] The target fragment (with FAM fluorescent group) amplified by SNP1-F1 / R:
[0064] 5'-GGTTTACGTTTCTGATTGTGTGAGTGAGAAGCAATTTGATATAAGGATGATACAT-3' (SEQ ID NO. 7);
[0065] The target fragment (with HEX fluorescent group) amplified by SNP1-F2 / R:
[0066] 5'-AGGTTTACGTTTCTGATTGTGTGAATGAGAAGCAATTTGATATAAGGATGATACAT-3' (SEQ ID NO. 8).
[0067] Qiaojia five-needle pine and white pine can be distinguished based on the genotype of the amplified fragment or the fluorescent color emitted during amplification.
[0068] If the genotype of the amplified fragment is G:G, it is identified as Qiaojia five-needle pine (Q type); if the genotype of the amplified fragment is A:A, it is identified as white pine (B type).
[0069] If FAM fluorescence (green fluorescence) is emitted during amplification, it is identified as Qiaojia five-needle pine (Q type); if HEX fluorescence (yellow or orange fluorescence) is emitted during amplification, it is identified as white pine (B type).
[0070] The second SNP site is located at >chr10:1961560286 on the chromosome. The second primer set can detect the second SNP site. The second primer set includes the first upstream primer SNP2-F1, the second upstream primer SNP2-F2, and the common downstream primer SNP2-R, with the following sequences:
[0071] SNP2-F1:
[0072] 5'- GAAGGTGACCAAGTTCATGCT AAGAATTAAGGGTGGAAATATAGG-3' (SEQ ID NO. 4);
[0073] SNP2-F2:
[0074] 5'- GAAGGTCGGAGTCAACGGATT AAAGAATTAAGGGTGGAAATATAGT-3' (SEQ ID NO. 5);
[0075] SNP2-R: 5'-CACCTAAAATCTTATGAAATTTGATAGCT-3' (SEQ ID NO. 6);
[0076] The target fragment to be amplified is:
[0077] The target fragment (with FAM fluorescent group) amplified by SNP2-F1 / R:
[0078] 5'-AAGAATTAAGGGTGGAAATATAGGTATAGCTATCAAATTTCATAAGATTTTAG GTG-3' (SEQ ID NO.9);
[0079] The target fragment amplified by SNP2-F2 / R (with HEX fluorescent group):
[0080] 5'-AAAGAATTAAGGGTGGAAATATAGTTATAGCTATCAAATTTCATAAGATTTTA GGTG-3' (SEQ ID NO. 10);
[0081] Qiaojia five-needle pine and white pine can be distinguished based on the genotype of the amplified fragment or the fluorescent color emitted during amplification.
[0082] If the genotype of the amplified fragment is G:G, it is identified as Qiaojia five-needle pine (Q type); if the genotype of the amplified fragment is T:T, it is identified as white pine (B type).
[0083] If FAM fluorescence (green fluorescence) is emitted during amplification, it is identified as Qiaojia five-needle pine (Q type); if HEX fluorescence (yellow or orange fluorescence) is emitted during amplification, it is identified as white pine (B type).
[0084] Example 2. Verification of known genotypes of Qiaojia five-needle pine and white pine using KASP primers.
[0085] In this embodiment, a total of 9 samples were collected, numbered XNL01, XNL02, XNL03, XNL04, XNL05, XNL06, SBY01, SBY02 and SBY0, respectively, from Southwest Forestry University (XNL) and World Horticultural Exposition Park (SBY).
[0086] Genomic DNA was extracted from the above samples, and PCR amplification was performed using the FLU-ARMS for KASP 2XPCR mix V4 genotyping PCR amplification kit (Guangzhou Good Biotech Co., Ltd.) with the first and second primer sets from Example 1, respectively. The PCR amplification reaction system is shown in Table 1, and the reaction procedure is shown in Table 2.
[0087] Table 1 PCR amplification system
[0088] reagents volume Genomic DNA sample to be tested (diluted 30-fold) 4.5μL 2×v4Flu-ArmsMix 5μL Mixed primers (F1:F2:R = 1:1:3) (10 μM) 0.5μL <![CDATA[Nuclease-freeH2O]]> Add to 10μL
[0089] Table 2 PCR amplification program
[0090]
[0091] The fluorescence type of the samples was read, and the amplification products were sequenced to determine the genotype. The results are shown in Table 3. The fluorescence scatter plot of SNP molecular marker genotyping is shown in the figure. Figure 1 As shown.
[0092] Table 3. Fluorescence type, detected genotype, and known species genotype for each sample.
[0093]
[0094] Note: Q represents the genotype of Qiaojia five-needle pine, and B represents the genotype of white pine.
[0095] From Table 1 and Figure 1 It can be seen that the detection results of the genotypes of Qiaojia five-needle pine and white pine using the KASP primer set of the present invention are the same as their actual genotypes, with a consistency of 100%.
[0096] Example 3. Detection of populations with unknown genotypes using KASP primers
[0097] In this embodiment, 56 well-grown plants were used as the test population. The sampling time was March 2025, and all plants originated from Kunming City. First, phenotypic identification was performed by professionals. Among the 56 samples, 45 were Qiaojia five-needle pine samples and 11 were whitebark pine samples. After being shuffled, genotyping was performed.
[0098] After extracting genomic DNA from each sample, PCR amplification was performed using the first and second primer sets from Example 1, respectively. The PCR amplification reaction system and procedure were the same as in Example 2. The fluorescence patterns of the samples were read, and the amplification products were sequenced to determine the genotype. The results are shown in Table 4, and the population genotyping fluorescence scatter plot is shown below. Figure 2 As shown.
[0099] Table 4. Identification of Genotypes for Unknown Samples
[0100]
[0101]
[0102]
[0103] Note: Q represents the genotype of Qiaojia five-needle pine, and B represents the genotype of white pine.
[0104] The results of this embodiment show that the identification results of the KASP primer set developed in this experiment are completely consistent with the phenotypic identification results. Therefore, it is evident that the KASP primer set developed in this experiment can effectively distinguish between *Pinus tabuliformis* and *Pinus bungeana*.
[0105] As can be seen from the above embodiments, the present invention provides a KASP primer set for distinguishing between Qiaojia five-needle pine and white pine, as well as its detection method and application. The KASP primer set of the present invention can effectively distinguish between Qiaojia five-needle pine and white pine, and the detected genotype has 100% consistency with the genotype of known varieties.
[0106] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A KASP primer set for distinguishing between Qiaojia five-needle pine and white pine, characterized in that, The KASP primer set includes at least one of the following primer sets: The first SNP primer set is used to amplify the first SNP site; The second SNP primer set is used to amplify the second SNP site; The first upstream primer of the first SNP primer set is shown in SEQ ID NO.1, the second upstream primer is shown in SEQ ID NO.2, and the downstream primer is shown in SEQ ID NO.3; The first upstream primer of the second SNP primer set is shown in SEQ ID NO.4, the second upstream primer is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6; The location of the first SNP locus on the chromosome is: >chr04:434506971, and the location of the second SNP locus on the chromosome is: >chr10:1961560286.
2. A reagent kit for distinguishing between Qiaojia five-needle pine and white pine, characterized in that, Includes the KASP primer set as described in claim 1.
3. A detection method for distinguishing between Qiaojia five-needle pine and white pine, characterized in that, Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the extracted genomic DNA as a template, competitive allele detection is performed using the SNP primer set described in claim 1. Gene-specific PCR amplification was performed to obtain PCR products. S3. Differentiate between Qiaojia five-needle pine and white pine based on the genotyping results of the fluorescence or amplification products read during competitive allele-specific PCR: If the fluorescence signal of the FAM group is read, it is identified as Qiaojia five-needle pine; If a fluorescence signal of the HEX group is detected, it is identified as white pine. When amplification is performed using the first SNP primer set, if the genotype of the amplification product is G:G, it is identified as Qiaojia five-needle pine; if the genotype of the amplification product is A:A, it is identified as white pine. When amplification is performed using the second SNP primer set, if the genotype of the amplified fragment is G:G, it is identified as Qiaojia five-needle pine; if the genotype of the amplified fragment is T:T, it is identified as white pine.
4. The detection method according to claim 3, characterized in that, The reaction system for competitive allele-specific PCR amplification is 10 μL: 5 μL of 2×v4 Flu-Arms Mix, 4.5 μL of genomic DNA from the sample to be tested, and 0.5 μL of mixed primers; the mixed primers consist of a first upstream primer, a second upstream primer, and a downstream primer.
5. The detection method according to claim 4, characterized in that, The initial concentration of the mixed primers was 10 μM; the molar ratio of the first upstream primer, the second upstream primer, and the downstream primer was 1:1:
3.
6. The detection method according to claim 5, characterized in that, The reaction procedure for the competitive allele-specific PCR amplification is as follows: (1) Pre-denaturation: 95℃ for 10 min; (2) Landing PCR cycle: (2.1)95℃,15s; (2.2)61℃,45s; (2.3) Repeat steps (2.1) and (2.2) for 10 cycles, decreasing the temperature by 0.6°C per cycle from 61°C; (3) Conventional PCR cycle: (3.1)95℃,15s; (3.2)55℃,45s; (3.3) Repeat steps (3.1) and (3.2) for a total of 36 cycles; (4) Fluorescence reading: 30℃, for 30s.
7. The use of the KASP primer set according to claim 1 in at least one of the following: (1) Application in distinguishing or assisting in the distinction between Qiaojia five-needle pine and white pine; (2) Application in the preparation of a kit to distinguish between Qiaojia five-needle pine and white pine; (3) Application in the protection of germplasm resources of Qiaojia five-needle pine.
8. The use of the kit according to claim 2 in at least one of the following: (1) Application in distinguishing or assisting in the distinction between Qiaojia five-needle pine and white pine; (2) Application in the preparation of a kit to distinguish between Qiaojia five-needle pine and white pine; (3) Application in the protection of germplasm resources of Qiaojia five-needle pine.
Citation Information
Patent Citations
SNP locus primer combination for identifying pinus bungeana germplasm resources and application
CN112226433A
Development and application of molecular marker for identifying female parent of pine tree
CN119506454A