SNP primer group for identifying subpopulation of eastern slope of qiaojia five-needle pine and identification method and application thereof

By designing SNP primer sets and identification methods for the Dongpo subpopulation of Qiaojia five-needle pine, and utilizing competitive allele-specific PCR amplification and fluorescent tags, the problem of difficult source identification in existing technologies has been solved, enabling rapid and accurate genotyping identification and supporting the protection and management of germplasm resources.

CN120536624BActive Publication Date: 2025-12-09KUNMING INST OF BOTANY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510779750.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-12-09
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

Existing technologies lack simple, economical, and rapid methods to distinguish different genotypes of Qiaojia five-needle pine, especially when the seed source is unclear. It is difficult to efficiently distinguish the germplasm of artificially bred individuals, leading to difficulties in germplasm tracking and management, and affecting the maintenance of genetic diversity.

Method used

A primer set for the East and West slope subpopulations of *Pinus fiveneedle* in Qiaojia County was designed. Genotypes were rapidly identified by competitive allele-specific PCR amplification combined with FAM and HEX fluorescent tags, including primer sets for the first to fifth SNP sites and their identification methods.

Benefits of technology

This method enables rapid, accurate, and low-cost identification of subpopulations of *Pinus five-needle* on the east and west slopes of Qiaojia County, simplifies provenance identification, and supports the protection and management of germplasm resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536624B_ABST
    Figure CN120536624B_ABST
Patent Text Reader

Abstract

The application provides a SNP primer group for identification of Qiaojia Pinus strobiformis east-west slope subpopulation, and an identification method and application thereof, and belongs to the technical field of molecular markers. Five SNP primer groups are designed for five SNP sites of Qiaojia Pinus strobiformis. The SNP primer group comprises a first upstream primer, a second upstream primer and a downstream primer. The SNP primer group can quickly identify the Qiaojia Pinus strobiformis east-west slope subpopulation, and has the advantages of accuracy, rapidness, low cost, short identification period, simple operation and the like, and has important application value in the protection and management of Qiaojia Pinus strobiformis germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, and particularly relates to a SNP primer group for identifying the east-west slope subpopulation of Pinus squamata Xiang W. Li, a method for identifying the same and application thereof. BACKGROUND

[0002] Pinus squamata Xiang W. Li, also known as Pinus squamata, is a coniferous tree belonging to Pinacea and Pinus squamata group, and is a very small population plant of Pinus squamata sub-group. At present, there are only 35 wild Pinus squamata. The wild population of Pinus squamata mainly includes two subpopulations, namely, the east slope subpopulation and the west slope subpopulation, based on geographical distribution and genetic differentiation. For the past 30 years, through artificial seedling cultivation, ex-situ conservation, and original habitat return, the protection of Pinus squamata has achieved certain results. However, in the protection research of Pinus squamata, a major challenge currently faced is how to efficiently distinguish the provenance (east or west slope original population) of artificially propagated individuals without clear seed sources, so as to achieve precise protection of different genotypes and maintain the genetic diversity of artificial conservation plots. At present, this task relies on relatively expensive gene sequencing technology, and there is a lack of simple, economical and rapid alternative methods. In the process of protecting very small population plants, avoiding inbreeding depression is one of the key problems. However, there is currently no effective method to efficiently distinguish different genotypes of Pinus squamata.

[0003] Artificial propagation is considered an indispensable strategy in the protection of Pinus squamata. At present, seedling cultivation mainly relies on second-generation trees as seed sources. However, the source of these second-generation trees is often unclear, which brings difficulties to the tracking and management of seed sources. Therefore, a technology for quickly and efficiently determining the seed source through genotypes is particularly important. SUMMARY

[0004] Therefore, the present application provides a SNP primer group for identifying the east-west slope subpopulation of Pinus squamata and a method for identifying the same and application thereof.

[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:

[0006] The present application provides a SNP primer group for identifying the east-west slope subpopulation of Pinus squamata, which comprises at least one of the following primer groups:

[0007] The first SNP primer group is used for amplifying a first SNP site;

[0008] The second SNP primer group is used for amplifying a second SNP site;

[0009] The third SNP primer group is used for amplifying a third SNP site;

[0010] a fourth SNP primer set for amplifying a fourth SNP site;

[0011] a fifth SNP primer set for amplifying a fifth SNP site;

[0012] the first upstream primer of the first SNP primer set is shown as SEQ ID NO. 1, the second upstream primer is shown as SEQ ID NO. 2, and the downstream primer is shown as SEQ ID NO. 3;

[0013] the first upstream primer of the second SNP primer set is shown as SEQ ID NO. 4, the second upstream primer is shown as SEQ ID NO. 5, and the downstream primer is shown as SEQ ID NO. 6;

[0014] the first upstream primer of the third SNP primer set is shown as SEQ ID NO. 7, the second upstream primer is shown as SEQ ID NO. 8, and the downstream primer is shown as SEQ ID NO. 9;

[0015] the first upstream primer of the fourth SNP primer set is shown as SEQ ID NO. 10, the second upstream primer is shown as SEQ ID NO. 11, and the downstream primer is shown as SEQ ID NO. 12;

[0016] the first upstream primer of the fifth SNP primer set is shown as SEQ ID NO. 13, the second upstream primer is shown as SEQ ID NO. 14, and the downstream primer is shown as SEQ ID NO. 15.

[0017] Preferably, the 5' end of the first upstream primer is connected with a FAM fluorescent group tag sequence, and the 5' end of the second upstream primer is connected with a HEX fluorescent group tag sequence.

[0018] The present application also provides a kit for identifying the SNP of the Qiaohua Pinus strobiformis east-west slope subpopulation, comprising the SNP primer set.

[0019] The present application also provides a method for identifying the Qiaohua Pinus strobiformis east-west slope subpopulation, characterized in that the method comprises the following steps:

[0020] S1. extracting the genomic DNA of the Qiaohua Pinus strobiformis sample to be tested;

[0021] S2. using the genomic DNA of the Qiaohua Pinus strobiformis sample to be tested as a template, performing competitive allele-specific PCR amplification with the SNP primer set to obtain a PCR product;

[0022] S3. Genotyping and east-west slope subpopulation identification according to reading fluorescence: if the fluorescence signal of FAM group is read, it is determined as west slope subpopulation genotype (WW type), if the fluorescence signal of HEX group is read, it is determined as east slope subpopulation genotype (EE type), if the fluorescence signals of HEX and FAM are read, it is determined as hybrid genotype (EW type).

[0023] Preferably, the reaction system of the competitive allele-specific PCR amplification is 10 μL: 1.2×v4 Flu-Arms Mix: 5 μL, genomic DNA of the Pinus squamata Qiaojia sample to be tested 4.5 μL, mixed primers 0.5 μL; the mixed primers are composed of the first upstream primer, the second upstream primer and the downstream primer.

[0024] Preferably, the initial concentration of the mixed primers is 10 μM; the molar ratio of the first upstream primer, the second upstream primer and the downstream primer is 1:1:3.

[0025] Preferably, the reaction procedure of the competitive allele-specific PCR amplification is as follows:

[0026] (1) initial denaturation: 95℃, for 10 min;

[0027] (2) 2. touchdown PCR cycle:

[0028] (2.1) 195℃, 15 s;

[0029] (2.2) 61℃, 45 s;

[0030] (2.3) repeat steps (2.1) and (2.2) for 10 cycles, and decrease 0.6℃ for each cycle at 61℃.

[0031] (3) regular PCR cycle:

[0032] (3.1) 95℃, 15 s;

[0033] (3.2) 55℃, 45 s;

[0034] (3.3) repeat steps 3.1 and 3.2 for 36 cycles.

[0035] The application also provides the application of the SNP primer set in at least one of the following:

[0036] (1) in identifying or assisting in identifying the east-west slope subpopulation of Pinus squamata;

[0037] (2) in preparing a kit for identifying the east-west slope subpopulation of Pinus squamata;

[0038] (3) in molecular marker breeding of Pinus squamata.

[0039] (4) In the application of the Pinus squamaonastica west slope subpopulation in the protection of germplasm resources.

[0040] The application also provides the application of the kit in at least one of the following:

[0041] (1) In the identification or auxiliary identification of the Pinus squamaonastica west slope subpopulation;

[0042] (2) In the molecular marker breeding of Pinus squamaonastica;

[0043] (3) In the application of the Pinus squamaonastica west slope subpopulation in the protection of germplasm resources.

[0044] By adopting the above technical scheme, the SNP primer set of the application can quickly identify the Pinus squamaonastica west slope subpopulation, and has the advantages of accuracy, rapidness, low cost, short identification period, simple operation and the like, and has important application value in the protection and management of Pinus squamaonastica germplasm resources. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 It is the SNP molecular marker genotyping fluorescence scatter plot of 12 samples in Example 3.

[0046] Figure 2 It is the SNP molecular marker genotyping fluorescence scatter plot of 54 Pinus squamaonastica test populations in Example 4. DETAILED DESCRIPTION

[0047] The technical solutions provided by the application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the application.

[0048] Example 1. KASP primer development

[0049] The experimental material used in the development of molecular markers is 33 original Pinus squamaonastica samples (numbered YS01-YS33) collected in the laboratory before, which were collected in February 2023 in Youshan National Nature Reserve, Zhaotong City, Yunnan Province. The samples of the above-mentioned 33 original Pinus squamaonastica were re-sequenced, the obtained original sequences were quality controlled, and the sequences that had undergone quality control were analyzed for variation, and SNP sites were screened out. The SNP sites screened out were designed primers.

[0050] Primer design principles:

[0051] 1. First, the target detection site is determined, and the upstream typing primer is designed on the left side of the site, and the length of the upstream typing primer is about 24 bp;

[0052] 2. Add FAM and HEX linker sequence to the 5' end of the designed upstream typing primer, respectively;

[0053] 3. Design the 3' end of the downstream common primer to avoid the SNP site base, and the length of the primer is 29 bp. When synthesizing the downstream common primer, the reverse complementary sequence is used.

[0054] 4. The length of the entire amplification product is 60-120 bp.

[0055] According to the above principles, five groups of SNP primers are designed as follows:

[0056] The first SNP site is located at >chr03:1894841732 on the chromosome.

[0057] SNP1-F1:

[0058] 5'- AGAGTTTTTCTGGATCAACCTGAAG-3' (SEQ ID NO. 1); GAAGGTGACCAAGTTCATGCT SNP1-F2:

[0059] 5'- AGAGTTTTTCTGGATCAACCTGAAT-3' (SEQ ID NO. 2);

[0060] GAAGGTCGGAGTCAACGGATT SNP1-R: 5'-GTGAATCTGTGGAATCAAATAGTCTCCTC-3' (SEQ ID NO. 3).

[0061] The amplified target fragment is:

[0062] AGAGTTTTTCTGGATCAACCTGAAGTGGAACGAGGAGACTATTTGATTCCACAGATTCAC (SEQ ID NO. 16);

[0063] AGAGTTTTTCTGGATCAACCTGAATTGGAACGAGGAGACTATTTGATTCCACAGATTCAC (SEQ ID NO. 17).

[0064] If the genotype is T:T, it is determined as the genotype of the Dongpo subpopulation (EE type); the genotype T:G is determined as the hybrid genotype (EW type); and the genotype G:G is determined as the genotype of the Xipo subpopulation (WW type). Or HEX fluorescence, it is determined as the genotype of the Dongpo subpopulation (EE type); the mixed fluorescence results of HEX and FAM determine the hybrid genotype (EW type); and FAM fluorescence determines the genotype of the Xipo subpopulation (WW type).

[0065] If the genotype is T:T, it is determined as the genotype of the Dongpo subpopulation (EE type); the genotype T:G is determined as the hybrid genotype (EW type); and the genotype G:G is determined as the genotype of the Xipo subpopulation (WW type). Or HEX fluorescence, it is determined as the genotype of the Dongpo subpopulation (EE type); the mixed fluorescence results of HEX and FAM determine the hybrid genotype (EW type); and FAM fluorescence determines the genotype of the Xipo subpopulation (WW type). ​

[0066] The second SNP site is located at > chr03:2067283962 on the chromosome

[0067] SNP2-F1: 5'- CGACGATGTAGAGATGTTGAAGTTT-3' (SEQ ID NO. 4); GAAGGTGACCAAGTTCATGCT

[0068] SNP2-F2: 5'- CGACGATGTAGAGATGTTGAAGTTA-3' (SEQ ID NO. 5); GAAGGTCGGAGTCAACGGATT

[0069] SNP2-R: 5'- GCATTGAGGCAAATAAGTGGGTTTTGTGG-3' (SEQ ID NO. 6);

[0070] The amplified target fragment is:

[0071] CGACGATGTAGAGATGTTGAAGTTTTCCCAACCCACAAAACCCACTTATTTGCCTCAATGC (SEQ ID NO. 18);

[0072] CGACGATGTAGAGATGTTGAAGTTATCCCAACCCACAAAACCCACTTATTTGCCTCAATGC (SEQ ID NO. 19).

[0073] Genotype A: A, determined as the genotype of the Dongpo subpopulation (EE type); genotype A: T, determined as a hybrid genotype (EW type); genotype T: T, determined as the genotype of the Xipo subpopulation (WW type). Or HEX fluorescence, determined as the genotype of the Dongpo subpopulation (EE type); HEX and FAM mixed fluorescence results, determined as a hybrid genotype (EW type); FAM fluorescence, determined as the genotype of the Xipo subpopulation (WW type).

[0074] The third SNP site is located at > chr04:2281349986 on the chromosome

[0075] SNP3-F1: 5'- CAAATGTCTGTAAGAGACACAGTTG-3' (SEQ ID NO. 7); GAAGGTGACCAAGTTCATGCT

[0076] SNP3-F2: 5'- CAAATGTCTGTAAGAGACACAGTTT-3' (SEQ ID NO. 8); GAAGGTCGGAGTCAACGGATT

[0077] ​​​​SNP3-R: 5'-TCTTGGTTAATCCAACAATCATTGCATTC-3' (SEQ ID NO. 9).

[0078] The amplified target fragment is:

[0079] CAAATGTCTGTAAGAGACACAGTTGCGTGGAATGCAATGATTGTTGGATTAACCAAGA (SEQ ID NO. 20);

[0080] CAAATGTCTGTAAGAGACACAGTTTCGTGGAATGCAATGATTGTTGGATTAACCAAGA (SEQ ID NO. 21).

[0081] Genotype T:T, determined as the genotype of the Dongpo subpopulation (EE type); genotype T:G, determined as the heterozygous genotype (EW type); genotype G:G, determined as the genotype of the Xipo subpopulation (WW type). Or HEX fluorescence, determined as the genotype of the Dongpo subpopulation (EE type); HEX and FAM mixed fluorescence results, determined as the heterozygous genotype (EW type); FAM fluorescence, determined as the genotype of the Xipo subpopulation (WW type).

[0082] The fourth SNP site is located at >chr06:2125520768 on the chromosome

[0083] SNP4-F1: 5'- GAAGGTGACCAAGTTCATGCT AAGGTGGAATCACGAGATAAGAAAT-3' (SEQ ID NO. 10);

[0084] SNP4-F1: 5'- GAAGGTCGGAGTCAACGGATT AAGGTGGAATCACGAGATAAGAAAG-3' (SEQ ID NO. 11);

[0085] SNP4-R: 5'-AATATTAGGTTGGTCATCGACCTGACAAG-3' (SEQ ID NO. 12).

[0086] The amplified target fragment is:

[0087] AAGGTGGAATCACGAGATAAGAAATTGGATACTTGTCAGGTCGATGACCAACCTAATATT (SEQ ID NO. 22);

[0088] AAGGTGGAATCACGAGATAAGAAAGTGGATACTTGTCAGGTCGATGACCAACCTAATATT (SEQ ID NO. 23).

[0089] Genotype G:G, determined as the genotype of the East Slope subpopulation (EE type); genotype G:T, determined as the heterozygous genotype (EW type); genotype T:T, determined as the genotype of the West Slope subpopulation (WW type). Or HEX fluorescence, determined as the genotype of the East Slope subpopulation (EE type); HEX and FAM mixed fluorescence results, determined as the heterozygous genotype (EW type); FAM fluorescence, determined as the genotype of the West Slope subpopulation (WW type).

[0090] The position of the fifth SNP site on the chromosome is > chr07:365412684

[0091] SNP5-F1: 5'- AAACACACTAAAATGGAGTTACCAC-3' (SEQ ID NO. 13); GAAGGTGACCAAGTTCATGCT

[0092] SNP5-F2: 5'- AAACACACTAAAATGGAGTTACCAG-3' (SEQ ID NO. 14); GAAGGTCGGAGTCAACGGATT

[0093] SNP5-R: 5'- TCGAGAAGCATCTCCTTCTCTTCGATCTC-3' (SEQ ID NO. 15).

[0094] The amplified target fragment is:

[0095] AAACACACTAAAATGGAGTTACCACGCTATGGAGATCGAAGAGAAGGAGATGCTTCTCGA (SEQ ID NO. 24);

[0096] AAACACACTAAAATGGAGTTACCAGGCTATGGAGATCGAAGAGAAGGAGATGCTTCTCGA (SEQ ID NO. 25).

[0097] Genotype G:G, determined as the genotype of the East Slope subpopulation (EE type); genotype G:C, determined as the heterozygous genotype (EW type); genotype C:C, determined as the genotype of the West Slope subpopulation (WW type). Or HEX fluorescence, determined as the genotype of the East Slope subpopulation (EE type); HEX and FAM mixed fluorescence results, determined as the heterozygous genotype (EW type); FAM fluorescence, determined as the genotype of the West Slope subpopulation (WW type).

[0098] ​​In the above primer set, the underlined part of the first upstream primer is a FAM fluorescent group tag sequence, and the underlined part of the second upstream primer is a HEX fluorescent group tag sequence.

[0099] Example 2. Genotyping of Pinus squamata using KASP primers

[0100] Experimental materials: Fresh needle tissue samples of Pinus squamata generation 2 and generation 3 were selected. Generation 2 samples were collected in the botanical garden of Kunming Institute of Botany, and generation 3 samples were collected in the nursery. A total of 17 samples were used, and 2 mL centrifuge tubes were used for storage.

[0101] Step 1: Extract RNA

[0102] 1. After grinding the Pinus squamata leaves in liquid nitrogen, collect ≤100 mg of plant sample into a centrifuge tube, add 500 μL of RBBuffer / 10 μL of β-mercaptoethanol, and immediately vortex to mix.

[0103] 2. Fit the gDNAFilter filter column into a 2 mL collection tube, transfer the mixture to the gDNAFilter filter column, and centrifuge at 14,000 g for 5 min at room temperature.

[0104] 3. Transfer the filtrate to a new 1.5 mL centrifuge tube, add 0.5 times the volume of anhydrous ethanol, vortex for 20 s at high speed, and mix. If there is precipitation, use a gun to hit 10-15 times;

[0105] 4. Fit the HiBind R RNAMini binding column into a 2 mL collection tube, transfer 700 μL of the mixture from step 3 to the HiBind RRNAMini binding column, centrifuge at 12,000 x g for 1 min at room temperature, and discard the filtrate;

[0106] 5. Repeat step 4 until all the mixture is transferred through the column;

[0107] 6. Fit the HiBind B RNAMini binding column into the same 2 mL collection tube, add 400 μL of RWFWash Buffer, centrifuge at 10,000 x g for 30 s at room temperature, and discard the filtrate;

[0108] 7. Fit the HiBind RRNAMini binding column into the same 2 mL collection tube, add 500 μL of RNAWash Buffer I II (previously diluted with anhydrous ethanol), centrifuge at 10,000 x g for 30 s at room temperature, and discard the filtrate;

[0109] 8. Repeat step 7;

[0110] 9. Fit the HiBind R RNA Mini Binding Column into the same 2 mL collection tube, centrifuge at maximum speed for 2 min at room temperature, and discard the HiBind R RNA Mini Binding Column matrix;

[0111] 10. Fit the HiBind R RNA Mini Binding Column into a new 1.5 mL centrifuge tube, take 50-100 μL DEPC Water, accurately add to the center of the HiBind R RNA Mini Binding Column membrane, and place at room temperature for 2 min, centrifuge at 10,000 x g for 1 min at room temperature, and elute the RNA;

[0112] 11. Nanodrop and Qbuit and electrophoresis quality control.

[0113] Second step, RNA quality detection:

[0114] Use the NanoPhotometer Spectrophotometer to detect the purity of the sample (IMPLEN, CA, USA);

[0115] Use the Agilent 2100 RNA Nano 6000 Assay Kit (Agilent Technologies, CA, USA) to detect the integrity of the RNA sample.

[0116] In the present application, the quality and purity of the RNA sample of the test C. przewalskii germplasm resource must meet the subsequent reverse transcription and PCR (RT-qPCR) typing requirements. The specific standard is as follows:

[0117] The total RNA samples were strictly controlled in quality before used for subsequent genotyping experiments. The RNA concentration was determined by Qubit 3.0 Fluorometer (Life Technologies, Carlsbad, CA, USA) with the qualified standard set as ≥ 50 ng / μL to ensure sufficient starting amount for subsequent reverse transcription reaction. The purity of RNA samples was evaluated by NanoDrop One Spectrophotometer (NanoDrop Technologies, Wilmington, DE) through detecting the A260 / A280 and A260 / A230 ratios. The qualified A260 / A280 ratio should be between 1.8-2.2 and the A260 / A230 ratio should be between 1.8-2.5 to exclude the potential inhibitory effect of protein, salt ions or organic solvent residues on downstream enzymatic reactions. RNA integrity was the key to the success of genotyping experiments, therefore, all RNA samples used for genotyping were evaluated by Agilent 2100 Bioanalyzer and required RIN (RNA Integrity Number) value to reach ≥ 7.0 to ensure the integrity of RNA samples, which was beneficial to accurate reverse transcription and subsequent typing reaction. In addition, to completely exclude the interference of genomic DNA contamination on the typing results, No-RT control was set for each RNA sample for qPCR detection, and the qualified standard was that No-RT control had no amplification signal within 40 cycles to ensure that the detected typing signal was specifically derived from RNA reverse transcription cDNA.

[0118] Step 3, library construction and preparation

[0119] After the sample detection was qualified, 1-2 ug of total RNA was taken from each sample as the starting material to construct the transcriptome sequencing library. According to the operation instruction of VAHTS Universal V6 RNA-seq Library Prep Kit for Ilumina (NR604-01 / 02), different index tags were selected for library construction.

[0120] For the qualified Total RNA sample, the eukaryotic mRNA is enriched by magnetic beads with Oligo(dT), then the mRNA is broken into short fragments by adding fragmentation buffer, and the single-strand cDNA is synthesized by using mRNA as a template and using random hexamers as primers, then the double-strand cDNA is synthesized by adding buffer, dNTPs, RNase H and DNA polymerase I, and then the double-strand cDNA is purified by using AMPure Pbeads or QiaQuick PCR kit. The purified double-strand cDNA is subjected to end repair, A tailing and sequencing adapter ligation, then fragment size selection, and finally PCR enrichment to obtain the final cDNA library.

[0121] Step 4, library detection

[0122] After the library construction is completed, the Qubit 3.0 is used for preliminary quantification, and the library is diluted to 1 ng / ul, then the Agilent 2100 is used to detect the insert size of the library, and after the insert size meets the expectation, the Bio-RAD CFX96 fluorescence quantitative PCR instrument and the Bio-RAD KITiQ SYBR GRN are used for Q-PCR to accurately quantify the effective concentration of the library (the effective concentration of the library > 10 nM) to ensure the quality of the library.

[0123] Step 5, library clustering and sequencing

[0124] The DNBSEQ-T7RS high-throughput sequencing kit (FCL PE100) V3.0 is used for clustering and sequencing on the DNBSEQ-T7 platform, and a double-end sequencing program (PE) is run to obtain 150 bp double-end sequencing reads.

[0125] Step 6, perform sequencing data processing:

[0126] Raw data control: filter low-quality read data;

[0127] Data preprocessing: READ comparison, then sorting and deduplication, then local reprocessing and base quality correction;

[0128] Variant detection: detect variants, then variant quality control and filtration;

[0129] Step 7, after gene sequencing, analyze the variants to obtain the genotyping results, as shown in Table 1.

[0130] Table 1 Genotyping results

[0131] Sample No. Genotyping Results Sample No. Genotyping Results GL01 EE FHB070a EW GL02 WW FHB070b EW GL03 WW SXK040a EW GL04 EE SXK040b EW GL05 EE SXK066a EW GL06 EE SXK066b EW GL07 WW SXK073a EW FHB020a EW SXK073b EW FHB020b EW

[0132] Note: WW is the western slope subpopulation, EE is the eastern slope subpopulation, and EW is the hybrid

[0133] Example 3. Verification in samples of known genotypes using SNP primers

[0134] The known-genotype Pinus squamata second-generation homozygote sample (sample number: GL01-07) and third-generation hybrid samples (FHB020a, FHB070a, SXK040a, SXK066a, SXK073a) in Example 2 were amplified in a PCR reaction using the primers of the present application, as follows:

[0135] 1. The DNA of the seven Pinus squamata GL01-07 samples was extracted using the CTAB method, and the genomic DNA of the seven Pinus squamata samples was obtained.

[0136] 2. The genomic DNA of the seven Pinus squamata samples was used as a template, and five primer sets were used for competitive allele-specific PCR amplification, and an NTC (non-template control) group was set up as a control. The reaction system is shown in Table 2.

[0137] Table 2 Reaction system

[0138]

[0139]

[0140] In each PCR reaction system, the concentration ratio of the first upstream primer, the second upstream primer, and the downstream primer was 1:1:3.

[0141] PCR reaction program:

[0142] 1. Initial denaturation: 95°C for 10 min.

[0143] 2. Drop PCR cycle:

[0144] 1) 95°C, 15s;

[0145] 2) 61°C, 45s;

[0146] 3) Repeat the above steps for 10 cycles, with a decrease of 0.6°C at 61°C for each cycle.

[0147] 3. Normal PCR cycle:

[0148] 1) 95°C, 15s;

[0149] 2) 55°C, 45s;

[0150] 3) Repeat the above step 36 cycles.

[0151] 4. Fluorescence reading: When the PCR amplification product temperature drops below 40℃, read the fluorescence value by scanning the FAM and HEX light beams of the microplate reader (FAM fluorescence tag sequence is observed at an excitation light of 485nm and an emission light of 520nm wavelength, and the HEX fluorescence tag sequence is observed at an excitation light of 528nm and an emission light of 560nm wavelength). Determine the genotype of each SNP site of the 12 test C. kousa germplasm resources based on the color of the fluorescence signal.

[0152] The specific judgment principle is as follows:

[0153] The 5' end of the first upstream primer has a FAM fluorescence tag sequence, and the fluorescence signal of the FAM group can be read by the microplate reader or fluorescence quantitative PCR instrument. The fluorescence signal of the FAM fluorescence tag sequence is green. The 5' end of the second upstream primer has a HEX fluorescence tag sequence, and the fluorescence signal of the HEX group can be read by the microplate reader or fluorescence quantitative PCR instrument. The fluorescence signal of the HEX fluorescence tag sequence is yellow or orange.

[0154] If the fluorescence quantitative PCR instrument detects a green fluorescence signal of the FAM fluorescence group, the test C. kousa germplasm resource is homozygous, and is the West Slope subpopulation (WW type);

[0155] If the fluorescence quantitative PCR instrument detects a yellow or orange fluorescence signal of the HEX fluorescence group, the test C. kousa germplasm resource is homozygous, and is the East Slope subpopulation (EE type);

[0156] If the fluorescence quantitative PCR instrument detects both FAM and HEX fluorescence signals, the test C. kousa germplasm resource is heterozygous based on the SNP site (EW type).

[0157] Step 3: Analyze the results of PCR: Use the HEX (East Slope EE) and FAM (West Slope WW) fluorescence values to establish a coordinate system to make a picture. The West Slope genotype is close to the X axis, the East Slope genotype is close to the Y axis, and the heterozygous genotype is on the diagonal. According to the picture, the fluorescence categories of each sample are counted, and the results are shown in Table 3. The genotype is shown in Table 4, and the SNP molecular marker genotyping fluorescence scatter plot is shown in Figure 1 .

[0158] Table 3: Fluorescence types of each sample

[0159]

[0160] Note: FAM / HEX indicates that both FAM and HEX fluorescence signals are detected

[0161] Genotype identification results of each sample in Table 4

[0162]

[0163]

[0164] Note: WW is the western slope subpopulation, EE is the eastern slope subpopulation, and EW is the hybrid

[0165] If HEX fluorescence is read in the amplification product, it is determined as the eastern slope subpopulation (EE type); if FAM fluorescence is read in the amplification product, it is determined as the western slope subpopulation (WW type). From the fluorescence reading results in Table 3, the identified genotypes in Table 4, and the SNP molecular marker genotyping fluorescence scatter plots in Table 5, the amplification identification results of the 12 Qianjia Pinus samples can match the known genotype samples. Figure 1

[0166] Example 4. Identification of existing Qianjia Pinus germplasm resources using SNP primers

[0167] In this example, the effectiveness of the SNP primer combination developed in Example 1 was tested using 54 Qianjia Pinus test populations of excellent germplasm resources. The sample sources and genotype identification results are shown in Table 5.

[0168] Table 5 Identification results of 54 Qianjia Pinus east-west slope subpopulations

[0169]

[0170]

[0171]

[0172] Note: WW is the western slope subpopulation, EE is the eastern slope subpopulation, and EW is the hybrid

[0173] As can be seen from the above examples, the present application provides a SNP primer set for identifying Qianjia Pinus east-west slope subpopulations and its identification method and application. The SNP primer set of the present application can achieve the identification of Qianjia Pinus east-west slope subpopulations.

[0174] The above description is only the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.​

Claims

1. A SNP primer set for identifying the western slope subpopulation of Qiqiaoshenewengia insignis, characterized in that, The SNP primer set comprises at least one of the following primer sets: a first SNP primer set for amplifying a first SNP site; a second SNP primer set for amplifying a second SNP site; a third SNP primer set for amplifying a third SNP site; a fourth SNP primer set for amplifying a fourth SNP site; a fifth SNP primer set for amplifying a fifth SNP site; the first upstream primer of the first SNP primer set is shown as SEQ ID NO. 1, the second upstream primer is shown as SEQ ID NO. 2, and the downstream primer is shown as SEQ ID NO. 3; the first upstream primer of the second SNP primer set is shown as SEQ ID NO. 4, the second upstream primer is shown as SEQ ID NO. 5, and the downstream primer is shown as SEQ ID NO. 6; the first upstream primer of the third SNP primer set is shown as SEQ ID NO. 7, the second upstream primer is shown as SEQ ID NO. 8, and the downstream primer is shown as SEQ ID NO. 9; the first upstream primer of the fourth SNP primer set is shown as SEQ ID NO. 10, the second upstream primer is shown as SEQ ID NO. 11, and the downstream primer is shown as SEQ ID NO. 12; the first upstream primer of the fifth SNP primer set is shown as SEQ ID NO. 13, the second upstream primer is shown as SEQ ID NO. 14, and the downstream primer is shown as SEQ ID NO.

15.

2. The SNP primer set according to claim 1, characterized in that, The 5' end of the first upstream primer is connected with a FAM fluorescent group tag sequence, and the 5' end of the second upstream primer is connected with a HEX fluorescent group tag sequence.

3. A kit for identifying SNPs of Pinus qiabensis subpopulation in the east slope, characterized in that, The SNP primer set of claim 1 or 2.

4. A method for identifying the Qiaohua Five-Needle Pine western slope subpopulation, characterized in that, The method comprises the following steps: S1. extracting genomic DNA of the sample of Pinus squamata to be tested; S2. using the SNP primer set of claim 1 or 2 to perform competitive allele-specific PCR amplification with the genomic DNA of the sample of Pinus squamata to be tested as a template, and obtaining a PCR product; S3. performing genotyping and east-west slope subpopulation identification according to the fluorescence read by the PCR product: if the fluorescence signal of the FAM group is read, it is determined as the west slope subpopulation genotype, if the fluorescence signal of the HEX group is read, it is determined as the east slope subpopulation genotype, and if the fluorescence signals of the HEX and FAM groups are read, it is determined as a hybrid genotype.

5. The method of claim 4, wherein the method further comprises, The reaction system of the competitive allele-specific PCR amplification is 10 μL: 1.2×v4 Flu-Arms Mix: 5 μL, genomic DNA of the sample of Pinus squamata to be tested 4.5 μL, and mixed primers 0.5 μL; the mixed primers are composed of the first upstream primer, the second upstream primer, and the downstream primer.

6. The method of claim 5, wherein, The initial concentration of the mixed primers is 10 μM; the molar ratio of the first upstream primer, the second upstream primer, and the downstream primer is 1:1:

3.

7. The method of claim 6, wherein the method further comprises, The reaction procedure of the competitive allele-specific PCR amplification is as follows: (1) initial denaturation: 95℃, for 10 min; (2) 2. landing PCR cycle: (2.1)195℃,15s; (2.2)61℃,45s; (2.3) Repeat steps (2.1) and (2.2) for 10 cycles, 0.6°C decrease per cycle at 61°C; (3) Regular PCR cycles: (3.1)95℃,15s; (3.2)55℃,45s; (3.3) Repeat steps 3.1 and 3.2 for 36 cycles in total; (4) Fluorescence reading: 30°C, 30s.

8. The SNP primer set of claim 1 or 2 is used in at least one of the following: (1) in identifying or assisting in identifying the Qiaohua Pinus strobus subpopulation; (2) in preparing a kit for identifying the Qiaohua Pinus strobus subpopulation; (3) in Qiaohua Pinus strobus molecular marker breeding; (4) in Qiaohua Pinus strobus germplasm resource protection.

9. The kit of claim 3 is used in at least one of the following: (1) in identifying or assisting in identifying the Qiaohua Pinus strobus subpopulation; (2) in Qiaohua Pinus strobus molecular marker breeding; (3) in Qiaohua Pinus strobus germplasm resource protection.

Citation Information

Patent Citations

  • Artificial hybrid breeding method of Primula L.

    CN103070064A

  • Tissue culture and rapid propagation method of pinus squamata based on improved culture medium

    CN106342690A