Loop-mediated isothermal amplification primer group for detecting cat astrovirus and detection method

Abstract

The invention belongs to the technical field of virus detection, and particularly relates to a primer composition for detecting cat astrovirus as well as a kit and a method thereof. The invention provides a FeAstV detection primer composition with high sensitivity and strong specificity. The primer composition comprises a forward inner primer FeAstV-F3, a reverse inner primer FeAstV-B3, a forward outer primer FeAstV-FIP and a reverse outer primer FeAstV-BIP, and is characterized in that the forward inner primer FeAstV-F3, the reverse inner primer FeAstV-B3, the forward outer primer FeAstV-FIP and the reverse outer primer FeAstV-BIP are used for detecting FeAstV; an LAMP amplification system is established by using the primer composition, and loop-mediated isothermal amplification is carried out; the LAMP is combined with a hydroxynaphthol blue (HNB) dye, so that the LAMP-HNB visual detection method is successfully constructed. The result of the embodiment shows that the detection method is quick, sensitive and simple to operate, and is particularly suitable for precise detection requirements of primary medical treatment, on-site screening and resource-deficient regions.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of virus detection, and particularly relates to a loop-mediated isothermal amplification primer set for detecting feline astrovirus and a detection method. BACKGROUND

[0002] Feline astrovirus (FeAstV) is a single-stranded RNA virus containing three major open reading frames, namely ORF1a, ORF1b and ORF2. Feline astrovirus mainly invades intestinal epithelial cells, causing cell damage and intestinal function disorder. The common clinical symptoms of feline astrovirus are vomiting, diarrhea, loss of appetite and dehydration, and some strains can cause runny nose, sneezing and conjunctivitis. The main transmission routes of feline astrovirus are fecal-oral transmission, contact transmission and vertical transmission, and the susceptible population is 1-5 month-old kittens and cats with low immunity. Feline astrovirus has host specificity and mainly infects cats (such as domestic cats, wild cats and lions), and no reports of infection of dogs, pigs and other animals have been found.

[0003] Through strict environmental management, timely symptomatic treatment and prevention of mixed infection, the epidemic situation can be effectively controlled. If a cat shows related symptoms, it is recommended to seek medical treatment as soon as possible for pathogen detection to develop a targeted treatment plan. The methods for detecting FeAstV in the laboratory include traditional RT-PCR detection and fluorescent quantitative PCR technology detection, but these two detection methods are time-consuming, require high-performance instruments and have high cost, which are not suitable for clinical first-line treatment.

[0004] Loop-mediated isothermal amplification (LAMP) is a highly efficient nucleic acid amplification technology, which rapidly amplifies target sequences under isothermal conditions (60-65 DEG C) through the design of 4 or 6 specific primers, so as to detect viruses. LAMP detection of viruses can improve the specificity of detection and enhance the sensitivity of detection. LAMP detection does not require expensive instruments, only requires a constant temperature device, and greatly reduces the cost of equipment. LAMP technology has become an important tool in the field of molecular diagnosis due to its rapidness, sensitivity, low cost and simple operation, and is particularly suitable for the precise detection needs of primary medical care, on-site screening and resource-poor areas. However, there is no method for detecting feline astrovirus by LAMP at present.

[0005] Therefore, it is urgent to develop a method for detecting feline astrovirus based on LAMP. SUMMARY

[0006] The purpose of the present application is to provide a loop-mediated isothermal amplification primer set for detecting feline astrovirus and a detection method, which can rapidly and sensitively detect feline astrovirus.

[0007] In order to achieve the above-mentioned purpose, the present application provides the following technical solutions:

[0008] The application provides a loop-mediated isothermal amplification primer set for detecting feline astrovirus, which comprises a forward inner primer FeAstV-F3, a reverse inner primer FeAstV-B3, a forward outer primer FeAstV-FIP and a reverse outer primer FeAstV-BIP.

[0009] Preferably, the nucleotide sequence of the forward inner primer FeAstV-F3 is shown in SEQ ID NO. 1.

[0010] The nucleotide sequence of the reverse inner primer FeAstV-B3 is shown in SEQ ID NO. 2.

[0011] The nucleotide sequence of the forward outer primer FeAstV-FIP is shown in SEQ ID NO. 3.

[0012] The nucleotide sequence of the reverse outer primer FeAstV-BIP is shown in SEQ ID NO. 4.

[0013] The application also provides a feline astrovirus loop-mediated isothermal amplification detection kit, which comprises the loop-mediated isothermal amplification primer set.

[0014] The application also provides a method for detecting feline astrovirus, which comprises the following steps:

[0015] S1, obtaining a specific conservative target sequence of a feline astrovirus gene by comparing feline astrovirus genome sequences in a database, and designing the loop-mediated isothermal amplification primer set according to the DNA sequence of the conservative target;

[0016] S2, extracting feline astrovirus RNA and reverse transcribing the feline astrovirus RNA into cDNA as a nucleic acid template;

[0017] S3, configuring a LAMP reaction system and adding hydroxynaphthol blue dye solution for amplification reaction;

[0018] S4, detecting by agarose gel electrophoresis reaction.

[0019] Preferably, the conservative target sequence shown in step S1 is shown in the nucleotide sequence SEQ ID NO. 5.

[0020] Preferably, the LAMP reaction system in step S3 is 25 μL, including 10x Isothermal Amplification Buffer 2.5 μL, MgSO4 1.5 μL, dNTP Mix (10 mM) 3.5 μL, FeAstV-FIP 1 μL, 1FeAstV-BIP 1 μL, FeAstV-F3 1 μL, FeAstV-B3 1 μL, Bst 2.0 DNA Polymerase (8,000 U / mL) 1 μL, nucleic acid template 2 μL, and ddH2O to 25 μL.

[0021] Preferably, the hydroxynaphthol blue indicator in step S3 is 0.25 μL.

[0022] Preferably, the reaction condition of the amplification reaction in step S3 is 60-65 °C constant temperature for 30-60 min.

[0023] Preferably, the agarose gel electrophoresis reaction in step S4 is an electrophoresis reaction of 1% agarose gel, 170 V constant voltage for 20 min.

[0024] Advantages of the present application:

[0025] The present application establishes a cat astar virus detection primer and kit based on LAMP and HNB indicator. The sensitivity and specificity of the method are studied. The present application takes FeAstV ORF1a gene as the target gene, designs a set of specific LAMP primers, and establishes a constant temperature rapid FeAstV method. The present application successfully establishes a LAMP-HNB visual diagnosis method by combining LAMP with HNB dye, which can quickly and conveniently detect FeAstV. The results show that the optimal reaction condition of the LAMP detection system is 65 °C for 40 min. This method can specifically detect cat astar virus, and the minimum detection concentration is 1.31 x 10 1 copies / μL.

[0026] LAMP reaction is carried out at constant temperature, avoiding the complex temperature rising and falling steps of traditional PCR, and the reaction time can be reduced to 30-60 min. Its amplification efficiency is high, which is suitable for rapid diagnosis demand. LAMP detection does not need expensive instruments, only needs constant temperature equipment, which greatly reduces the equipment cost. Using HNB visualization method, the color change can be directly observed without electrophoresis or professional equipment, avoiding the problem of opening pollution. LAMP technology has the characteristics of rapidity, sensitivity, low cost and simple operation, and becomes an important tool in the field of molecular diagnosis, especially suitable for the precise detection demand of primary medical care, on-site screening and resource scarce areas. This technology provides a new detection method for detecting cat astar virus. BRIEF DESCRIPTION OF DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0028] Figure 1 It is a temperature gradient chart of the present application; wherein Marker is: DNA molecular weight standard DL2000 DNA Marker; 1-5 are respectively 61℃, 62℃, 63℃, 64℃, 65℃; NC: high-temperature sterilized ddH2O;

[0029] Figure 2 It is a result chart after 30min reaction; wherein 1-5 are respectively: 61℃, 62℃, 63℃, 64℃, 65℃; NC: high-temperature sterilized ddH2O;

[0030] Figure 3 It is a result chart after 40min reaction; wherein 1-5 are respectively: 61℃, 62℃, 63℃, 64℃, 65℃; NC: high-temperature sterilized ddH2O;

[0031] Figure 4 It is a result chart after 50min reaction; wherein 1-5 are respectively: 61℃, 62℃, 63℃, 64℃, 65℃; NC: high-temperature sterilized ddH2O;

[0032] Figure 5 It is a result chart after 60min reaction; wherein 1-5 are respectively: 61℃, 62℃, 63℃, 64℃, 65℃; NC: high-temperature sterilized ddH2O;

[0033] Figure 6 It is a visual result chart of LAMP specific detection of FeAstV of the present application; wherein 1-4 are respectively cat astrophil virus, cat herpes virus, cat calicivirus, cat coronavirus; NC: high-temperature sterilized ddH2O;

[0034] Figure 7 It is a visual result chart of LAMP sensitivity detection of FeAstV of the present application; wherein 1-11 are respectively 1.31×10 10 copies / mL, 1.31×10 9 copies / mL, 1.31×10 8 copies / mL, 1.31×10 7 copies / mL, 1.31×10 6copies / mL, 1.31 x 10 5 copies / mL, 1.31 x 10 4 copies / mL, 1.31 x 10 3 copies / mL, 1.31 x 10 2 copies / mL, 1.31 x 10 1 copies / mL, 1.31 x 10 0 copies / mL; NC: autoclaved ddH2O. DETAILED DESCRIPTION

[0035] The application provides a loop-mediated isothermal amplification primer set for detecting feline astrovirus, and the loop-mediated isothermal amplification primer set is designed by using a specific primer of a conservative region of a feline astrovirus ORF1a gene (a sequence shown in a sequence table SEQ ID NO. 5). The loop-mediated isothermal amplification primer set comprises a forward inner primer FeAstV-F3, a reverse inner primer FeAstV-B3, a forward outer primer FeAstV-FIP and a reverse outer primer FeAstV-BIP.

[0036] The nucleotide sequence of the forward inner primer FeAstV-F3 is shown in SEQ ID NO. 1: ATGGCCCTCTTCAATGTCTC (SEQ ID NO. 1); the nucleotide sequence of the reverse inner primer FeAstV-B3 is shown in SEQ ID NO. 2: AGGTAGGACAGCCATGCG (SEQ ID NO. 2); the nucleotide sequence of the forward outer primer FeAstV-FIP is shown in SEQ ID NO. 3: CGATACGGAGCCAGTGAACCTGACGAGGCGATCAAGAACATC (SEQ ID NO. 3); and the nucleotide sequence of the reverse outer primer FeAstV-BIP is shown in SEQ ID NO. 4: TCTTCTCTGTGGCTCTCACGGT-TGGGCCAACACAATAACTGT (SEQ ID NO. 4).

[0037] The application discloses a feline astrovirus detection method based on LAMP and HNB indicators, and the method comprises the following steps: (1) preparation of virus strains, experimental instruments and experimental reagents; (2) design and synthesis of primers; (3) virus nucleic acid extraction; (4) establishment and condition optimization of LAMP detection reaction. The optimized LAMP detection reaction condition is 65 DEG C reaction for 40 min.

[0038] LAMP detection technology is a kind of molecular diagnostic method based on nucleic acid amplification, which has significant advantages in pathogen detection, gene diagnosis and other fields due to its unique principle and design. Hydroxynaphthol blue (HNB) is a metal ion indicator. HNB binds with magnesium ions (the optimal concentration is generally 8 mM-10 mM) to make the initial color of the reaction system purple. With the progress of the reaction, Mg 2+ reacts with the precipitated pyrophosphate ions to form magnesium pyrophosphate precipitate, and hydroxynaphthol blue loses magnesium ions to make the system color turn into sky blue, while the unreacted system still maintains the purple color. The results of the LAMP specificity and sensitivity detection test of FeAstV show that the visualized LAMP method treated by HNB can specifically detect cat astrophil virus, and the lower limit of the LAMP method detection is 1.31 x 10 1 copies / mL.

[0039] In order to further illustrate the present application, the technical solutions provided by the present application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0040] The production process, experimental method or detection method involved in the embodiments of the present application are all conventional methods in the prior art without special instructions, and the name and / or abbreviation thereof all belong to the conventional name in the art, which is very clear and explicit in the related application field. The skilled in the art can understand the conventional process steps and apply the corresponding equipment according to the name, and implement it according to the conventional conditions or the conditions recommended by the manufacturer.

[0041] The viral genomic RNA extraction kit is purchased from Shanghai Feijie Biotechnology Co., Ltd.; the Phanta Max Super-Fidelity DNA Polymerase kit is purchased from Nanjing Novozyme Biotech Co., Ltd.; the Bst 2.0 DNA Polymerase kit is purchased from New England Biolabs.

[0042] The various instruments, equipment, raw materials or reagents used in the embodiments of the present application do not have special restrictions on the source, and are conventional products that can be purchased through normal commercial channels, or can be prepared according to the conventional method well known to those skilled in the art.

[0043] Example 1 Construction of LAMP detection reaction

[0044] In the embodiment, the universal primer is designed by the target gene fragment of the conserved region, the FeAstV primer, the inner primer and the outer primer are amplified, and the virus fragment is amplified and detected. The FeAstV primer is obtained to prepare the standard in the test. The inner primer and the loop primer are used for amplifying the feline astrovirus fragment in the LAMP detection reaction, so as to detect the feline astrovirus. In the condition optimization aspect, the optimal reaction time and temperature are found out by designing the time gradient and the temperature gradient, so that the detection can be completed in the shortest time and the most suitable temperature. The optimal time in the application is 40 min, and the optimal temperature is 65 DEG C. The application can make the result more intuitive display by using the visual method, and the operation is simple.

[0045] (1) Preparation of virus strain, experimental instrument and experimental reagent:

[0046] The virus strain includes: feline astrovirus (FeAstV), feline herpesvirus (FHV-1), feline calicivirus (FCV) and feline coronavirus (FCoV).

[0047] The experimental instrument includes: PCR instrument, electric heating constant temperature water bath, electronic analytical balance, electrophoresis instrument, multi-sample tissue grinder, fume hood, super clean bench, pipette, small high-speed centrifuge, full-wavelength enzyme marker, high-speed refrigerated centrifuge.

[0048] The experimental reagent includes: virus genome RNA extraction kit, agarose, TAE buffer, LB agar, LB broth, TIANScript II RTase (200U / μL), Oligo(dT)15 (10μM), Random (10μM), 5xTIANScript II RTase Buffer, RNase-Free ddH2O, Super Pure dNTPs (10mM, each), RNasin (40U / μL), Phanta Max Super-Fidelity DNA Polymerase kit, Bst 2.0 DNAPolymerase kit, dNTP Mix (10mM each), hydroxynaphthol blue indicating dye, DL2000 DNA Marker, ddH2O and HNB dye solution.

[0049] (2) Design and synthesis of primer:

[0050] After comparing the complete sequences of 193 cat astrovirus strains published in the GenBank database of NCBI, specific primers were designed for the conserved region of cat astrovirus. The primers were divided into two groups, namely internal primers and external primers. FeAstV-F1P and FeAstV-B1P were internal primers, and FeAstV-F3 and FeAstV-B3 were external primers. The partial genomic sequence of the target gene ORF1a is as follows.

[0051] The conserved region of the target gene fragment is as follows: gactccaccacgaaacgactacggattgcccaacaggaaaaagcgactctggcacttgataatcaacttatgcgtcatgaaattgctagataccagcaagcccaacagacagtcaatgtccgcactgttaatatgaaatatatattagtggctgctgtcatgatctttctcgctcttttgcctagtagtgatgcacaagtctactttcctgtcaataggaccatctttactgacattcgggaagtgtgccgcctgtcgactgaaaccttaaatgaaaatctgaacctccggattaagatggccctcttcaatgtctcgatctatgaccagtacgaggcgatcaagaacatcttgacaatgcaatttattcctcaggttcactggctccgtatcgtacttgaagcccttaggtactaccaagtatggaacctcttctctgtggctctcacggtactcacgctccttaaaagcaaaaaagtaggcacagatcttacagttattgtgttggcccacttttcaggttggcgcatggctgtcctacctaccataccctttcagacaaccttgtccctttgggtcatgaacctcgtgatgctttgcttttgctttgacaagttctgcgc (SEQ ID NO. 5).

[0052] (3) Virus nucleic acid extraction:

[0053] The virus-containing sample was extracted according to the instructions of the viral genome RNA extraction kit to extract the RNA of feline astrovirus, feline herpesvirus, feline calicivirus and feline coronavirus, respectively. 5 μL of virus RNA was reverse transcribed into 20 μL of cDNA. All treated nucleic acids were stored in a freezer at -20°C.

[0054] (4) Establishment of LAMP detection reaction:

[0055] The total reaction system of 25 μL LAMP includes 2.5 μL of 10× Isothermal Amplification Buffer, 1.5 μL of MgSO4, 3.5 μL of dNTP Mix (10 mM), 1 μL of FeAstV-FIP, 1 μL of FeAstV-BIP, 1 μL of FeAstV-F3, 1 μL of FeAstV-B3, 1 μL of Bst 2.0 DNA Polymerase (8,000 U / mL), 2 μL of nucleic acid template, and finally ddH2O to 25 μL.

[0056] (5) Optimization of LAMP detection reaction conditions:

[0057] LAMP detection reaction is prone to false positive results, so the negative reaction solution should be configured separately from the sample. By adjusting the reaction time and temperature, the optimal reaction conditions are screened out, and the reaction is optimized by controlling a single variable in the LAMP system.

[0058] The reaction time was selected as 30 min, 40 min, 50 min and 60 min, respectively, the temperature gradient was set as 61°C, 63°C, 63°C, 64°C and 65°C, and deionized water after high-temperature sterilization was set as a negative control. After the 25 μL LAMP reaction system was configured, 0.25 μL HNB dyeing solution was added and mixed, each reaction was repeated three times. After amplification, 8 μL of reaction solution and 5 μL of DL2000 DNA Marker were subjected to electrophoresis reaction on a 1% agarose gel for 20 min at a constant voltage of 170 V. The most obvious characteristic ladder band that can be detected is positive, and if no band appears, it is negative.

[0059] The electrophoresis reaction results are shown in Figure 1 , indicating that the optimal temperature of LAMP detection reaction is 65°C.

[0060] The experimental result graph of reaction for 30 min is shown in Figure 2 , the experimental result graph of reaction for 40 min is shown in Figure 3 , the experimental result graph of reaction for 50 min is shown in Figure 4 , and the experimental result graph of reaction for 60 min is shown in Figure 5The results show that the optimal time for LAMP detection reaction is 40 min. Therefore, the optimal reaction condition for LAMP detection is 65 DEG C reaction for 40 min.

[0061] (6) Establishment of LAMP-HNB visual detection method:

[0062] After the 25 muL LAMP reaction system is configured, 0.25 muL HNB dyeing liquid is added and mixed to observe that the reaction liquid becomes purple.

[0063] The optimal dNTP Mix (10mM each) concentration suitable for the reaction system is explored, and six concentration gradients of 1.2mM, 1.4mM, 1.6mM, 1.8mM, 2.0mM and 3.2mM are set.

[0064] The results show that when the concentration is 1.2mM, the reaction liquid does not change color after reaction; when the concentration is 1.6mM, 1.8mM, 2.0mM and 3.2mM, the reaction liquid has changed color without starting reaction; when the concentration is 1.4mM, after reaction, the positive amplification sample shows sky blue, and the negative control is purple. The results show that the optimal dNTP Mix (10mM each) concentration is 1.4mM, that is, 3.5 muL.

[0065] Example 2 LAMP specificity detection test of FeAstV

[0066] In the present application, the specificity detection is to detect feline herpesvirus, feline calicivirus and feline coronavirus by using the LAMP detection primer group for feline astrovirus, and the results are compared with the results of detecting feline astrovirus, so as to prove the specificity of the primer group in the present application. It shows that the primer group is specific to feline astrovirus.

[0067] According to example 1, the cDNA of feline astrovirus, feline herpesvirus, feline calicivirus and feline coronavirus is respectively used as a template to configure a 25 muL LAMP reaction system, and a high-temperature sterilized deionized water is set as a negative control. After the 25 muL LAMP reaction system is configured, 0.25 muL HNB dyeing liquid is added and mixed, and the amplification is carried out according to the optimal reaction condition (65 DEG C reaction for 40 min), each reaction is repeated three times, the color change is observed, and the specificity of the detection technology is explored.

[0068] The results are as Figure 6 described, which shows that the color of feline astrovirus after LAMP reaction amplification becomes sky blue, and the colors of feline herpesvirus, feline calicivirus and feline coronavirus become purple, indicating that the visual LAMP method after HNB visualization can specifically detect feline astrovirus.

[0069] Example 3 LAMP sensitivity detection test of FeAstV

[0070] The sensitivity detection is to explore the lowest detection concentration of the detection technology, so as to prove the sensitivity of the reaction system to the detection of cat astrovirus. The experimental results show that the lower limit of FeAstV is 1.31 x 10 1 copies / mL, indicating that the method has high sensitivity and can be used for the detection of cat astrovirus in clinic.

[0071] The starting concentration of FeAstV plasmid is 623 μg / mL, that is, the copy number is 1.31 x 10 11 copies / mL, detected by full-wavelength enzyme label instrument. The original solution is diluted by 10 times, and the concentration gradient is: 1.31 x 10 10 copies / mL-1.31 x 10 0 copies / mL.

[0072] 25 μL LAMP reaction system is configured, and one high-temperature sterilized deionized water is set as a negative control. The amplification is carried out according to the optimal reaction condition (65℃ reaction for 40 min). After the 25 μL LAMP reaction system is configured, 0.25 μL HNB dyeing solution is added and mixed, each reaction is repeated three times, the color change is observed, and the lowest detection concentration of the detection technology is explored.

[0073] The results are shown in Table 1. Figure 7 The color of 1.31 x 10 10 -1.31 x 10 1 copies / mL after LAMP reaction amplification is changed to sky blue, and the color of 1.31 x 10 2 copies / mL is changed to violet. The detection results show that the lower limit of FeAstV detected by the established LAMP method is 1.31 x 10 1 copies / mL, indicating that the method has high sensitivity.

[0074] Although the above embodiment makes a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments. Other embodiments can be obtained according to the present embodiment without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. A loop-mediated isothermal amplification primer set for detecting feline astrovirus, characterized in that: The loop-mediated isothermal amplification primer set includes a forward inner primer FeAstV-F3, a reverse inner primer FeAstV-B3, a forward outer primer FeAstV-FIP and a reverse outer primer FeAstV-BIP.

2. The loop-mediated isothermal amplification primer set according to claim 1, characterized in that: The nucleotide sequence of the forward inner primer FeAstV-F3 is shown in SEQ ID NO.1; The nucleotide sequence of the reverse inner primer FeAstV-B3 is shown in SEQ ID NO. 2; The nucleotide sequence of the forward outer primer FeAstV-FIP is shown in SEQ ID NO. 3; The nucleotide sequence of the reverse outer primer FeAstV-BIP is shown in SEQ ID NO.

4.

3. A feline astrovirus loop-mediated isothermal amplification detection kit, characterized in that: The feline astrovirus loop-mediated isothermal amplification detection kit comprises the loop-mediated isothermal amplification primer set according to claim 1.

4. A method for detecting feline astrovirus, characterized in that The following steps are involved: S1. By comparing the feline astrovirus genome sequence in the database, a specific conserved target sequence of the feline astrovirus gene is obtained, and according to the DNA sequence of the conserved target, the loop-mediated isothermal amplification primer set of claim 1 is designed; S2, extracting feline astrovirus RNA and reverse-transcribing it into cDNA as a nucleic acid template; S3, preparing the LAMP reaction system, adding hydroxynaphthol blue dye solution for amplification reaction; S4. Detection is performed using agarose gel electrophoresis.

5. The method according to claim 4, characterized in that: The conserved target sequence in step S1 is shown in the nucleotide sequence SEQ ID NO.

5.

6. The method according to claim 4, characterized in that: The LAMP reaction system described in step S3, calculated as 25 μL, includes 2.5 μL of 10×Isothermal Amplification Buffer, 1.5 μL of MgSO4, 3.5 μL of dNTP Mix (10 mM), 1 μL of FeAstV-FIP, 1 μL of 1FeAstV-BIP, 1 μL of FeAstV-F3, 1 μL of FeAstV-B3, 1 μL of Bst 2.0 DNA Polymerase (8,000 U / mL), 2 μL of nucleic acid template, and ddH2O to make up to 25 μL.

7. The method according to claim 4, characterized in that: The amount of the hydroxynaphthol blue indicator in step S3 is 0.25 μL.

8. The method according to claim 4, characterized in that: The reaction conditions of the amplification reaction in step S3 are: constant temperature at 60°C-65°C for 30-60 minutes.

9. The method according to claim 4, characterized in that: The agarose gel electrophoresis reaction in step S4 is an electrophoresis reaction using 1% agarose gel and a constant voltage of 170V for 20 minutes.

Images