Primer and probe combination for detecting four viruses in cat digestive tract, application of primer and probe combination and kit

By designing specific primer and probe combinations and combining them with multiplex PCR technology, the problem of the inability to rapidly and simultaneously detect four viruses in the feline digestive tract was solved, achieving efficient and low-cost multiplex detection and improving the sensitivity and accuracy of detection.

CN121380449AActive Publication Date: 2026-01-23SHENZHEN RUNMING BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511699550.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2026-01-23
Estimated Expiration
2045-11-17

AI Technical Summary

Technical Problem

The lack of existing technologies for rapid detection of four feline digestive tract viruses (feline panleukopenia virus, feline enteric coronavirus, feline astrovirus, and feline bocavirus type 1) results in low detection efficiency, high cost, and an inability to meet the needs of rapid clinical diagnosis.

Method used

A primer and probe combination was designed, which, combined with multiplex PCR technology, can simultaneously detect four viruses in the feline digestive tract. This includes specific primers and probes for each virus, ensuring minimal cross-reaction during amplification and improving the sensitivity and accuracy of detection.

Benefits of technology

It enables rapid, low-cost multiplex detection, shortens diagnostic time, and improves detection sensitivity and accuracy, capable of detecting viral loads as low as 10 cp/μL.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380449A_ABST
    Figure CN121380449A_ABST
Patent Text Reader

Abstract

The invention discloses a primer and probe combination for detecting four viruses of a cat digestive tract, application of the primer and probe combination and a kit, and relates to the technical field of in-vitro detection.The primer and probe combination for detecting the four viruses of the cat digestive tract comprises a first combination, a second combination, a third combination and a fourth combination, the four combinations are respectively designed for cat astrovirus, cat plague virus, cat intestinal coronavirus and cat bocavirus type 1, the four viruses of FPV, FCoV, FeAstV and FBoV can be synchronously detected by combining a multiplex PCR technology, the diagnosis time is shortened, and the detection cost is reduced; meanwhile, the primer and probe combined design can avoid cross reaction in the amplification process, and the detection sensitivity and accuracy are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of in vitro detection technology, and in particular to a primer and probe combination for detecting four viruses in the feline digestive tract, their applications, and a kit. Background Technology

[0002] Gastrointestinal diseases in cats are a common problem in veterinary clinics. Feline panleukopenia virus (FPV), feline enteric coronavirus (FCoV), feline astrovirus (FeAstV), and feline bocavirus type 1 (FBoV) are the main pathogens causing feline gastrointestinal infections. These viruses are highly contagious and can cause symptoms such as vomiting, diarrhea, and dehydration, and in severe cases, even death.

[0003] Currently, the detection of these viruses mostly employs a single detection method, requiring multiple sampling and testing, which is inefficient, costly, and cannot meet the needs of rapid clinical diagnosis. For example, feline panleukopenia virus detection typically uses colloidal gold test strips or quantitative real-time PCR; feline coronavirus detection relies on enzyme-linked immunosorbent assay (ELISA); and feline astrovirus and feline bocavirus detection require separate polymerase chain reaction (PCR) amplification.

[0004] Therefore, there is currently a lack of rapid methods that can simultaneously detect the above four viruses. Summary of the Invention

[0005] The main objective of this invention is to propose a primer and probe combination for detecting four viruses in the feline digestive tract, along with their applications and a reagent kit. The aim is to provide a highly specific, low-cost, and rapid diagnostic reagent for detecting feline panleukopenia virus, feline enteric coronavirus, feline astrovirus, and feline bocavirus type 1.

[0006] To achieve the above objectives, this invention proposes a primer and probe combination for detecting four feline digestive tract viruses. The primer and probe combination for detecting these four viruses includes a first combination, a second combination, a third combination, and a fourth combination, wherein: The first combination includes an upstream primer for FeAstV_F, a downstream primer for FeAstV_R, and a probe for FeAstV_P targeting feline astrovirus. The nucleotide sequence of the upstream primer for FeAstV_F is shown in SEQ ID NO. 1, the nucleotide sequence of the downstream primer for FeAstV_R is shown in SEQ ID NO. 2, and the nucleotide sequence of the probe for FeAstV_P is shown in SEQ ID NO. 3. The second combination includes an FPV_F upstream primer, an FPV_R downstream primer, and an FPV_P probe targeting feline panleukopenia virus. The nucleotide sequence of the FPV_F upstream primer is shown in SEQ ID NO. 4, the nucleotide sequence of the FPV_R downstream primer is shown in SEQ ID NO. 5, and the nucleotide sequence of the FPV_P probe is shown in SEQ ID NO. 6. The third combination includes an upstream primer for FCoV_F, a downstream primer for FCoV_R, and a probe for FCoV_P against feline enteric coronaviruses. The nucleotide sequence of the upstream primer for FCoV_F is shown in SEQ ID NO. 7, the nucleotide sequence of the downstream primer for FCoV_R is shown in SEQ ID NO. 8, and the nucleotide sequence of the probe for FCoV_P is shown in SEQ ID NO. 9. The fourth combination includes an upstream primer for FBoV_F, a downstream primer for FBoV_R, and a probe for FBoV_P targeting feline bocavirus type 1. The nucleotide sequence of the upstream primer for FBoV_F is shown in SEQ ID NO. 10, the nucleotide sequence of the downstream primer for FBoV_R is shown in SEQ ID NO. 11, and the nucleotide sequence of the probe for FBoV_P is shown in SEQ ID NO. 12.

[0007] The present invention also provides the application of the aforementioned primer and probe combination for detecting four feline digestive tract viruses in the preparation of products for detecting four feline digestive tract viruses.

[0008] The present invention also provides a kit for detecting four feline digestive tract viruses, the kit comprising the aforementioned primer and probe combination for detecting the four feline digestive tract viruses.

[0009] In one embodiment, the kit for detecting four feline digestive tract viruses includes a PCR reaction solution and a standard template mixture; The PCR reaction solution includes the aforementioned primer and probe combination for detecting four viruses in the feline digestive tract.

[0010] In one embodiment, the standard template mixture includes plasmid DNA from feline astrovirus, feline panleukopenia virus, feline enteric coronavirus, and feline bocavirus type 1.

[0011] In one embodiment, the PCR reaction solution comprises PCR reagents and the aforementioned primer and probe combination for detecting four feline digestive tract viruses: In the first combination, the concentrations of both primers and probes are 0.4 μM / μL; In the second combination, the concentrations of both primers and probes are 0.4 μM / μL; In the third combination, the concentrations of both primers and probes are 0.4 μM / μL; In the fourth combination, the concentrations of both primers and probes are 0.4 μM / μL.

[0012] In one embodiment, the PCR reagent includes a premixed, lyophilizable probe-based qPCR reagent.

[0013] In the technical solution of this invention, the primer and probe combinations for detecting four feline digestive tract viruses include a first combination, a second combination, a third combination, and a fourth combination. The four combinations are designed with upstream primers, downstream primers, and probes for feline astrovirus, feline panleukopenia virus, feline enteric coronavirus, and feline bocavirus type 1, respectively. Combined with multiplex PCR technology, four viruses, FPV, FCoV, FeAstV, and FBoV, can be detected simultaneously, shortening the diagnostic time and reducing the detection cost. At the same time, the primer and probe combination design of this invention can avoid cross-reactions during the amplification process, improving the sensitivity and accuracy of detection. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.

[0015] Figure 1 This is a real-time quantitative PCR (qPCR) amplification curve of the negative control in Example 2 of the present invention; Figure 2 This is the qPCR amplification curve of positive control 1 in Example 2 of the present invention; Figure 3 This is the qPCR amplification curve of positive control 2 in Example 2 of the present invention; Figure 4 This is the qPCR amplification curve of positive control 3 in Example 2 of the present invention; Figure 5 This is the qPCR amplification curve of positive control 4 in Example 2 of the present invention; Figure 6 This is the qPCR amplification curve of the sample to be tested in Example 2 of the present invention.

[0016] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Where the manufacturers of reagents or instruments are not specified, they are all conventional products that can be purchased commercially. Furthermore, the meaning of "and / or" throughout the text includes three parallel solutions; for example, "A and / or B" includes solution A, or solution B, or a solution where both A and B are satisfied simultaneously. In addition, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0018] Specifically, feline panleukopenia virus (FPV) belongs to the parvoviridae family. It is a non-enveloped, single-stranded DNA virus with strong resistance to the environment. It is mainly transmitted through direct contact (such as saliva, feces, and urine) or indirect contact. Clinical symptoms include high fever, vomiting, diarrhea, and a significant decrease in white blood cell count. Common detection methods include clinical symptom observation, complete blood count (CBC), FPV test strips, and PCR testing.

[0019] Feline enteric coronavirus (FCoV) belongs to the Coronaviridae family and has two biotypes: the more pathogenic feline infectious peritonitis virus (FIPV) and the less pathogenic feline enteric coronavirus (FECV). It is primarily transmitted via the fecal-oral route. Clinical symptoms include mild to moderate diarrhea, which may lead to fever, weight loss, and anemia. Common detection methods include clinical symptoms and medical history, and laboratory tests (viral testing, blood tests, and ascites examination).

[0020] Feline astrovirus (FeAstV) belongs to the genus *Astrovirus* and is typically associated with intestinal infection. Its specific transmission route is unclear, but it may be related to contact with felines. Clinical symptoms include vomiting and diarrhea, but asymptomatic infection is also possible. Currently, there is no specific detection method.

[0021] Feline bocavirus type 1 (FBoV) belongs to the parvoviridae family and is a small, non-enveloped, single-stranded DNA virus. FBoV exhibits genetic diversity, and its specific transmission routes are not fully understood, but it may be transmitted through direct or indirect contact. It is commonly found in gastrointestinal samples from cats exhibiting diarrhea. Its primary clinical symptom is diarrhea in cats, which may be associated with severe enteritis or hemorrhagic enteritis. It is frequently co-infected with other viruses, exacerbating diarrhea symptoms. Common detection methods include TaqMan-based real-time quantitative PCR and SYBR Green I-based double-stranded real-time PCR.

[0022] The current methods for detecting the above four viruses have the following disadvantages: (1) Cumbersome operation: multiple sampling and testing are required, increasing the workload of clinical staff. (2) High risk of missed detection: a single test cannot cover multiple pathogens, resulting in low efficiency of comprehensive diagnosis. (3) High cost: repeated testing consumes more reagents and consumables.

[0023] In view of this, the present invention proposes a primer and probe combination for detecting four feline digestive tract viruses. The primer and probe combination for detecting the four feline digestive tract viruses includes a first combination, a second combination, a third combination, and a fourth combination, wherein: the first combination includes an upstream primer for FeAstV_F, a downstream primer for FeAstV_R, and a FeAstV_P probe targeting feline astrovirus. The nucleotide sequence of the FeAstV_F upstream primer is shown in SEQ ID NO. 1, the nucleotide sequence of the FeAstV_R downstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the FeAstV_P probe is shown in SEQ ID NO. 3; the second combination includes an upstream primer for FPV_F, a downstream primer for FPV_R, and an FPV_P probe targeting feline panleukopenia virus. The nucleotide sequence of the FPV_F upstream primer is shown in SEQ ID NO. 4, the nucleotide sequence of the FPV_R downstream primer is shown in SEQ ID NO. 5, and the nucleotide sequence of the FPV_P probe is shown in SEQ ID NO. 4. As shown in SEQ ID NO. 6; the third combination includes an upstream primer for FCoV_F, a downstream primer for FCoV_R, and an FCoV_P probe targeting feline enteric coronaviruses. The nucleotide sequence of the FCoV_F upstream primer is shown in SEQ ID NO. 7, the nucleotide sequence of the FCoV_R downstream primer is shown in SEQ ID NO. 8, and the nucleotide sequence of the FCoV_P probe is shown in SEQ ID NO. 9; the fourth combination includes an upstream primer for FBoV_F, a downstream primer for FBoV_R, and an FBoV_P probe targeting feline bocavirus type 1. The nucleotide sequence of the FBoV_F upstream primer is shown in SEQ ID NO. 10, the nucleotide sequence of the FBoV_R downstream primer is shown in SEQ ID NO. 11, and the nucleotide sequence of the FBoV_P probe is shown in SEQ ID NO. 12.

[0024] Table 1 Primer and probe combinations for four feline gastrointestinal viruses

[0025] In the technical solution of this invention, the primer and probe combination for detecting four feline digestive tract viruses includes a first combination, a second combination, a third combination, and a fourth combination. The four combinations are designed with upstream primers, downstream primers, and probes for feline astrovirus, feline panleukopenia virus, feline enteric coronavirus, and feline bocavirus type 1, respectively. Combined with multiplex PCR technology, four viruses, FPV, FCoV, FeAstV, and FBoV, can be detected simultaneously, shortening the diagnostic time and reducing the detection cost. At the same time, the primer and probe combination design of this invention can avoid cross-reactions during the amplification process, improving the sensitivity and accuracy of detection.

[0026] Specifically, this invention obtains the gene sequences of feline astrovirus, feline panleukopenia virus, feline enteric coronavirus, and feline bocavirus type 1 from the National Center for Biotechnology Information (NCBI), and designs specific primers and probes from conserved regions of these viruses. The sequences of the conserved regions selected for the four viruses are shown in SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, and SEQ ID No. 16, respectively. SEQ ID No. 13: >lcl|KF374704.1_cds_AGZ85184.1_3_orf1b (cat-shaped)

[0027] SEQ ID No. 14: >lcl|M38246.1_cds_VP2 (feline parvovirus)

[0028] SEQ ID No. 15: >lcl|NC_002306.3_cds_YP_004070199.1_7 (feline intestinal coronavirus)

[0029] SEQ ID No. 16: >lcl|MH155951.1_cds_AXM43001.1_2 (Feline bocaparvovirus np1) ATGTCGAGTGGAGAATGCTCGAAGGACGCGAGGAAAAGACACCACGACAGGAATCGGACGCCGAGTCCAGTGCCGAGCAAGAAGGGTCGATGGAGCTTGAGCTCTCACCGACGCAGTGGGGAGAAATGCTCGGTCTCGTCGCCGGAGACATCGAATCAGGAGAACCACCAATCACGCTCCACTGCTTCGAGTCACTCACTGACGAAGACTGGGACTCTCTATAGTGTACCCTTTGTAAAGGTTATAAAAAGCAAATATAAAAATAAAGGAAAACCTACACCATTAGATGTATTTGTTAGACATAAAGCCAAATCAAGTGATGATTGTCCAAATTTTTGTGGATTTTATTGGCATAGCACCAGATTGGCTAGATTTGGAACAGATTATATTTTTAATATAGCTAAACCTCAATTCCAATCGTACGCAACCAATAATCTAATATCTTGGGATCAATGTAGAGATATATTGTTTGAATTTAAAAAAAATGTAGACTTCAAATATAGGAGTATGATGTATCATTTTGCACTGGGGGAACAATGTAATAAATGTAATTATTGGGATCAGGTATACACTGCTCATCTGGCTCATGTGTCTATTCCCACTATACAGGAAGACGACGAAGAGCCATTTGAGGTAACTGATAATGAAATGCTAGCGGTCGCCATGGAAGTCGATGGCACCAACCAATAG。

[0030] It should be noted that the primers and probes of the present invention are designed to be specific primers and probes for the conserved regions of four viruses, ensuring amplification specificity. Combining with the multiplex PCR technology, four viruses can be screened synchronously, shortening the diagnostic time, with relatively high detection efficiency, saving reagent and labor costs; and the probability of cross-reaction between different primers and probes is relatively low, with good detection accuracy; at the same time, the primer and probe combination of the present invention can detect a virus load as low as 10 cp / μL, with relatively high detection sensitivity.

[0031] This invention also provides the application of the aforementioned primer and probe combination for detecting four feline digestive tract viruses in the preparation of products for detecting these four viruses. Therefore, it possesses all the beneficial effects of the aforementioned primer and probe combination for detecting the four feline digestive tract viruses, which will not be elaborated further here. It is understood that the products for detecting the four feline digestive tract viruses include kits, test strips, etc.

[0032] This invention also provides a kit for detecting four feline digestive tract viruses, comprising the aforementioned primer and probe combination for detecting the four feline digestive tract viruses. Therefore, it possesses all the beneficial effects of the aforementioned primer and probe combination for detecting the four feline digestive tract viruses, which will not be elaborated further here.

[0033] In some embodiments, the kit for detecting four feline digestive tract viruses includes a PCR reaction solution and a standard template mixture; the PCR reaction solution includes the aforementioned primer and probe combination for detecting the four feline digestive tract viruses. That is, the primer and probe combination for detecting the four feline digestive tract viruses can be directly incorporated into the PCR reaction solution.

[0034] In some embodiments, the standard template mixture comprises plasmid DNA from feline astrovirus, feline panleukopenia virus, feline enteric coronavirus, or feline bocavirus type 1. The standard template mixture is a positive standard.

[0035] In some embodiments, the PCR reaction solution includes PCR reagents and the aforementioned primer and probe combinations for detecting four feline digestive tract viruses: the concentration of primers and probes in the first combination is 0.4 μM / μL; and / or, the concentration of primers and probes in the second combination is 0.4 μM / μL; and / or, the concentration of primers and probes in the third combination is 0.4 μM / μL; and / or, the concentration of primers and probes in the fourth combination is 0.4 μM / μL. It is understood that in the PCR reaction solution, the concentrations of primers and probes in the four combinations within the aforementioned ranges ensure a low probability of cross-reaction, effectively distinguishing the four viruses, resulting in high accuracy of the detection results. Furthermore, the primer and probe system at these concentrations can detect viral loads as low as 10 cp / μL, exhibiting high detection sensitivity. Preferably, in some embodiments, the PCR reagents include premixed lyophilizable probe-based qPCR reagents.

[0036] Understandably, PCR reagents can be prepared in multiple batches. During testing, primer and probe combinations for detecting four feline digestive tract viruses can be mixed with one batch of PCR reagent to obtain a PCR reaction solution. At the same time, a standard template mixture can be mixed with one batch of PCR reagent as a positive control.

[0037] This invention also provides a method for detecting four viruses in the feline digestive tract. Fluorescent probes are used to distinguish different amplification products, and a real-time quantitative PCR system (SLAN-96P) is used for detection. Results are interpreted based on the Ct value of the fluorescence channels (Ct value < 35 is interpreted as positive; Ct value ≥ 35 or no amplification curve is interpreted as negative). FPV is the FAM channel, FeAstV is the HEX channel, FCoV is the ROX channel, and FBoV is the CY5 channel.

[0038] Results interpretation: Fluorescent probe method was used to distinguish different viral amplification products, with each virus corresponding to a different channel.

[0039] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0040] Example 1 This embodiment provides a kit for detecting four feline digestive tract viruses, including primer and probe combinations (sequences as shown in SEQ ID NO. 1 to SEQ ID NO. 12) for detecting the four feline digestive tract viruses, four standard templates, negative controls, and five premixed lyophilizable probe-based qPCR reagents. The primer and probe combinations for detecting the four feline digestive tract viruses are mixed with one premixed lyophilizable probe-based qPCR reagent to obtain a PCR reaction solution. The specific components and concentrations of the PCR reaction solution are shown in Table 2. The standard template mixture is a mixture of plasmid DNA from feline astrovirus, feline panleukopenia virus, feline enteric coronavirus, and feline bocavirus type 1. Each standard template is mixed with one premixed lyophilizable probe-based qPCR reagent to obtain a positive control. The positive controls for FPV, FeAstV, FCoV, and FBoV are designated as Positive Control 1, Positive Control 2, Positive Control 3, and Positive Control 4, respectively. The negative control is purified water.

[0041] Table 2 PCR Reaction Solution Preparation Table

[0042] The premixed lyophilizable probe-based qPCR kit was purchased from Hunan Aikerui Biotechnology Co., Ltd., catalog number AG11757. The nucleotide sequences of FeAstV_F, FeAstV_R, FeAstV_P, FPV_F, FPV_R, FPV_P, FCoV_F, FCoV_R, FCoV_P, FBoV_F, FBoV_R, and FBoV_P are shown in Table 1. These nucleotide sequences were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0043] Example 2 This embodiment provides the detection experiment of the kit in Example 1 on one sample to be tested (the sample to be tested is a cat anal swab nucleic acid sample). The specific operation is as follows: calculate the amount of each component according to the detection requirements of this experiment. One sample to be tested corresponds to one PCR reaction solution, wherein the volume of the PCR reaction solution is 20 μL, the sample volume is 5 μL, and the total reaction volume is 25 μL.

[0044] Each sample was mixed with a separate PCR reaction solution to a total volume of 25 μL, and centrifuged thoroughly to obtain four mixtures. The reaction tubes containing these mixtures were then placed in a real-time quantitative PCR system (Shanghai Hongshi SLAN-96P), and the PCR amplification program was set according to Table 3. This test also included four positive controls (positive control 1, positive control 2, positive control 3, and positive control 4) and one negative control.

[0045] Table 3 PCR amplification program

[0046] The test results of the negative control are as follows: Figure 1 As shown, no virus was detected, indicating that the accuracy of this test is high. The Ct value is the cycle number corresponding to the first crossing of the threshold line by the fluorescence signal; the threshold line is a horizontal line.

[0047] The test results of positive control 1 are as follows Figure 2 As shown, the detection results of positive control 2 are as follows: Figure 3 As shown, the detection results of positive control 3 are as follows: Figure 4 As shown, the test results for positive control 4 are as follows: Figure 5 As shown, Figures 2 to 5 The results showed that each virus was detected in one channel, with good distinguishability. Channel 1 was the FAM channel; Channel 2 was the HEX channel; Channel 3 was the ROX channel; and Channel 4 was the CY5 channel.

[0048] The test results of the sample are as follows Figure 6 As shown, the sample to be tested contained feline parvovirus, astrovirus, coronavirus, and bocavirus.

[0049] Performance testing The sensitivity of methods for detecting four viruses in the feline digestive tract was analyzed.

[0050] Sensitivity was determined by detection limit. Different concentrations of plasmids were prepared for four different feline digestive tract viruses. The plasmids were synthesized by Beijing Qingke Biotechnology Co., Ltd. Multiplex PCR detection was performed using the detection kit described in Example 1. The plasmids of each virus were diluted to five concentration gradients: 2000 copies / mL, 1000 copies / mL, 500 copies / mL, 250 copies / mL, and 125 copies / mL. Samples were prepared by mixing the plasmids of the same concentration in equal proportions, with virus concentrations of 500 copies / mL, 250 copies / mL, 125 copies / mL, 62.5 copies / mL, and 31.25 copies / mL. The samples were added according to the kit and then tested. The detection method was the same as in Example 2. The results are shown in Table 4.

[0051] Table 4. Results of sensitivity tests for various types of viruses

[0052] As shown in Table 4, under this reaction system, each virus can be stably detected when the concentration is greater than or equal to 62.25 copies / mL.

[0053] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. A primer and probe combination for detecting four viruses in the feline digestive tract, characterized in that, The primer and probe combinations for detecting four feline digestive tract viruses include a first combination, a second combination, a third combination, and a fourth combination, wherein: The first combination includes an upstream primer for FeAstV_F, a downstream primer for FeAstV_R, and a probe for FeAstV_P targeting feline astrovirus. The nucleotide sequence of the upstream primer for FeAstV_F is shown in SEQ ID NO. 1, the nucleotide sequence of the downstream primer for FeAstV_R is shown in SEQ ID NO. 2, and the nucleotide sequence of the probe for FeAstV_P is shown in SEQ ID NO.

3. The second combination includes an FPV_F upstream primer, an FPV_R downstream primer, and an FPV_P probe targeting feline panleukopenia virus. The nucleotide sequence of the FPV_F upstream primer is shown in SEQ ID NO. 4, the nucleotide sequence of the FPV_R downstream primer is shown in SEQ ID NO. 5, and the nucleotide sequence of the FPV_P probe is shown in SEQ ID NO.

6. The third combination includes an upstream primer for FCoV_F, a downstream primer for FCoV_R, and a probe for FCoV_P against feline enteric coronaviruses. The nucleotide sequence of the upstream primer for FCoV_F is shown in SEQ ID NO. 7, the nucleotide sequence of the downstream primer for FCoV_R is shown in SEQ ID NO. 8, and the nucleotide sequence of the probe for FCoV_P is shown in SEQ ID NO.

9. The fourth combination includes an upstream primer for FBoV_F, a downstream primer for FBoV_R, and a probe for FBoV_P targeting feline bocavirus type 1. The nucleotide sequence of the upstream primer for FBoV_F is shown in SEQ ID NO. 10, the nucleotide sequence of the downstream primer for FBoV_R is shown in SEQ ID NO. 11, and the nucleotide sequence of the probe for FBoV_P is shown in SEQ ID NO.

12.

2. The use of the primer and probe combination for detecting four feline digestive tract viruses as described in claim 1 in the preparation of a product for detecting four feline digestive tract viruses.

3. A kit for detecting four viruses in the feline digestive tract, characterized in that, The kit for detecting four feline digestive tract viruses comprises the primer and probe combination for detecting four feline digestive tract viruses as described in claim 1.

4. The kit for detecting four feline digestive tract viruses as described in claim 3, characterized in that, The kit for detecting four viruses in the feline digestive tract includes a PCR reaction solution and a standard template mixture; The PCR reaction solution includes the primer and probe combination for detecting four feline digestive tract viruses as described in claim 1.

5. The kit for detecting four feline digestive tract viruses as described in claim 4, characterized in that, The standard template mixture includes plasmid DNA from feline astrovirus, feline panleukopenia virus, feline enteric coronavirus, and feline bocavirus type 1.

6. The kit for detecting four feline digestive tract viruses as described in claim 4, characterized in that, The PCR reaction solution includes PCR reagents and the primer and probe combination for detecting four feline digestive tract viruses as described in claim 1: In the first combination, the concentrations of both primers and probes are 0.4 μM / μL; In the second combination, the concentrations of both primers and probes are 0.4 μM / μL; In the third combination, the concentrations of both primers and probes are 0.4 μM / μL; In the fourth combination, the concentrations of both primers and probes are 0.4 μM / μL.

7. The kit for detecting four feline digestive tract viruses as described in claim 6, characterized in that, The PCR reagents include premixed lyophilizable probe-based qPCR reagents.

Citation Information

Patent Citations

  • Multiplex fluorescent PCR (polymerase chain reaction) primer probe group and kit for detecting four feline diarrhea-related viruses and application

    CN115852043A

  • Primer probe composition, kit and method for detecting feline coronavirus and feline parvovirus

    CN116949214A

  • Multiplex PCR (polymerase chain reaction) kit for detecting cat digestive tract pathogens and application

    CN116949224A

  • Primer probe group, detection product and application thereof

    CN118813871A

  • Method for detecting panda-derived feline panleukopenia virus RAA-CRISPRCas12a

    CN120384156A