Tyrosine sulfation modified high-activity recombinant hirudin, saccharomyces cerevisiae engineering bacteria and application

Abstract

The invention belongs to the field of genetic engineering and synthetic biology, and particularly relates to tyrosine sulfation modified high-activity recombinant hirudin, saccharomyces cerevisiae engineering bacteria and application. According to the invention, saccharomyces cerevisiae is taken as a chassis cell, tyrosine protein sulfotransferase and related enzymes and transport systems are introduced through genetic engineering modification, efficient sulfation modification of the hirudin Tyr63 site is realized, and the anticoagulant activity of the hirudin Tyr63 site is remarkably improved. The method overcomes the limitations of high extraction cost of natural hirudin and lack of modification function in the existing recombination technology. In addition, the tyrosine sulfation modified high-activity recombinant hirudin provided by the invention shows an excellent antioxidant effect in the field of beauty and skin care, and experiments prove that the antioxidant activity of the tyrosine sulfation modified high-activity recombinant hirudin is equivalent to that of natural hirudin. The invention provides an innovative solution for low-cost and large-scale production of high-activity hirudin, and has the application potentials of medicines and cosmetics.

Description

[0001] This invention is a divisional application of Chinese application No. 202510726597.6, filed on June 3, 2025, entitled "A Highly Active Recombinant Hirudin Modified by Tyrosine Sulfate, Engineered Saccharomyces cerevisiae and Its Application", with applicants "Konami (Guangzhou) Biotechnology Co., Ltd.; Guangzhou Zeru New Material Technology Co., Ltd." Technical Field

[0002] This invention belongs to the fields of genetic engineering and synthetic biology, specifically relating to a highly active recombinant hirudin modified with tyrosine sulfate, an engineered strain of Saccharomyces cerevisiae, and its applications. Background Technology

[0003] Hirudin is a natural active polypeptide isolated and purified from the salivary glands of leeches. It consists of 65-66 amino acid residues and features a non-glycosylated, acidic single-chain structure. It is the most effective known natural thrombin inhibitor and is widely used clinically for the treatment of cardiovascular diseases.

[0004] Sulfation of the tyrosine residue (Tyr63) in hirudin is a key modification to its structure and function, catalyzed by tyrosine protein sulfonate transferase (TPST), which transfers the sulfate group from 3'-adenosine-5'-phosphate sulfate (PAPS) to the 63-tyrosine residue. Following Tyr63 sulfation, the C-terminal region of hirudin (including Tyr63) exhibits significantly enhanced specific binding to the exosite I site of thrombin, resulting in a 10-fold increase in its ability to inhibit thrombin. However, the low yield and high extraction cost of natural hirudin severely limit its application.

[0005] Currently, *E. coli* or engineered yeast expression systems are the main expression systems for recombinant hirudin production. Among them, *Saccharomyces cerevisiae*, as a host system for hirudin expression, has several significant advantages: ① It has a clear genetic background and is easy to operate, making it suitable for efficient gene editing and hirudin expression; ② It possesses a natural secretion system, enabling efficient secretion of hirudin into the culture medium, simplifying downstream purification processes; ③ It has the ability to form disulfide bonds, ensuring the correct folding of the N-terminal functional domain of hirudin. Furthermore, *Saccharomyces cerevisiae* grows rapidly, has low culture costs, and high safety (GRAS certified), making it suitable for high-density fermentation and large-scale production. It is an environmentally friendly and resource-efficient expression system. These advantages make it an ideal choice for the efficient production of high-quality, highly active hirudin, providing important technical support for the pharmaceutical and cosmetic skincare fields. However, *Escherichia coli* or *Saccharomyces cerevisiae*, as expression hosts, lack TPST-mediated post-translational modification capabilities, preventing them from completing Tyr63 sulfation modification. Consequently, the efficacy of their expressed recombinant hirudin is only one-tenth that of natural hirudin. Therefore, developing a highly efficient expression system capable of achieving Tyr63 sulfation modification is of great significance for enhancing the activity of recombinant hirudin and promoting its widespread application in the medical field.

[0006] Furthermore, as a natural antithrombin active substance, hirudin has been extensively studied in the field of pharmacology, particularly demonstrating significant effects in anticoagulation, antithrombosis, lowering blood pressure, and lowering blood lipids. However, its application in the cosmetic and skincare field is relatively less studied. Research indicates that it possesses multiple benefits, including antioxidant, anti-aging, whitening, anti-inflammatory, repairing, improving microcirculation, oil control, and pore shrinking effects, while also exhibiting high safety and non-irritation. These characteristics make it a highly promising functional skincare ingredient, with the potential for widespread application in high-end skincare products for anti-aging, whitening, and repair. With further research and advancements in production technology, the application prospects of hirudin in the cosmetics field will become even broader. Summary of the Invention

[0007] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a Saccharomyces cerevisiae engineered strain that expresses highly active recombinant hirudin modified with tyrosine sulfate.

[0008] Another object of the present invention is to provide a method for constructing the above-mentioned engineered brewer's yeast.

[0009] Another object of the present invention is to provide a highly active recombinant hirudin modified with tyrosine sulfate.

[0010] A fourth objective of this invention is to provide a method for preparing the above-mentioned highly active recombinant hirudin modified with tyrosine sulfate.

[0011] The fifth objective of this invention is to provide the application of the above-mentioned engineered Saccharomyces cerevisiae or highly active recombinant hirudin modified with tyrosine sulfate.

[0012] The objective of this invention is achieved through the following technical solution:

[0013] A highly active recombinant hirudin-expressing *Saccharomyces cerevisiae* strain expressing tyrosine sulfate modification was obtained through the following method:

[0014] Using *Saccharomyces cerevisiae* as the starting strain, the MET3Δ, MET14, SLL, and TPST1 gene expression elements were integrated into the chromosome of *Saccharomyces cerevisiae* to obtain an engineered strain of *Saccharomyces cerevisiae* with a tyrosine sulfate modification system. Then, a recombinant plasmid containing a recombinant hirudin gene expression element was introduced into the engineered strain of *Saccharomyces cerevisiae* with the tyrosine sulfate modification system to obtain an engineered strain of *Saccharomyces cerevisiae* expressing highly active recombinant hirudin with tyrosine sulfate modification.

[0015] The preferred strain of Saccharomyces cerevisiae is CEN.PK2-1D.

[0016] The recombinant hirudin gene expression element includes the rHirudin gene, the promoter TEF1p, and the terminator ADH1t. The rHirudin gene is composed of an AGA2 secretory peptide nucleic acid sequence, a His tag nucleic acid sequence, an enterokinase digested nucleic acid sequence, and a truncated Hirudin gene sequence linked together in sequence. The nucleotide sequence of the rHirudin gene is shown in SEQ ID No:1.

[0017] The recombinant plasmid containing the recombinant hirudin gene expression element was obtained by inserting the recombinant hirudin gene expression element into the free plasmid pRS416.

[0018] The MET3Δ gene expression element comprises the coding sequence of the functional region of the MET3 gene derived from Saccharomyces cerevisiae (amino acid sequence of MET3 positions 1-393) and its promoter and terminator (MET3p and MET3t), and the nucleotide sequence of the gene expression element is shown in SEQ ID No:2.

[0019] The MET14 gene expression element includes the coding sequence of the MET14 gene derived from Saccharomyces cerevisiae, as well as its promoter and terminator (MET14p and MET14t), and the nucleotide sequence of the gene expression element is shown in SEQ ID No:3.

[0020] The SLL gene expression element includes the SLL gene coding sequence, the Saccharomyces cerevisiae promoter TDH3p, and the terminator CYC1t. The nucleotide sequence of the SLL gene coding sequence is shown in SEQ ID No:4.

[0021] The TPST1 gene expression element includes the coding sequence of the TPST1 gene and the Saccharomyces cerevisiae promoter PGK1p and terminator PDC1t.

[0022] The TPST1 gene is the hTPST1 (from human), bTPST1 (from bovine), or eTPST1 (from nematode) gene, and the coding sequences of the hTPST1 and bTPST1 genes are shown in SEQ ID No:5 or 6.

[0023] The eTPST1 gene is either the wild-type eTPST1 gene or the mutant eTPST1 gene; the coding sequence of the wild-type eTPST1 gene is shown in SEQ ID No:7; the mutant eTPST1 gene is eTPST1 Q113R eTPST1 Q113K eTPST1 Q113H eTPST1 T201R eTPST1 T201K or eTPST1 T201H eTPST1 Q113R eTPST1 Q113K eTPST1 Q113H The corresponding mutation sites are 337-339 bp, and the corresponding mutated nucleotide sequences are AGA, AAA, and CAT, respectively; eTPST1 T201R eTPST1 T201K or eTPST1 T201H The corresponding mutation sites are 601-603bp, and the corresponding mutated nucleotide sequences are AGA, AAA, and CAT, respectively.

[0024] The nucleotide sequence of the promoter TDH3p is shown as positions 9954286 to 9955085 in NCBI database sequence accession number CP029160.1; the nucleotide sequence of the promoter PGK1p is shown as positions 124102 to 124853 in NCBI database sequence accession number CP135951.1; and the nucleotide sequence of the promoter TEF1p is shown as positions 707052 to 707481 in NCBI database sequence accession number CP029160.1. The nucleotide sequence of the terminator CYC1t is shown from position 1301 to 1607 in NCBI database sequence accession number KC879308.1; the nucleotide sequence of the terminator PDC1t is shown from position 3660519 to 3660915 in NCBI database sequence accession number CP029160.1; and the nucleotide sequence of the terminator ADH1t is shown from position 4671969 to 4672126 in NCBI database sequence accession number CP029160.1.

[0025] The method for constructing the engineered Saccharomyces cerevisiae strain expressing highly active recombinant hirudin modified with tyrosine sulfate includes the following steps:

[0026] I. Using Saccharomyces cerevisiae CEN.PK2-1D as the starting strain, the MET3Δ gene expression element and the MET14 gene expression element were inserted into the yeast chromosome through homologous recombination to obtain the engineered strain ZR-01;

[0027] II. Using the engineered strain ZR-01 obtained in step I as the object, the SLL gene expression element was inserted through gene editing to obtain the engineered strain ZR-02;

[0028] III. Using the engineered strain ZR-02 obtained in step II as the object, the TPST1 gene expression element was inserted through gene editing to obtain engineered strains (ZR-03, ZR-04, ZR-05, ZR-05 / 01 to ZR-05 / 06) containing the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element, and TPST1 gene expression element; among them, the engineered strain corresponding to the insertion of the hTPST1 gene expression element is ZR-03, the engineered strain corresponding to the insertion of the bTPST1 gene expression element is ZR-04, the engineered strain corresponding to the insertion of the wild-type eTPST1 gene expression element is ZR-05, and the engineered strain corresponding to the insertion of the mutant eTPST1 gene expression element is ZR-05 / 01 to ZR-05 / 06.

[0029] IV. Using the engineered strains obtained in step III as the target, recombinant plasmids containing recombinant hirudin gene expression elements were transferred into them by lithium acetate method to obtain strains ZR-07~09 and ZR-10~15, which are engineered Saccharomyces cerevisiae strains expressing highly active recombinant hirudin modified with tyrosine sulfate.

[0030] The engineered strain ZR-01 mentioned in step I is preferably prepared by the following method:

[0031] Design and synthesize a nucleic acid sequence, the nucleic acid sequence including: GAL7 UP MET3Δ gene expression elements (MET3p-MET3Δ-MET3t), MET14 gene expression elements (MET14p-MET14-MET14t), LEU2p-LEU2, and GAL7 DOWN The fragment was then transformed into Saccharomyces cerevisiae using the lithium acetate method, and positive clones were screened on LEU auxotrophic medium to obtain strain ZR-01.

[0032] The GAL7 UP and GAL7 DOWNThe fragment is located at the Gal7 site of the Saccharomyces cerevisiae genome, and its nucleotide sequence is shown in SEQ ID No:8-9.

[0033] The engineered strain ZR-02 described in step II is preferably prepared by the following method:

[0034] (1) Design and synthesize a nucleic acid sequence, the nucleic acid sequence including: GAL1 UP SLL gene expression elements and GAL1 DOWN Enzyme cleavage sites are set at the upstream and downstream ends, respectively;

[0035] (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-GAL1. UP -TDH3p-SLL-CYC1t-GAL1 DOWN ;

[0036] (3) Amplification of recombinant plasmid pUC57-GAL1 in Escherichia coli UP -TDH3p-SLL-CYC1t-GAL1 DOWN GAL1 was obtained by double enzyme digestion. UP -TDH3p-SLL-CYC1t-GAL1 DOWN Fragment;

[0037] (4) Incorporate gene editing plasmids with GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN The fragment was transformed into strain ZR-01 using the lithium acetate method, and positive transformants were screened to obtain engineered strain ZR-02.

[0038] The GAL1 UP and GAL1 DOWN The fragment is located at the Gal1 site in the Saccharomyces cerevisiae genome, and its nucleotide sequence is shown in SEQ ID No:10-11.

[0039] The engineered strains containing the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element, and TPST1 gene expression element described in step III are preferably prepared by the following method:

[0040] (1) Design and synthesize a nucleic acid sequence, the nucleic acid sequence comprising: HO UP Sequence, TPST1 gene expression elements and HO DOWN Sequences were defined, and restriction enzyme sites were set upstream and downstream, respectively;

[0041] (2) The sequence synthesized in step (1) was ligated by enzyme digestion and inserted into the pUC57 plasmid to construct the recombinant plasmid pUC57-HO. UP -PGK1p-TPST1-PDC1t-HO DOWN ;

[0042] (3) Amplification of recombinant plasmid pUC57-HO in Escherichia coli UP -PGK1p-TPST1-PDC1t-HO DOWN HO was obtained by double enzyme digestion UP -PGK1p-TPST1-PDC1t-HO DOWN Fragment;

[0043] (4) Incorporate gene editing plasmids with HO UP -PGK1p-TPST1-PDC1t-HO DOWN The fragment was transformed into strain ZR-02 using the lithium acetate method, and positive transformants were screened to obtain the target engineered strain.

[0044] The HO UP and HO DOWN The fragment is a homologous arm of the HO gene in Saccharomyces cerevisiae, and its nucleotide sequence is shown in SEQ ID No:12-13.

[0045] The starting plasmid for the gene editing plasmid is pRS416. The gene editing plasmid is based on pRS416, with the following components inserted: a Cas9 expression element and a gRNA expression element. The Cas9 expression element encodes the Cas9 nuclease for targeted cleavage of the target DNA sequence, as well as a promoter and terminator. The gRNA expression element includes a guide RNA sequence targeting a specific site in the *Saccharomyces cerevisiae* genome, a gRNA scaffold sequence, a promoter, and a terminator. The gRNA expression element is preferably GAL1. sgRNA Expression element or HO sgRNA Expression element.

[0046] The recombinant plasmid containing the recombinant hirudin gene expression element mentioned in step IV is preferably prepared by the following method:

[0047] (1) A recombinant hirudin gene expression element (TEF1p-rHirudin-ADH1t) was artificially synthesized and restriction enzyme sites were set at the upstream and downstream ends, respectively;

[0048] (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t.

[0049] (3) The recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t was amplified by E. coli and the TEF1p-rHirudin-ADH1t fragment was obtained by double enzyme digestion.

[0050] (4) The TEF1p-rHirudin-ADH1t fragment was ligated to the pRS416 vector through the restriction site to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t.

[0051] The method for constructing the engineered Saccharomyces cerevisiae expressing recombinant hirudin modified with tyrosine sulfate preferably further includes the following steps:

[0052] Design and synthesize fusion gene expression elements (rDNA) including rDNA homologous arm fragments. UP -PGK1p-KanMX4-P2A-eTPST1 T201K -PDC1t-rDNA DOWN The nucleic acid sequence of this expression element includes: rDNA UP , PGK1p, KanMX4, P2A, TPST1, PDC1t, rDNA DOWN The element was transformed into the engineered strain ZR-02 using the lithium acetate method, and strains containing high-copy TPST1 genes were screened using G418. The strain containing high-copy TPST1 genes was then transformed into a recombinant plasmid (pRS416-TEF1p-rHirudin-ADH1t) containing the recombinant hirudin gene expression element to obtain an engineered Saccharomyces cerevisiae strain expressing recombinant hirudin modified with tyrosine sulfate.

[0053] The TPST1 gene is preferably eTPST1. T201R .

[0054] The rDNA UP and rDNA DOWN This is a fragment located in the rDNA of Saccharomyces cerevisiae, where the rDNA... UP and rDNA DOWN The nucleotide sequences are shown in SEQ ID No:14-15. The nucleotide sequence of the KanMX4 resistance gene is shown in SEQ ID No:16, and the nucleotide sequence of the P2A self-cleaving peptide is shown in SEQ ID No:17.

[0055] A highly active recombinant hirudin modified with tyrosine sulfate was obtained by expressing the above-mentioned engineered Saccharomyces cerevisiae containing highly active recombinant hirudin modified with tyrosine sulfate.

[0056] The method for preparing the highly active recombinant hirudin modified with tyrosine sulfate includes the following steps:

[0057] The engineered strain of Saccharomyces cerevisiae expressing highly active recombinant hirudin modified with tyrosine sulfate was fermented, the supernatant of the fermentation broth was collected and purified to obtain highly active recombinant hirudin modified with tyrosine sulfate.

[0058] The application of the highly active recombinant hirudin modified with tyrosine sulfate or the engineered Saccharomyces cerevisiae in the preparation of antithrombin products.

[0059] The application of the highly active recombinant hirudin modified with tyrosine sulfate or the engineered Saccharomyces cerevisiae in the preparation of anticoagulant, antithrombotic, antihypertensive or hypolipidemic drugs.

[0060] The application of the highly active recombinant hirudin or engineered Saccharomyces cerevisiae modified with tyrosine sulfate in the field of beauty and skincare, including but not limited to antioxidant effects.

[0061] Technical principle of the invention:

[0062] Sulfate adenosine transferase (MET3) and adenosine-5'-phosphate sulfate kinase (MET14) are related synthases of the tyrosine sulfation modification donor 3′-phosphate adenosine-5′-phosphate (PAPS). PAPS is transported to the Golgi apparatus via the 3′-phosphate 5′-phosphate transporter (SLL). Under the catalysis of tyrosine protein sulfotransferase (TPST1), the sulfate group of PAPS is transferred to the 63rd tyrosine residue of hirudin, thereby completing tyrosine sulfation. Based on the above mechanism, in order to introduce a protein tyrosine sulfation modification system into the Saccharomyces cerevisiae expression system, this invention selects Saccharomyces cerevisiae as the starting strain and integrates the MET3Δ (MET3 functional region) gene expression element, the MET14 gene expression element, the SLL gene expression element, and the TPST1 gene expression element into the yeast chromosome to obtain an engineered strain with an introduced tyrosine sulfation modification system. Specifically:

[0063] The MET3Δ and MET14 gene expression elements express adenosine sulfate transferase and adenosine 5'-phosphosulfanilamide kinase, respectively, both derived from Saccharomyces cerevisiae. Their introduction can increase the level of the sulfation modification donor 3'-phosphoadecanoside-5'-phosphosulfate (PAPS) in the expressing strain. The SLL gene expression element expresses a 3'-phosphoadecanoside-5'-phosphosulfate transporter protein derived from Drosophila. Its introduction has been reported to increase the PAPS level in the Golgi apparatus of Saccharomyces cerevisiae by 5.6 times (Shin Kamiyama et al. J Biol Chem 2003 Jul 11). The TPST1 gene expression element expresses a tyrosine protein sulfotransferase 1 protein. Its introduction can directly catalyze the sulfation of recombinant hirudin at the Tyr63 position. In summary, this invention significantly enhances the anticoagulant activity of hirudin by increasing the levels of PAPS-related synthases MET3 and MET14 and introducing SLL and TPST1, ultimately achieving sulfation modification of hirudin Tyr63.

[0064] In constructing a *Saccharomyces cerevisiae* engineered strain expressing recombinant hirudin modified with tyrosine sulfate, this invention first studied the effects of TPST1 genes from different sources on the expression level of recombinant hirudin and the sulfation modification level of recombinant hirudin Tyr63. After fermentation screening, the engineered strains ZR-06 to ZR-09 showed similar recombinant hirudin expression levels. Figure 1 ZR-09 expressed recombinant hirudin with a higher level of Tyr63 sulfation modification. Figure 1 Furthermore, thrombin titration showed that the recombinant hirudin expressed by strain ZR-09 also exhibited higher activity. Figure 2 Based on this, the present invention selects to further mutate and optimize the activity of eTPST1. Through αfold3 simulated docking, the binding regions of Q113 and T201 of eTPST1 with hirudin are smaller than […]. ( Figure 3 The hirudin-binding region is rich in negatively charged E, therefore, a positively charged mutation is made in two amino acids. The eTPST1 mutant includes eTPST1. Q113R eTPST1 Q113K eTPST1 Q113H eTPST1 T201R eTPST1 T201K and eTPST1 T201HThe corresponding engineered strains were numbered ZR-10 to ZR-15. The construction method for strains ZR-10 to ZR-15 was the same as for ZR-09, that is, the mutant recombinant plasmid containing a homologous arm mutant TPST1 gene expression element fragment (obtained by site-directed mutagenesis PCR) and the recombinant hirudin expression plasmid were edited into strain ZR-02. After fermentation screening and comparison, strains ZR-10 to ZR-15 showed consistent expression levels (…). Figure 3 The ZR-13 strain exhibits higher recombinant hirudin activity. Figure 4 This invention further optimizes eTPST1. T201R The copy number was further used to construct the engineered strain ZR-16.

[0065] The present invention has the following advantages and effects compared with the prior art:

[0066] (1) This invention uses Saccharomyces cerevisiae as the chassis cell and introduces tyrosine protein sulfonate transferase (TPST1) and related enzymes and transport systems (MET3, MET14, SLL) through genetic engineering to achieve efficient sulfation modification of hirudin at the Tyr63 site, which significantly enhances its anticoagulant activity.

[0067] (2) This invention achieves eTPST1 through the selection of TPST1 genes from different sources, the directed mutation of the eTPST1 gene, and the realization of eTPST1 via rDNA. T201R High-copy integration significantly enhances the activity of recombinant hirudin.

[0068] (3) This invention overcomes the limitations of high extraction cost of natural hirudin and lack of modification function in existing recombinant technology. In addition, sulfated hirudin shows excellent antioxidant effects in the field of beauty and skin care. Experiments have shown that its antioxidant activity is comparable to that of natural hirudin, and it has the potential for both pharmaceutical and cosmetic applications.

[0069] (4) The recombinant hirudin expression system provided by the present invention has significant advantages in terms of production cost, biosafety, production efficiency, convenience of genetic manipulation and product activity. It provides an innovative solution for low-cost and large-scale production of highly active hirudin and opens up new avenues for the research and development and production of recombinant modified highly active peptides. Attached Figure Description

[0070] Figure 1 This is a Western blot result of recombinant hirudin expression in strains ZR-06~09 and sulfation modification with Tyr63.

[0071] Figure 2 This is a graph showing the comparative analysis of the activity of recombinant hirudin expressed by strains ZR-06 to ZR-09.

[0072] Figure 3This is a diagram illustrating the αfold3 simulation of the binding of eTPST1 with hirudin.

[0073] Figure 4 This is a Western blot analysis of the recombinant hirudin expressed by strain ZR-10-15.

[0074] Figure 5 This is a graph showing the comparative analysis of the activity of recombinant hirudin expressed by strains ZR-10 to ZR-15.

[0075] Figure 6 This is a graph showing the results of the analysis of the expression (A) and activity comparison (B) of recombinant hirudin between strains ZR-13 and ZR-16.

[0076] Figure 7 This is a graph showing the results of the evaluation of the antioxidant efficacy of recombinant hirudin expressed by strain ZR-16. Detailed Implementation

[0077] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0078] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. In the embodiments, processes and methods not described in detail are conventional methods known in the art. Reagents used in the embodiments were commercially available, and experimental procedures and conditions not specified are in accordance with conventional procedures and conditions in the art.

[0079] YPD medium is prepared in the following order: 10g yeast extract, 20g peptone, 20g glucose, 20g agar (added to solid medium), and ddH2O to a final volume of 1L. SC-Ura medium is prepared in the following order: 6.7g yeast nitrogen (YNB), 0.77g amino acid mixture (excluding uracil), 20g glucose, 20g agar (added to solid medium), and ddH2O to a final volume of 1L. SC-Leu medium is prepared in the following order: 6.7g yeast nitrogen (YNB), 0.77g amino acid mixture (excluding leucine), 20g glucose, 20g agar (added to solid medium), and ddH2O to a final volume of 1L. Tris-HCl buffer is prepared in the following order: 121.14 g Tris, add ddH2O to 1 L, and adjust the pH to 7.4 with HCl. 500 mM imidazole elution buffer is prepared in the following order: 68.08 g imidazole, 2.42 g Tris, 29.22 g NaCl, add ddH2O to 1 L, and adjust the pH to 8.0 with HCl.

[0080] The yeast genomic DNA extraction kit (catalog number: DP307) and plasmid miniprep kit (catalog number: DP105) used in the examples were purchased from Tiangen Biotech Co., Ltd.; restriction endonucleases such as Kpn I (catalog number: R3142V), Hind III (catalog number: R0104V), EcoRI (catalog number: R0101S), and Bam HI (catalog number: R3136S), and T4 ligase (catalog number: M0202) were purchased from NEB; and the gel extraction kit (catalog number: B518131-0100) was purchased from Sangon Biotech (Shanghai) Co., Ltd. The pRS416 free plasmid used in the examples was purchased from BioWind.

[0081] Example 1: Construction of engineered strains ZR-01-02

[0082] I. Construction of engineered strain ZR-01

[0083] 1. A sequence artificially synthesized containing a MET3Δ gene expression element + MET14 gene expression element + LEU2p-LEU2 element (GAL7) with homologous arms. UP -MET3p-MET3Δ-MET3t-MET14p-MET14-MET14t-LEU2p-LEU2-GAL7 DOWN The synthesized fragment was transformed into strain CEN.PK2-1D using the lithium acetate method. The addition order and volume of the system were as follows: 50% PEG3350 240 μL, 1M LiAc 36 μL, ssDNA 10 μL, DNA fragment 1 μg, and CEN.PK2-1D competent cells 50 μL. The cells were cultured in SC-Leu medium for 2-3 days, positive samples were screened, and the insertion of expression elements was verified by PCR, resulting in engineered strain ZR-01 containing MET3Δ and MET14 gene expression elements. Among them, LEU2p-LEU2 (SEQ ID No:18) is… Addgene: pESC-LEU(V5 and HA)Sequences The "LEU2" in the text contains a total of 1095bp. https: / / www.addgene.org / 222486 / sequences / .

[0084] MET3p-MET3Δ-MET3t sequence (character borders represent starters and stopers):

[0085]

[0086] MET14p-MET14-MET14t sequence (character borders represent starters and stopers):

[0087]

[0088] GAL7 UP The nucleotide sequence is shown below:

[0089] TTGACGCTTATTGTCAAGGCTTTCATCCCGATTCCAATATTACATTAGAAGTTTTAAGTACAGAGCCAACTTATCAATTTTATACCGGTGATTTCTTGTCTGCTGGTTACGAAGCAAGACAAGGTTTTGCAATTGAGCCTGGTAGATACATTGATGCTATCAATCAAGAGAACTGGAAAGATTGTGTAACCT

[0090] GAL7 DOWN The nucleotide sequence is shown below:

[0091] GGGTCCAAGATTGTCTACAGATTTTCCTGATTTGCCAGCTTACTATCCTTCTTGAAAATATGCACTCTATATCTTTTAGTTCTTAATTGCAACACATAGATTTGCTGTATAACGAATTTTATGCTATTTTTTAAATTTGGAGTTCAGTGATAAAAGTGTCACAGCGAATTTCCTCACATGTAGGGACCGAATTG

[0092] II. Construction of engineered strain ZR-02

[0093] 1. Construction of the GAL1 gene editing vector, the steps are as follows:

[0094] (1) Artificial synthesis of Cas9 expression elements and GAL1 sgRNA The expression element sequence was inserted into the pUC57 plasmid, and the recombinant plasmid was transformed into E. coli DH5α for amplification. The plasmid was then extracted using a plasmid miniprep kit. The plasmid was then double-digested with Kpn I and Hind III. The digestion system was added in the following order and volume: Kpn I 1.5 μL, Hind III 1.5 μL, 10×cutsmartbuffer 5 μL, pUC57-TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA -32 μL of SUP4t plasmid. This plasmid contains Cas9 expression elements and GAL1... sgRNA The expression element sequence is Addgene:pYZ463 Sequences( https: / / www.addgene.org / browse / sequence / 403781 / The sequence TGAGTTCAATTCTAGCGCAA is inserted after 8737bp in the range of 3617-8836bp.

[0095] (2) After enzymatic digestion, the system was subjected to 2% agarose gel electrophoresis. A gel block of approximately 5200 bp was excised and recovered using a gel recovery kit to obtain TEF1p-Cas9-CYC1t-SNR52p-GAL1. sgRNA -SUP4t fragment (SEQ ID No:19).

[0096] (3) The free pRS416 plasmid was transformed into E. coli DH5α for amplification and the plasmid was extracted using a plasmid miniprep kit. Then, it was double digested with Kpn I and Hind III. The order and volume of the digestion system were as follows: Kpn I 1.5 μL, HindIII 1.5 μL, 10×cutsmart buffer 5 μL, and pRS416 free plasmid 32 μL.

[0097] (4) After the enzyme digestion system was subjected to 2% agarose gel electrophoresis, a gel block of approximately 4800 bp was cut off and recovered using a gel recovery kit to obtain the pRS416 digested fragment.

[0098] (5)TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA The SUP4t fragment and the pRS416 digested fragment were ligated using T4 ligase to obtain the recombinant plasmid pRS416-TEF1p-Cas9-CYC1t-SNR52p-GAL1. sgRNA -SUP4t is the GAL1 gene editing plasmid. The ligation system is added in the following order and volume: T4 DNA Ligase Buffer (10×) 2μL, TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA 2 μL of SUP4t fragment, 2 μL of pRS416 digested fragment, 1 μL of T4 DNA Ligase, and 13 μL of ddH2O.

[0099] (6) The GAL1 gene editing plasmid was transformed into E. coli DH5α for amplification, and the plasmid was extracted using a plasmid miniprep kit for later use.

[0100] 2. Obtaining SLL gene expression element fragments with homologous arms, the steps are as follows:

[0101] (1) Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to artificially synthesize the SLL gene expression element (GAL1) with a homologous arm. UP -TDH3p-SLL-CYC1t-GAL1 DOWNThe fragment was prepared and restriction enzyme sites (EcoRI and BamHI) were set upstream and downstream, respectively. After double digestion with EcoRI and BamHI, the fragment was inserted into the pUC57 plasmid. The recombinant plasmid was transformed into E. coli DH5α for amplification, and the plasmid was extracted using a plasmid miniprep kit. Then, the fragment was double digested with EcoRI and BamHI. The order and volume of enzyme addition in the digestion system were as follows: EcoRI 1.5 μL, BamHI 1.5 μL, 10×cutsmart buffer 5 μL, pUC57-GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN 32 μL of plasmid.

[0102] (2) After the enzyme digestion system was subjected to 2% agarose gel electrophoresis, a gel block of approximately 2900 bp was excised and recovered using a gel recovery kit to obtain GAL1. UP -TDH3p-SLL-CYC1t-GAL1 DOWN DNA fragments.

[0103] 3. Construction of engineered strain ZR-02, the steps are as follows:

[0104] (1) The GAL1 gene editing plasmid and GAL1 were prepared using the lithium acetate method. UP -TDH3p-SLL-CYC1t-GAL1 DOWN DNA fragments were introduced into strain ZR-01. The required addition order and volume of the following additive system are as follows: 240 μL of 50% PEG 3350, 36 μL of 1M LiAc; 10 μL of ssDNA, 500 ng of GAL1 gene editing plasmid, and GAL1... UP -TDH3p-SLL-CYC1t-GAL1 DOWN 1 μg fragment, 50 μL competent cells.

[0105] (2) After mixing the system, incubate at 30℃ for 30 min, incubate at 42℃ for 20 min, treat with 5mM CaCl2 for 8 min, spread on SC-Ura plates and culture at 30℃ to screen positive colonies. After culturing positive colonies for 2-3 generations, perform spot-to-spot streaking on SC-Ura plates and YPD plates to screen out positive colonies that have lost the gene editing plasmid. Then perform PCR to verify the insertion of the SLL gene element, thus obtaining the engineered strain ZR-02 containing the MET3Δ gene expression element, the MET14 gene expression element and the SLL gene expression element.

[0106] The nucleotide sequence of TDH3p-SLL-CYC1t is shown below:

[0107]

[0108]

[0109] GAL1 UP The nucleotide sequence is shown below:

[0110] TATTAACAGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACC

[0111] GAL1 DOWN The nucleotide sequence is shown below:

[0112] AGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGGAT

[0113] TTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTA

[0114] TTGATTTTGATATGCTTTGCGCCGTCAAAG

[0115] Example 2: Construction of engineered bacteria ZR-03-05

[0116] 1. Construction of the HO gene editing vector, the steps are as follows:

[0117] (1) Artificial synthesis of Cas9 expression elements and HO sgRNA The expression element sequence was inserted into the pUC57 plasmid, and the recombinant plasmid was transformed into E. coli DH5α for amplification. The plasmid was then extracted using a plasmid miniprep kit. The plasmid was then double-digested with Kpn I and Hind III. The digestion system was added in the following order and volume: Kpn I 1.5 μL, Hind III 1.5 μL, 10×cutsmartbuffer 5 μL, pUC57-TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA -32 μL of SUP4t plasmid. This plasmid contains Cas9 expression elements and HO... sgRNAThe expression element sequence is 3617-8836bp in Addgene:pYZ463 Sequences, with the target sequence TCACCCACTAGTACTACCAT inserted after 8737bp.

[0118] (2) After enzymatic digestion, the system was subjected to 2% agarose gel electrophoresis. A gel block of approximately 5200 bp was excised and recovered using a gel recovery kit to obtain TEF1p-Cas9-CYC1t-SNR52p-HO. sgRNA -SUP4t fragment (SEQ ID No:20).

[0119] (3) pRS416 free plasmid was transformed into E. coli DH5α for amplification and plasmid was extracted using a plasmid miniprep kit; then double digestion was performed with Kpn I and Hind III. The order and volume of the system addition were as follows: Kpn I 1.5 μL, Hind III 1.5 μL, 10×cutsmart buffer 5 μL, pRS416 free plasmid 32 μL.

[0120] (4) After the enzyme digestion system was subjected to 2% agarose gel electrophoresis, gel blocks of approximately 4800 bp in size were cut off and recovered using a gel recovery kit to obtain the pRS416 digested fragment.

[0121] (5)TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA The SUP4t fragment and the pRS416 digested fragment were ligated using T4 ligase to obtain the recombinant plasmid pRS416-TEF1p-Cas9-CYC1t-SNR52p-HO. sgRNA -SUP4t is the HO gene editing plasmid. The required ligation system addition order and volume are as follows: T4 DNA Ligase Buffer (10×) 2μL, TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA 2 μL of SUP4t fragment, 2 μL of pRS416 digested fragment, 1 μL of T4 DNA Ligase, and 13 μL of ddH2O.

[0122] (6) The HO gene editing plasmid was transformed into E. coli DH5α for amplification, and the plasmid was extracted using a plasmid miniprep kit for later use.

[0123] 2. Obtaining TPST1 gene expression element fragments with homologous arms, the steps are as follows:

[0124] (1) Synthesize TPST1 gene elements (hTPST1, bTPST1, or eTPST1) fragments with homologous arms and set restriction enzyme sites (EcoRI and BamHI) upstream and downstream, respectively. After double digestion with EcoRI and BamHI, ligate and insert into pUC57 plasmid. Transform the recombinant plasmid into E. coli DH5α for amplification. Extract the plasmid using a plasmid miniprep kit. Then, double digest with EcoRI and BamHI. The order and volume of enzyme addition in the digestion system are as follows: EcoRI 1.5 μL, BamHI 1.5 μL, 10×cutsmart buffer 5 μL, pUC57-HO UP -PGK1p-TPST1-PDC1t-HO DOWN 32 μL of plasmid.

[0125] (2) After enzymatic digestion, the system was subjected to 2% agarose gel electrophoresis. Gel blocks of approximately 2600 bp (hTPST1), 2600 bp (bTPST1), and 2700 bp (eTPST1) were excised and recovered using a gel extraction kit to obtain HO. UP -PGK1p-TPST1-PDC1t-HO DOWN DNA fragments.

[0126] 3. Construction of engineered bacteria ZR-03~05, the steps are as follows:

[0127] (1) The HO gene editing plasmid and HO were prepared using the lithium acetate method. UP -PGK1p-TPST1-PDC1t-HO DOWN DNA fragments were introduced into strain ZR-02. The required addition order and volume of the following additive system are as follows: 240 μL of 50% PEG 3350, 36 μL of 1M LiAc; 10 μL of ssDNA, 500 ng of HO gene editing plasmid, and HO... UP -PGK1p-TPST1-PDC1t-HO DOWN 1 μg fragment, 50 μL competent cells.

[0128] (2) After mixing the system, incubate at 30℃ for 30 min, incubate at 42℃ for 20 min, treat with 5mM CaCl2 for 8 min, spread on SC-Ura plates and culture at 30℃ to screen positive colonies. After culturing positive colonies for 2-3 generations, perform spot-to-spot streaking on SC-Ura plates and YPD plates to screen out positive colonies that have lost the gene editing plasmid. Then perform PCR to verify the insertion of the TPST1 gene expression element and obtain engineered strains ZR-03 (hTPST1), ZR-04 (bTPST1) and ZR-05 (eTPST1).

[0129] Taking the hTPST1 gene element as an example, its nucleotide sequence is as follows (the underlined part is HO UP and HO DOWN ):

[0130]

[0131] The coding sequence of the bTPST1 gene is as follows:

[0132] ATGGTTGGTAAGTTGAAGCAAAACTTGTTGTTGGCTTGTTTGGTTATCTCTTCTGTTACTGTTTTCTACTTGGGTCAACAC

[0133] GCTATGGAATGTCACCACAGAATCGAAGAAAGATCTCAACCATTGAAGTTGGAAAACATCAAGACTACTGTTAGAACTG

[0134] CTTTGGACATCAAGGCTAACAAGACTTTCGCTTACCACAAGGACATGCCATTGATCTTCATCGGTGGTGTTCCAAGATCT

[0135] GGTACTACTTTGATGAGAGCTATGTTGGACGCTCACCCAGACATCAGATGTGGTGAAGAAACTAGAGTTATCCCAAGAA

[0136] TCTTGGCTTTGAAGCAAATCTGGTCTAGATCTTCTAAGGAAAAGATCAGATTGGACGAAGCTGGTGTTACTGACGAAGT

[0137] TTTGGACTCTGCTATGCAAGCTTTCTTGTTGGAAATCATCGTTAAGCACGGTGAACCAGCTCCATACTTGTGTAACAAGG

[0138] ACCCATTCGCTTTGAAGTCTTTGACTTACTTGGCTAGATTGTTCCCAAACGCTAAGTTCTTGTTGATGGTTAGAGACGGT

[0139] AGAGCTTCTGTTCACTCTATGATCTCTAGAAAGGTTACTATCGCTGGTTTCGACTTGAACTCTTACAGAGACTGTTTGACT

[0140] AAGTGGAACAGAGCTATCGAAACTATGTACAACCAATGTATGGAAGTTGGTTACAAGAAGTGTATGTTGGTTCACTACG

[0141] AACAATTGGTTTTGCACCCAGAAAGATGGATGAGAACTGTTTTGAAGTTCTTGCAAATCCCATGGAACCACTCTGTTTT

[0142] GCACCACGAAGAAATGATCGGTAAGGCTGGTGGTGTTTCTTTGTCTAAGGTTGAAAGATCTACTGACCAAGTTATCAAG

[0143] CCAGTTAACGTTGGTGCTTTGTCTAAGTGGGTTGGTAAGATCCCACCAGACGTTTTGCAAGACATGGCTGTTATCGCTCC

[0144] AATGTTGGCTAAGTTGGGTTACGACCCATACGCTAACCCACCAAACTACGGTAAGCCAGACCCAAAGATCTTGGAAAAC

[0145] ACTAGAAGAGTTTACAAGGGTGAATTTCAATTGCCAGAATTTTTGAAGGAAAAGCCACAATCTGAACAAGTTGAATAAeTPST1 gene coding sequence is as follows:

[0146] ATGAGAAAGAACAGAGAATTGTTGTTGGTTTTGTTCTTGGTTGTTTTCATCTTGTTCTACTTCATCACTGCTAGAACTGCT

[0147] GACGACCCATACTACTCTAACCACAGAGAAAAGTTCAACGGTGCTGCTGCTGACGACGGTGACGAATCTTTGCCATTCC

[0148] ACCAATTGACTTCTGTTAGATCTGACGACGGTTACAACAGAACTTCTCCATTCATCTTCATCGGTGGTGTTCCAAGATCT

[0149] GGTACTACTTTGATGAGAGCTATGTTGGACGCTCACCCAGAAGTTAGATGTGGTGAAGAAACTAGAGGTTATCCCAAGAA

[0150] TCTTGAACTTGAGATCTCAATGGAAGAAGTCTGAAAAGGAATGGAACAGATTGCAACAAGCTGGTGTTACTGGTGAAG

[0151] TTATCAACAACGCTATCTCTTCTTTCATCATGGAAATCATGGTTGGTCACGGTGACAGAGCTCCAAGATTGTGTAACAAG

[0152] GACCCATTCACTATGAAGTCTGCTGTTTACTTGAAGGAATTGTTCCCAAACGCTAAGTACTTGTTGATGATCAGAGACGG

[0153] TAGAGCTACTGTTAACTCTATCATCTCTAGAAAGGTTACTATCACTGGTTTCGACTTGAACGACTTCAGACAATGTATGAC

[0154] TAAGTGGAACGCTGCTATCCAAATCATGGTTGACCAATGTGAATCTGTTGGTGAAAAGAACTGTTTGAAGGTTTACTAC

[0155] GAACAATTGGTTTTGCACCCAGAAGCTCAAATGAGAAGAATCACTGAATTTTTGGACATCCCATGGGACGACAAGGTTT

[0156] TGCACCACGAACAATTGATCGGTAAGGACATCTCTTTGTCTAACGTTGAAAGATCTTCTGACCAAGTTGTTAAGCCAGTT

[0157] AACTTGGACGCTTTGATCAAGTGGGTTGGTACTATCCCAGAAGACGTTGTTGCTGACATGGACTCTGTTGCTCCAATGTT

[0158] GAGAAGATTGGGTTACGACCCAAACGCTAACCCACCAACTACGGTAAGCCAGACGAATTGGTTGCTAAGAAGACTGA

[0159] AGACGTTCACAAGAACGGTGCTGAATGGTACAAGAAGGCTGTTCAAGTTGTTAACGACCCAGGTAGAGTTGACAAGCC

[0160] AATCGTTGACAACGAAGTTTCTAAGTTGTAA

[0161] Example 3: Construction of recombinant hirudin expression engineered bacteria ZR-06~09

[0162] 1. The construction of the recombinant hirudin expression vector pRS416-TEF1p-rHirudin-ADH1t requires the following steps:

[0163] (1) Obtaining the TEF1p-rHirudin-ADH1t gene expression element: The TEF1p-rHirudin-ADH1t DNA fragment was artificially synthesized and restriction enzyme sites (EcoRI and BamHI) were set upstream and downstream, respectively. After double digestion with EcoRI and BamHI, the fragment was ligated and inserted into the pUC57 plasmid. The recombinant plasmid was transformed into E. coli DH5α for amplification and the plasmid was extracted using a plasmid miniprep kit. Then, the fragment was double digested with EcoRI and BamHI. The order and volume of the enzyme digestion system were as follows: EcoRI 1.5 μL, BamHI 1.5 μL, 10×cutsmart buffer 5 μL, pUC57-TEF1p-rHirudin-ADH1t plasmid 32 μL.

[0164] TEF1p-rHirudin-ADH1t DNA fragment:

[0165]

[0166] Note: The underlined part is the AGA2 secretory peptide nucleic acid sequence, the ununderlined part is the His tag nucleic acid sequence, the dotted underlined part is the enterokinase digested nucleic acid sequence, and the thick line part is the Hirudin gene sequence.

[0167] (2) After electrophoresis on a 1% agarose gel, a gel block of approximately 900 bp was cut off and recovered using a gel recovery kit to obtain the TEF1p-rHirudin-ADH1t DNA fragment.

[0168] 2. Obtaining the pRS416 vector restriction enzyme fragment, the steps are as follows:

[0169] (1) pRS416 free plasmid was transformed into E. coli DH5α for amplification. The plasmid was extracted using a plasmid miniprep kit and double-digested with EcoRI and BamHI. The order and volume of addition were as follows: EcoRI restriction enzyme 1.5 μL, BamHI restriction enzyme 1.5 μL, 10×cutsmart buffer 5 μL, pRS416 plasmid 32 μL.

[0170] (2) After the enzyme digestion system was subjected to 2% agarose gel electrophoresis, a gel block of approximately 4800 bp was cut off and recovered using a gel recovery kit to obtain the pRS416 vector enzyme digestion fragment.

[0171] (3) The TEF1p-rHirudin-ADH1t DNA fragment and the pRS416 vector digested fragment were ligated by T4 to obtain a ligation mixture. The required order and volume of the ligation system are as follows: T4 DNA Ligase Buffer (10×) 2μL, TEF1p-rHirudin-ADH1t DNA fragment 2μL, pRS416 digested fragment 2μL, T4 DNA Ligase 1μL, ddH2O 13μL.

[0172] 3. Screening for strains positive for recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t, the steps are as follows:

[0173] The above ligation mixture was transferred into DH5α, plated on ampicillin-resistant LB plates, and incubated overnight at 37°C. Strains were picked and expanded, and plasmids were extracted using a plasmid mini-prep kit and verified by PCR and sequencing to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t.

[0174] 4. Construction of engineered bacteria ZR-06~09, the steps are as follows:

[0175] (1) The recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t was transformed into strain CEN.PK2-1D (as a control) and the engineered strains ZR-03-05 constructed in Example 2 using the lithium acetate method. The order and volume of the additive system are as follows: 240 μL of 50% PEG 3350, 36 μL of 1M LiAc, 10 μL of ssDNA, 1 μg of pRS416-TEF1p-rHirudin-ADH1t plasmid, and 50 μL of competent cells.

[0176] (2) After mixing the system, incubate at 30℃ for 30 min, incubate at 42℃ for 20 min, treat with 5mM CaCl2 for 8 min, plate on SC-Ura plates and screen positive colonies at 30℃. The engineered bacteria ZR-06 (control, expressing only rHirudin), ZR-07 (MET3Δ+MET14+SLL+hTPST1+rHirudin), ZR-08 (MET3Δ+MET14+SLL+bTPST1+rHirudin), and ZR-09 (MET3Δ+MET14+SLL+eTPST1+rHirudin) were obtained respectively.

[0177] Example 4: Screening of engineered strains from ZR-07 to ZR-09 that express higher recombinant hirudin activity.

[0178] 1. Fermentation of strains: Single colonies of engineered strains ZR-06 to ZR-09 were picked and inoculated into YPD liquid medium and cultured overnight at 30°C and 200 rpm. The overnight culture was then transferred to fresh YPD liquid medium at a ratio of 1:50 (V:V) and cultured for 48 hours to ensure full protein expression and sulfation modification.

[0179] 2. Centrifugation detection: Centrifuge at 4℃ and 5000rpm for 10min, collect the culture supernatant, and take a portion of the supernatant for Western blot analysis to detect recombinant hirudin protein expression and Tyr63 sulfation modification (protein expression primary antibody is anti-his, catalog number DTH01; Tyr63 sulfation primary antibody is Sulfo-1C-A2, catalog number: ab136481; secondary antibody is goat anti-mouse IgG, catalog number: ab205719, all antibodies were purchased from Abcam, UK). The remaining fermentation supernatant was lyophilized for later use.

[0180] 3. Activity Assay: The recombinant hirudin activity was determined according to the thrombin titration method in the Pharmacopoeia of the People's Republic of China (2020 edition). The specific method was as follows: 1 g of the lyophilized powder to be tested (prepared in step 2) was accurately weighed and 5 mL of 0.9% sodium chloride solution was accurately added. The mixture was stirred thoroughly and extracted for 30 min with occasional shaking. After centrifugation, 100 μL of the supernatant was accurately weighed and placed in a test tube. 200 μL of tris(hydroxymethyl)aminomethane hydrochloride buffer (prepared on an ad hoc basis) containing 0.5% (bovine) fibrinogen (based on coagulation) was added and shaken well. The mixture was then placed in a 37°C water bath for 5 min. Thrombin solution containing 40 units per mL was added dropwise (5 μL was added dropwise every 1 min, with gentle shaking while adding) until coagulation. Each group was tested in triplicate, and the volume of thrombin solution consumed was recorded.

[0181] 4. Activity Calculation: The activity of recombinant hirudin was calculated using the formula U = C1V1 / C2V2, where U is the thrombin activity unit per 1g (U / g); C1 is the concentration of thrombin solution (U / mL); C2 is the concentration of test sample solution (g / mL); V1 is the volume of thrombin solution consumed (μL); and V2 is the amount of test sample solution added (μL).

[0182] from Figure 1 As can be seen, the expression levels of recombinant hirudin in strains ZR-06 to ZR-09 are similar. Figure 1 However, strain ZR-09 expressed a higher level of Tyr63 sulfation modification of recombinant hirudin. Thrombin titration and calculation comparisons showed that strain ZR-09 also exhibited higher activity of recombinant hirudin. Figure 2 ).

[0183] Example 5: Construction of recombinant hirudin expression engineered bacteria ZR-10~15

[0184] (1) To obtain recombinant hirudin with higher levels of Tyr63 sulfate modification, based on Examples 3 and 4 above, this study used wild-type eTPST1 protein as the research object to study its interaction with hirudin. Through αfold3 simulated docking (https: / / alphafoldserver.com / ), it was found that the Q113 and T201 binding regions of the eTPST1 protein with hirudin were smaller than... The binding region of hirudin to the eTPST1 protein is rich in negatively charged E(t) molecules. Figure 3 Therefore, positively charged mutations were performed on these two amino acids in the eTPST1 protein. The specific mutation sites are shown in Table 1.

[0185] (2) The recombinant plasmid pUC57-HO constructed in Example 2 UP -PGK1p-eTPST1-PDC1t-HO DOWN Using a template, a site-directed mutagenesis sequence was constructed using a one-step PCR method according to conventional procedures. After phosphorylation, a recombinant plasmid pUC57-HO containing a mutant eTPST1 gene expression element fragment with a homologous arm was obtained. UP -PGK1p-eTPST1 Q113R -PDC1t-HO DOWN The required primers are shown in Table 2. Alternatively, mutant eTPST1 gene expression elements with homologous arms can be directly synthesized artificially, referring to Example 2.

[0186] (3) Referring to Example 2, the mutant eTPST1 gene expression element fragment with homologous arm was digested and recovered by enzyme digestion and introduced into the engineered strain ZR-02 with the HO gene editing plasmid using the lithium acetate method. Positive samples were screened, the gene editing plasmid was discarded, and PCR was performed to verify the insertion of the mutant TPST1 gene expression element. The engineered strains corresponding to the insertion of the mutant eTPST1 gene expression element were found to be ZR-05 / 01 to ZR-05 / 06.

[0187] (4) The recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t was transformed into the positive strain obtained in step (3), using the same method as in Example 3, to obtain the eTPST1 mutant eTPST1. Q113R eTPST1 Q113K eTPST1 Q113H eTPST1 T201R eTPST1 T201K eTPST1 T201H The sequence corresponds to strains ZR-10 to ZR-15.

[0188] (3) Screening of engineered strains expressing recombinant hirudin with higher activity among ZR-10 to ZR-15: fermentation, purification and activity detection methods are the same as in Example 4.

[0189] See results Figure 4 As shown in the figure, the expression levels of recombinant hirudin in the six mutants were comparable. The activity of recombinant hirudin expressed by each strain ZR-10–15 was compared by thrombin titration and calculation; the results are shown below. Figure 5 eTPST1 T201R The mutation can significantly enhance the activity of recombinant hirudin.

[0190] Table 1. Mutation sites of eTPST1 protein

[0191]

[0192]

[0193] Table 2 Primer sequences (bolded parts are mutant nucleic acids)

[0194]

[0195] Example 6 High Copy eTPST1 T201R Construction of engineered bacteria ZR-16

[0196] 1. Artificially synthesized fusion gene expression elements rDNA including rDNA homologous arm fragments. up -pPGK1-KanMX4-P2A-eTPST1 T201R -PDC1t-rDNAdown Following the aforementioned examples, the engineered strain ZR-02 was transformed using the lithium acetate method. Positive isolates were screened by culturing on YPD plates containing 500 μg / mL G418 for 2-3 days. The positive isolates were then streaked onto YPD plates containing gradient concentrations of G418 from 1000 to 16000 μg / mL (1000 μg / mL, 2000 μg / mL, 4000 μg / mL, 8000 μg / mL, 16000 μg / mL) and cultured for 2-3 days to screen for high-copy eTPST1. T201R Positive result.

[0197] 2. Referring to the aforementioned embodiment, the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t was transferred into the positive sample screened in step 1 using the lithium acetate method. The sample was then plated onto SC-Ura plates and cultured for 2-3 days to screen for positive samples, thus obtaining the engineered strain ZR-16.

[0198] 3. Referring to Example 4, the fermentation, purification, and activity detection methods for engineered strains ZR-13 and ZR-16 were used to compare their recombinant hirudin expression activity and sulfation level. Figure 5 ).

[0199] The activity of recombinant hirudin expressed by strains ZR-13 and ZR-16 is as follows: Figure 6 As shown, the results indicate that strain ZR-16 expresses a higher level of sulfated modified highly active rHirudin.

[0200] Fusion gene expression element rDNA up -pPGK1-KanMX4-P2A-eTPST1 T201R -PDC1t-rDNA down Nucleotide sequence:

[0201]

[0202]

[0203] Note: Lowercase letters represent rDNA. UP and rDNA DOWN The underlined portion represents the nucleotide sequence of the KanMX4 resistance gene, and the dotted underline represents the nucleotide sequence of the P2A self-cleaving peptide.

[0204] Application Examples: Application of tyrosine-sulfated recombinant hirudin in the field of medical aesthetics

[0205] 1. Evaluation of the antioxidant activity of highly active rHirudin

[0206] (1) Preparation of 2',7'-Dichlorofluorescein diacetate (DCFH-DA) solution: Accurately weigh 0.0049 g of DCFH-DA, add 1 mL of methanol to dissolve completely, aliquot (100 μL / tube), and store at -20°C protected from light. The preparation process must be carried out under aseptic conditions and protected from light. When using, accurately pipette 2.5 μL of DCFH-DA stock solution, add 1 mL of serum-free DMEM medium, mix thoroughly, and prepare fresh before use.

[0207] (2) Preparation of highly active rHirudin solution: Accurately weigh 1g of highly active rHirudin lyophilized powder (ZR-16 expression product in Example 6), mix thoroughly with 100mL of distilled water, filter through a 0.22μm filter membrane to sterilize, and prepare a stock solution with a concentration of 10g / L. When using, dilute with H2O2 solution (0.2mmol / L) to prepare concentration gradients of 50, 100, 150, 200, and 250mg / L.

[0208] (3) Preparation of natural Hirudin (CAS No.: 113274-56-9) solution: Same as above.

[0209] (4) Preparation of Vitamin C solution: Accurately weigh 200.0 mg of vitamin C sample, mix thoroughly with distilled water, and bring the volume to 10 mL. Filter through a 0.22 μm filter membrane for sterilization to prepare a vitamin C stock solution with a concentration of 20 mg / mL. Store at 2-8℃ protected from light for no more than 3 months. When using, dilute with H2O2 solution (0.2 mmol / L) to prepare concentration gradients of 0.2, 0.4, 0.6, 0.8, and 1 mg / mL.

[0210] (5) Cell culture: Place Hacat cells (commercially available) in a cell culture flask, add 5 mL of cell culture medium (90% DMEM medium + 10% fetal bovine serum), and culture in a 37℃, 5% CO2 incubator. Observe cell growth under an inverted microscope. When the cells grow to 80%-90% of the culture flask, perform cell seeding.

[0211] (6) Cell seeding: Logarithmic growth phase cells were seeded into 24-well plates at a seeding density of 1×10⁶ cells / well. 5 Cells / mL, incubated for 24 hours.

[0212] (7) Evaluation system: A blank control group (group 1), an oxidation control group (group 2), a high-activity rHirudin group (group 3), a natural Hirudin group (group 4), and a positive control group (group 5) were set up. The evaluation system is shown in Table 3.

[0213] Table 3

[0214]

[0215] Note: All washing steps in this experiment were performed using a pipette. Each time, 0.5-1 mL of PBS buffer was aspirated, and the aspiration and respiration were performed gently and slowly, one column at a time. The samples in the table refer to highly active rHirudin or natural Hirudin.

[0216] After adding DCFH-DA solution, the evaluation system was incubated at 37°C in the dark for 30 min. Cells were washed three times with PBS buffer, and fluorescence intensity (MFI) was measured using a fluorescence analyzer at an excitation wavelength of 485 nm and an emission wavelength of 538 nm. After gently removing the PBS buffer from each well, cells were immediately lysed to extract total cellular protein. The total cellular protein content was determined using the BCA assay kit. ROS is expressed as fluorescence intensity per mg of protein, i.e., MFI / mg protein.

[0217] (8) Calculation of ROS inhibition rate: I ROS (%) = (1-(ROS) S -ROS B ) / (ROS H -ROS B ))×100%, where I ROS Indicates ROS inhibition rate; ROS S This indicates the ROS values ​​for sample groups (groups 3-5); ROS B This represents the ROS value of the blank control group; ROS H This indicates the ROS value of the oxidation group.

[0218] Plotting curves as follows Figure 7 The results showed that the antioxidant capacity of the highly active recombinant hirudin expressed by Tyr63 sulfated by ZR-16 was comparable to that of natural hirudin, indicating that the structure of the highly active recombinant hirudin expressed by Tyr63 sulfated by ZR-16 is close to that of natural hirudin.

[0219] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A method for constructing a *Saccharomyces cerevisiae* engineered strain expressing highly active recombinant hirudin modified with tyrosine sulfate, characterized in that: I. GAL7 UP -MET3p-MET3Δ-MET3t-MET14p-MET14-MET14t-LEU2p-LEU2-GAL7 DOWN The fragment was transformed into *Saccharomyces cerevisiae* CEN.PK2-1D via the lithium acetate method, and positive clones were screened on LEU auxotrophic medium to obtain strain ZR-01; the GAL7 UP -MET3p-MET3Δ-MET3t-MET14p-MET14-MET14t-LEU2p-LEU2-GAL7 DOWN In the fragment, the nucleotide sequence of MET3p-MET3Δ-MET3t is shown in SEQ ID No:2, the nucleotide sequence of MET14p-MET14-MET14t is shown in SEQ ID No:3, the nucleotide sequence of LEU2p-LEU2 is shown in SEQ ID No:18, and GAL7... UP and GAL7 DOWN The nucleotide sequences are shown in SEQ ID No:8-9, respectively; II. The GAL1 gene editing plasmid and GAL1... UP -TDH3p-SLL-CYC1t-GAL1 DOWN The fragment was transformed into strain ZR-01 obtained in step I using the lithium acetate method, and positive transformants were screened to obtain engineered strain ZR-02; the GAL1 gene editing plasmid was prepared by the following method: TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA The -SUP4t fragment was inserted into the starter plasmid to obtain the GAL1 gene editing plasmid; the TEF1p-Cas9-CYC1t-SNR52p-GAL1 was described. sgRNA The nucleotide sequence of the -SUP4t fragment is shown in SEQ ID No:19; the GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN In the fragment, the nucleotide sequence of SLL is shown in SEQ ID No:4, GAL1 UP and GAL1 DOWN The nucleotide sequences are shown in SEQ ID No:10-11, respectively; III. The HO gene editing plasmid and HO... UP -PGK1p-TPST1-PDC1t-HO DOWN The fragment was transformed into strain ZR-02 obtained in step II using the lithium acetate method. Positive transformants were screened to obtain engineered strains containing MET3Δ, MET14, SLL, and TPST1 gene expression elements. The HO gene editing plasmid was prepared as follows: TEF1p-Cas9-CYC1t-SNR52p-HO... sgRNA The -SUP4t fragment was inserted into the starter plasmid to obtain the HO gene editing plasmid; the TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA The nucleotide sequence of the -SUP4t fragment is shown in SEQ ID No:20; the HO UP -PGK1p-TPST1-PDC1t-HO DOWN In the fragment, TPST1 is the hTPST1 gene, bTPST1 gene, or eTPST1 gene, and the coding sequences of the hTPST1 gene, bTPST1 gene, and eTPST1 are shown in SEQ ID No:5-7, respectively; IV. Using the engineered strains obtained in step III as the target, recombinant plasmids containing the recombinant hirudin gene expression element TEF1p-rHirudin-ADH1t were transformed into the strains via the lithium acetate method to obtain engineered Saccharomyces cerevisiae strains ZR-07, ZR-08, and ZR-09 expressing highly active recombinant hirudin modified with tyrosine sulfate. The recombinant plasmids were prepared as follows: the TEF1p-rHirudin-ADH1t fragment was inserted into the starting plasmid to obtain the recombinant plasmids. The nucleotide sequence of rHirudin in the TEF1p-rHirudin-ADH1t fragment is shown in SEQ ID No:

1. ZR-07, ZR-08, and ZR-09 respectively contain the hTPST1 gene, bTPST1 gene, or eTPST1 gene. The nucleotide sequence of the promoter TDH3p is shown as positions 9954286 to 9955085 in NCBI database sequence accession number CP029160.1; the nucleotide sequence of the promoter PGK1p is shown as positions 124102 to 124853 in NCBI database sequence accession number CP135951.1; and the nucleotide sequence of the promoter TEF1p is shown as positions 707052 to 707481 in NCBI database sequence accession number CP029160.

1. The nucleotide sequences of the terminator CYC1t are shown from positions 1301 to 1607 in NCBI database sequence accession number KC879308.1; the nucleotide sequences of the terminator PDC1t are shown from positions 3660519 to 3660915 in NCBI database sequence accession number CP029160.1; and the nucleotide sequences of the terminator ADH1t are shown from positions 4671969 to 4672126 in NCBI database sequence accession number CP029160.

1. The HO described in step III UP -PGK1p-TPST1-PDC1t-HO DOWN In the clip, HO UP The nucleotide sequence is shown below: TTACAGAAAGGGTTCGCAAGTCCTGTTTCTATGCCTTTCTCTTAGTAATTCACGAAATAAACCTATGGTTTA CGAAATGATCCACGAAAATCATGTTATTATTTACATCAACATATCGCGAAAATTCATGTCATGTCCACATTAACAT CATTGCAGAGCAACAATTCATTTTCATAGAGAAATTTGCTACTA; The HO described in step III UP -PGK1p-TPST1-PDC1t-HO DOWN In the clip, HO DOWN The nucleotide sequence is shown below: TGGTACCTACTACTTTGAATTGTACTACCGCTGGGCGTTATTAGGTGTGAAACCACGAAAAGTTCACCATAA CTTCGAATAAAGTCGCGGAAAAAAGTAAACAGCTATTGCTACTCAAATGAGGTTTGCAGAAGCTTGTTGAAGCATG ATGAAGCGTTCTAAACGCACTATTCATCATTAAATATTTAAAGCTCATAA 。 2. The method for constructing engineered Saccharomyces cerevisiae according to claim 1, characterized in that: The engineered strain ZR-01 described in step I was prepared using the following method: Design and synthesize a nucleic acid sequence, the nucleic acid sequence including: GAL7 UP MET3p-MET3Δ-MET3t, MET14p-MET14-MET14t, LEU2p-LEU2 and GAL7 DOWN The fragment was then transformed into Saccharomyces cerevisiae using the lithium acetate method, and positive clones were screened on LEU auxotrophic medium to obtain strain ZR-01.

3. The method for constructing engineered brewer's yeast according to claim 1, characterized in that: The engineered strain ZR-02 described in step II was prepared using the following method: (1) Design and synthesize a nucleic acid sequence, the nucleic acid sequence including: GAL1 UP SLL gene expression elements and GAL1 DOWN Enzyme cleavage sites are set at the upstream and downstream ends, respectively; (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-GAL1. UP -TDH3p-SLL-CYC1t-GAL1 DOWN ; (3) Amplification of recombinant plasmid pUC57-GAL1 in Escherichia coli UP -TDH3p-SLL-CYC1t-GAL1 DOWN GAL1 was obtained by double enzyme digestion. UP -TDH3p-SLL-CYC1t-GAL1 DOWN Fragment; (4) Incorporate the GAL1 gene editing plasmid with GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN The fragment was transformed into strain ZR-01 using the lithium acetate method, and positive transformants were screened to obtain engineered strain ZR-02.

4. The method for constructing engineered brewer's yeast according to claim 1, characterized in that: The engineered strains containing the MET3Δ gene expression element, MET14 gene expression element, SLL gene expression element, and TPST1 gene expression element described in step III were prepared using the following method: (1) Design and synthesize a nucleic acid sequence, the nucleic acid sequence comprising: HO UP Sequence, TPST1 gene expression elements and HO DOWN Sequences were defined, and restriction enzyme sites were set upstream and downstream, respectively; (2) The sequence synthesized in step (1) was ligated by enzyme digestion and inserted into the pUC57 plasmid to construct the recombinant plasmid pUC57-HO. UP -PGK1p-TPST1-PDC1t-HO DOWN ; (3) Amplification of recombinant plasmid pUC57-HO in Escherichia coli UP -PGK1p-TPST1-PDC1t-HO DOWN HO was obtained by double enzyme digestion UP -PGK1p-TPST1-PDC1t-HO DOWN Fragment; (4) Incorporate the HO gene editing plasmid with HO UP -PGK1p-TPST1-PDC1t-HO DOWN The fragment was transformed into strain ZR-02 using the lithium acetate method, and positive transformants were screened to obtain the target engineered strain.

5. The method for constructing engineered Saccharomyces cerevisiae according to claim 1, characterized in that... It also includes the following steps: The starting plasmid mentioned in step II, III or IV is pRS416.

6. The method for constructing engineered Saccharomyces cerevisiae according to claim 1, characterized in that: The recombinant plasmid containing the recombinant hirudin gene expression element TEF1p-rHirudin-ADH1t described in step IV or V was prepared by the following method: (1) Artificially synthesize recombinant hirudin gene expression elements and set enzyme cleavage sites at the upstream and downstream ends respectively; (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t. (3) The recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t was amplified by E. coli and the TEF1p-rHirudin-ADH1t fragment was obtained by double enzyme digestion. (4) The TEF1p-rHirudin-ADH1t fragment was ligated to the pRS416 vector through the restriction site to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t containing the recombinant hirudin gene expression element.

7. A *Saccharomyces cerevisiae* engineered strain expressing highly active recombinant hirudin modified with tyrosine sulfate, characterized in that... It is constructed by the construction method described in any one of claims 1-6.

8. The use of the engineered Saccharomyces cerevisiae according to claim 7 in the preparation of antithrombin products.

9. The use of the engineered Saccharomyces cerevisiae according to claim 7 in the preparation of antithrombotic, antihypertensive or lipid-lowering drugs.

Images