Non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method, primer, probe and kit
By employing a non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method, combined with Tag primers, locked nucleic acid technology, and ARMS, a highly sensitive detection of extremely low proportions of BRAF V600E mutations in saliva samples was achieved. This solves the problem of insufficient detection sensitivity in existing technologies and provides accurate information for individualized treatment.
Patent Information
- Application Number
- CN202511089156.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies are insufficient to detect extremely low proportions of BRAF V600E gene mutations in non-invasive samples such as saliva with high sensitivity, especially in exosomes where the detection sensitivity is inadequate.
A non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method was adopted, which combined Tag primers, locked nucleic acid technology, MGB modification and mutation amplification system (ARMS). Through two rounds of PCR amplification, specific primers and probes were used to improve the sensitivity and specificity of detection.
It enables the detection of BRAF V600E gene mutations as low as 0.1% in salivary exosomes, reducing patient sampling discomfort and providing accurate basis for individualized treatment.
Smart Images

Figure CN120905368A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology and biological detection, in particular to the detection of the mutation state of the exosome mRNA BRAF gene V600E of human origin, and specifically to a non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method, primers, probes and kits. BACKGROUND
[0002] Exosomes are produced in cells and are multivesicular bodies. They are membrane vesicles secreted by living cells with a diameter of about 30-150 nm, and have a "cup plate" shape. Almost all types of cells in the human body can produce exosomes. Exosomes exist in almost all tissues, intercellular spaces, body fluids, including blood, saliva, urine and breast milk. Exosomes carry proteins, mRNAs and their degradation fragments involved in intracellular signal transduction, and are important regulators of cell activity. They play an important role in the treatment of tumor metastasis, immune regulation mechanisms, disease development, Alzheimer's disease and immune diseases, and are expected to become an early diagnostic marker for a variety of diseases.
[0003] The main separation methods of exosomes include differential centrifugation, density gradient centrifugation, size exclusion chromatography, filtration, polymer precipitation, immunosorbent separation, and isolation screening. However, the mainstream separation method in the literature on exosomes in the CNS is currently the ultracentrifugation method. Ultracentrifugation separation can accurately and repeatedly obtain exosomes while minimizing the co-purification of protein aggregates and other membrane particles.
[0004] Messenger RNA (mRNA) directly guides protein synthesis in cells by carrying genetic instructions. Its advantages include a short half-life, presence only in metabolically active cells, and the ability to specifically identify functional gene expression events. It also has strong dynamic monitoring capabilities, with mRNA abundance directly reflecting real-time transcriptional activity, making it suitable for monitoring cancer treatment responses. Additionally, it has low contamination interference, with environmental residual RNA being easily degraded, significantly reducing the risk of cross-contamination and improving detection specificity.
[0005] BRAF is a human gene that encodes the B-Raf protein. The B-Raf protein is involved in sending signals inside cells, which direct cell growth. B-Raf is a 766-amino acid regulatory signal transduction serine / threonine-specific protein kinase. B-Raf functions are involved in multiple signal transduction pathways. B-Raf is a member of the Raf family of growth signal transduction protein kinases that play a major role in the regulation of the MAP kinase / ERKs signal transduction pathway that affects cell proliferation, differentiation, and secretion. When the BRAF gene mutates, especially V600E (the lysine (Valine, V) at position 600 in the gene coding sequence is replaced by glutamic acid (Glutamic, E)), it can lead to the constitutive activation of B-Raf protein monomers and subsequent activation of MEK1 and MEK2 proteins, promoting uncontrolled cell division and proliferation, which may induce cancer. BRAF gene V600E mutation is associated with various cancers, including colorectal cancer, papillary thyroid cancer, melanoma, non-small cell lung cancer, hairy cell leukemia, brain tumors, etc. Among them, the incidence of melanoma is 40-50%, the incidence of papillary thyroid cancer is 70-80%, the incidence of colorectal cancer is 10%, and the incidence in NSCLC patients is 3-5%.
[0006] Currently, corresponding targeted drugs have been developed for BRAF gene mutations. In 2011, the first BRAF V600E targeted inhibitor Vemurafenib was approved by FDA for the treatment of advanced melanoma patients with BRAF V600E mutation, which prolonged the progression-free survival and overall survival of patients. Since then, Dabrafenib and Trametinib have been approved for the treatment of unresectable or metastatic melanoma.
[0007] With the rapid development of molecular biology, there are many detection methods for BRAF V600E mutations, such as direct sequencing, fluorescent quantitative PCR, pyrosequencing, high-resolution melting curve detection (High Resolution Melting Analysis, HRM), liquid chromatography, etc. However, the above methods are suitable for clinical tissue samples, and lack sensitivity for non-invasive saliva and other body fluid samples.
[0008] After searching, we found the following prior art and made corresponding analysis:
[0009] CN 111304329 A and CN 109576372 A both use traditional Taqman technology to detect BRAF V600E gene mutation, that is, two primers are used to amplify the BRAF gene fragment containing the mutation point indiscriminately, and two different color fluorescent labels are used to label the mutant probe and the wild type probe, respectively. The mutant probe emits light to indicate the detection of mutant sequence, and the wild type probe emits light to indicate the detection of wild type sequence. The simultaneous emission of the two probes indicates that there are both mutant sequence and wild type sequence in the sample.
[0010] CN 108277281 A patent uses one ARMS primer, one ordinary primer, one mutant probe and one wild type blocking sequence.
[0011] Using the methods of the above three patents, wild type or mutant nucleic acid samples with a larger proportion can be detected in tissue samples, but the sensitivity is insufficient for saliva samples. Because saliva contains wild type BRAF gene fragments from various tissues including salivary glands, and BRAF V600E mutant gene fragments from thyroid tumors only account for 1% or less. SUMMARY
[0012] In order to solve the problems in the prior art, the non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method, primer, probe and kit are provided, through non-invasive sampling, pathological tissue is not needed to be taken, the pain of the patient in the sampling process is reduced, the Tag primer, the locked nucleic acid technology, the MGB modification and the mutation amplification system (Amplification refractory mutation system, ARMS) technology are combined, the sensitivity is improved, and the specificity is guaranteed. Based on the detection result, a reasonable scheme can be selected for clinical individualized treatment; in addition, the non-invasive, accurate and high-throughput exosome mRNA BRAF gene V600E mutation detection kit can detect the low mutation frequency BRAF V600E gene mutation in saliva exosomes, and other detection methods on the market cannot achieve this. Specifically, the detection method of the present application can well meet the detection of the extremely low proportion of BRAF V600E mutant genes in saliva samples, two pairs of primers and one probe are used, and two rounds of PCR amplification are used to detect the extremely low proportion of BRAF V600E gene fragments in saliva samples. The first round of PCR uses a pair of allele specific ARMS primers carrying Tag nucleotides to specifically amplify the extremely low copy number of BRAF V600E mutant genes in the sample, and the product amplified will carry the Tag nucleotide sequence label. The second round of PCR uses a Tag primer to selectively amplify the PCR product of the first round, so as to avoid the amplification of a large number of wild-type genes (without Tag label) in the sample. The detection method, primer, probe and kit of the present application can detect as low as 0.1% of the BRAF V600E mutant gene fragments in the sample.
[0013] Locked nucleic acid (Locked Nucleic Acid, LNA) is a chemically modified nucleic acid analogue, the core feature is that the 2'-O and 4'-C atoms of the ribose ring are connected by a methylene bridge to form a rigid ring structure ("locked" state), which greatly reduces the conformational freedom of ribose. This rigid structure makes LNA bind more tightly to complementary mRNA / RNA, while requiring more stringent base pairing, reducing binding to non-target sequences and improving the specificity of the product.
[0014] MGB probe (Minor Groove Binder Probe) is a molecular tool that enhances the performance of the probe through chemical modification, which covalently connects a minor groove binder (such as a bis-benzimidazole derivative) at the 3' end of the probe. The molecule can be embedded in the minor groove region of the mRNA double helix, enhancing the binding stability of the probe to the target. MGB forces the probe to form a strict base pairing with the target, which is particularly suitable for distinguishing SNPs (single nucleotide polymorphisms).
[0015] The basic principle of the amplification refractory mutation system (ARMS) technology is that Taq mRNA polymerase lacks 3'→5' proofreading activity, and when the 3' end of the primer is mismatched with the template, the amplification efficiency is significantly reduced or even completely inhibited. ARMS uses this feature to design allele-specific primers (Allele-Specific Primers) so that their 3' ends are completely matched with mutant sequences.
[0016] The first aspect of the present application provides a non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method, comprising:
[0017] S1, separating an exosome sample, comprising: treating the exosome sample with an equal volume of PEG 6000, mixing uniformly, and precipitating and separating the exosome sample at a temperature environment of 4℃ overnight; centrifuging the precipitated and separated exosome sample at 12000 rpm for 30 min; extracting an mRNA sample in a supernatant sample and purifying; wherein the exosome sample is from a body fluid, and the body fluid is saliva and / or urine;
[0018] S2, using mRNA as a template, adding an exogenous reference gene and a primer pair for detecting the exogenous reference gene, and simultaneously using a Tag-ARMS primer pair for specifically enriching an exosome mRNA BRAF gene V600E mutation to perform a first round of PCR amplification reaction to form a PCR product; the upstream primer sequence of the Tag-ARMS primer pair is SEQ ID No. 1 sequence, and the downstream primer sequence is SEQ ID No. 2 sequence; the upstream primer sequence of the primer pair for detecting the exogenous reference gene is SEQ ID No. 6 sequence, and the downstream primer sequence is SEQ ID No. 7 sequence; wherein the SEQ ID No. 1 sequence is: ATGCGATGCGATGCGACCTCACAGTAAAAATAGGTG; the SEQ ID No. 2 sequence is: TGACTGACTGACGGGACCCACTCCATCGAGATTTAt, wherein the lowercase letters are lock nucleic acid labeled bases; the SEQ ID No. 6 sequence is: TGACTTAGTTGCGTTACACCCTTT or TGACTTAGTTGCGTTACACCCGTT; and the SEQ ID No. 7 sequence is:
[0019] CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC;
[0020] S3, using the PCR product as a template, using a system without UNG enzyme for amplification, adding a primer pair for detecting an internal reference gene, and using a specific Tag primer pair for detecting the mRNA BRAF gene V600E mutation of human exosomes and a probe sequence for a second round of PCR amplification reaction; the upstream primer sequence of the Tag primer pair is SEQ ID No. 3 sequence, and the downstream primer sequence is SEQ ID No. 4 sequence; the probe sequence is SEQ ID No. 5 sequence; the upstream primer sequence of the primer pair for detecting the internal reference gene is SEQ ID No. 6 sequence, and the downstream primer sequence is SEQ ID No. 7 sequence, and the probe sequence is SEQ ID No. 8 sequence; the SEQ ID No. 3 sequence is: ATGCGATGCGATGCGAC or ATGCGATGCGAGGCGAC; the SEQ ID No. 4 sequence is: TGACTGACTGACGGGACCCA or TGACTGACTGACGGGAGCCA; the SEQ ID No. 5 sequence is TGGTCTAGCTACAGATAA or TGGTCTAGCTACAGAGAA; the SEQ ID No. 6 sequence is: TGACTTAGTTGCGTTACACCCTTT or TGACTTAGTTGCGTTACACCCGTT; the SEQ ID No. 7 sequence is: CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC; and the SEQ ID No. 8 is: CAAAACCTAACTTGCGCAGA or CAAAACCTAGCTTGCGCAGA;
[0021] S4, judging the mutation state of the BRAF gene V600E site of the mRNA sample of the exosome, comprising: judging the mutation state of the BRAF gene V600E site of the mRNA sample of the exosome according to the CT value.
[0022] Preferably, the concentration of the purified mRNA sample is 5-10 ng / μL.
[0023] Preferably, the S2 comprises:
[0024] S21, adding the mRNA sample extracted from the exosome sample to the Tag-ARMS PCR reaction solution for specifically enriching and detecting the mRNA BRAF gene V600E mutation of human exosomes;
[0025] S22, reverse transcribing the mRNA sample into cDNA using random primers, comprising: digesting genomic DNA under temperature and time conditions of 42℃ and 2 min, then performing reverse transcription under temperature and time conditions of 25℃ and 5 min and 42℃ and 15 min; then inactivating reverse transcriptase activity under temperature and time conditions of 85℃ and 2 min;
[0026] S23, performing a first round of timed quantitative fluorescent PCR amplification reaction based on first reaction conditions to form a PCR product; wherein the first reaction conditions comprise:
[0027] The concentration of the Tag-ARMS primer pair is 0.01-0.2 μM;
[0028] The reaction conditions of the first round of timed quantitative fluorescent PCR amplification reaction are: 95℃ pre-denaturation for 3-10 min; performing the following cycles for 15-25 times: 95℃ denaturation for 10-30 s, 55-60℃ annealing for 15-45 s and 60-72℃ extension for 30-60 s.
[0029] Preferably, S3 comprises:
[0030] S31, taking 2 μL of the PCR product;
[0031] S32, adding a primer pair for detecting an internal reference gene, while using a Tag primer pair for specifically enriching and detecting a V600E mutation of the human exosome mRNA BRAF gene and a probe sequence;
[0032] S33, performing a second round of timed quantitative fluorescent PCR amplification reaction based on second reaction conditions; wherein the second reaction conditions comprise:
[0033] The concentration of the Tag primer pair is 0.1-0.4 μM; the concentration of the probe is 0.1-0.2 μM;
[0034] The reaction conditions of the second round of timed quantitative fluorescent PCR amplification reaction are: 95℃ pre-denaturation for 3-10 min; performing the following cycles for 35-45 times: 95℃ denaturation for 10-30 s, 55-60℃ annealing for 15-45 s and 60-72℃ extension for 30-60 s.
[0035] Preferably, the last base at the 3' end of the downstream primer sequence of the Tag-ARMS primer pair is modified with a locked nucleic acid; the 5' end of the probe sequence is labeled with FAM fluorescence, and the 3' end is modified with MGB.
[0036] Preferably, the exogenous reference gene is a human ACTB gene, the upstream primer sequence of the primer pair for detecting the exogenous reference gene is SEQ ID No. 6, the downstream primer sequence of the primer pair for detecting the exogenous reference gene is SEQ ID No. 7, and the probe sequence of the primer pair for detecting the exogenous reference gene is SEQ ID No. 8; the SEQ ID No. 6 is: TGACTTAGTTGCGTTACACCCTTT or TGACTTAGTTGCGTTACACCCGTT; the SEQ ID No. 7 is: CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC; and the SEQ ID No. 8 is: CAAAACCTAACTTGCGCAGA or CAAAACCTAGCTTGCGCAGA.
[0037] CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC; and the SEQ ID No. 8 is: CAAAACCTAACTTGCGCAGA or CAAAACCTAGCTTGCGCAGA.
[0038] Preferably, the 5' end of the probe sequence of the primer pair for detecting the exogenous reference gene is labeled with VIC fluorescence, and the 3' end is modified with MGB.
[0039] Preferably, the upstream primer of the Tag-ARMS primer pair has a sequence of 70% or more identical to the sequence shown in SEQ ID No. 1; the downstream primer of the Tag-ARMS primer pair has a sequence of 70% or more identical to the sequence shown in SEQ ID No. 2; the upstream primer of the Tag primer pair has a sequence of 70% or more identical to the sequence shown in SEQ ID No. 3; the downstream primer of the Tag primer pair has a sequence of 70% or more identical to the sequence shown in SEQ ID No. 4; and the probe has a sequence of 70% or more identical to the sequence shown in SEQ ID No. 5.
[0040] The second aspect of the present application provides a PCR reaction kit for detecting human exosome mRNA BRAF gene V600E mutation, characterized in that the kit comprises the primer pair and the probe of the first aspect, and the non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method of the first aspect is implemented, wherein the kit comprises any one or several of the following reagents:
[0041] The first PCR reaction solution comprises Taq DNA polymerase, Mg 2+ , PCR reaction buffer, dATP, dCTP, dTTP, dGTP, dUTP and UNG enzyme.
[0042] The second PCR reaction solution comprises Taq DNA polymerase, Mg 2+PCR reaction buffer, dATP, dCTP, dTTP and dGTP;
[0043] Positive control, comprising: a BRAF wild-type plasmid and a BRAF mutant plasmid, the ratio of the BRAF wild-type plasmid to the BRAF mutant plasmid being 320:1;
[0044] Negative control, comprising: a BRAF wild-type plasmid;
[0045] wherein, when the negative control in the kit has no "S" type amplification curve and no Ct value and the Ct value of the positive control is ≤38, the kit result is valid; when the Ct value of the exogenous reference gene of the mRNA sample is ≤38, the mRNA sample is valid, at this time, when the FAM channel Ct value is ≤38, it is judged that the BRAF gene V600E site exists mutation.
[0046] The third aspect of the present application is to provide a detection reagent or a detection kit comprising the primer sequence and / or the probe of the first aspect.
[0047] The present application has the following beneficial effects:
[0048] By non-invasive sampling, pathological tissue is not required, reducing the pain of patients in the sampling process, combined with Tag primer, locked nucleic acid technology, MGB modification and mutation amplification system (Amplification refractory mutation system, ARMS) technology, the sensitivity is improved while the specificity is guaranteed. Based on the detection results, the clinical reasonable selection of the scheme can be helped to carry out individualized treatment; in addition, the non-invasive, accurate and high-throughput detection of the exosome mRNA BRAF gene V600E mutation detection kit can realize the detection of the low mutation frequency BRAF V600E gene mutation in saliva exosomes, which cannot be achieved by other detection methods on the market. Specifically, the detection method of the present application can well meet the detection of the extremely low proportion of BRAF V600E mutant genes in saliva samples, two pairs of primers and one probe are used to detect the extremely low proportion of BRAF V600E gene fragments in saliva samples through two rounds of PCR amplification. The first round of PCR uses a pair of allele specific ARMS primers carrying Tag nucleotides to specifically amplify the extremely low copy number of BRAF V600E mutant genes in the sample, and the amplified product will carry a Tag nucleotide sequence label. The second round of PCR selectively amplifies the PCR product of the first round using Tag primers to avoid the amplification of a large number of wild-type genes (without Tag label) in the sample. The detection method, primer, probe and kit of the present application can detect as low as 0.1% of the BRAF V600E mutant gene fragments in the sample. Attached Figure Description
[0049] Figure 1 This is a schematic diagram illustrating the principle of the non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method provided by the present invention.
[0050] Figure 2 The kit provided by this invention is used for sensitivity detection, where A, B, C and D are amplification curves with gene mutation frequencies of 1%, 0.1%, 0.01% and 0.001%, respectively.
[0051] Figure 3 This is a schematic diagram of the specific detection of the kit provided by the present invention, wherein E represents amplification of the normal human genome, F represents amplification of the TERT plasmid, G represents amplification of the unmutated BRAF plasmid, and H represents amplification of a mixture of non-target genes.
[0052] Figure 4 Electron micrograph of exosomes in a saliva sample provided by the present invention. Detailed Implementation
[0053] To better understand the above technical solutions, the following will provide a detailed explanation of the technical solutions in conjunction with the accompanying drawings and specific implementation methods.
[0054] The method provided by this invention can be implemented in a terminal environment that may include one or more of the following components: a processor, a memory, and a display screen. The memory stores at least one instruction, which is loaded and executed by the processor to implement the method described in the following embodiments.
[0055] A processor may include one or more processing cores. The processor uses various interfaces and lines to connect various parts of the terminal, and performs various functions and processes data by running or executing instructions, programs, code sets or instruction sets stored in memory, and by calling data stored in memory.
[0056] Memory can include random access memory (RAM) or read-only memory (ROM). Memory can be used to store instructions, programs, code, code sets, or instructions.
[0057] The display screen is used to show the user interface of each application.
[0058] In addition, those skilled in the art can understand that the structure of the terminal described above does not constitute a limitation on the terminal, and the terminal can include more or fewer components, or combine certain components, or different component arrangements. For example, the terminal also includes radio frequency circuitry, an input unit, a sensor, audio circuitry, a power supply, and the like, which are not described here.
[0059] Embodiment one
[0060] The present embodiment provides a non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method, comprising:
[0061] S1, separating an exosome sample, comprising: treating the exosome sample with an equal volume of PEG 6000, mixing uniformly, and precipitating and separating the exosome sample at a temperature environment of 4°C overnight; centrifuging the precipitated and separated exosome sample at 12000 rpm for 30 min; extracting an mRNA sample from the supernatant sample and purifying; wherein the exosome sample is from a body fluid, and the body fluid is saliva and / or urine;
[0062] As a preferred embodiment, the concentration of the purified mRNA sample is 5-10 ng / μL.
[0063] S2, using mRNA as a template, adding an exogenous reference gene and a primer pair for detecting the exogenous reference gene, and simultaneously using a Tag-ARMS primer pair for specifically enriching an exosome mRNA BRAF gene V600E mutation to perform a first round of PCR amplification reaction to form a PCR product; the sequence of the upstream primer of the Tag-ARMS primer pair is SEQ ID No. 1, and the sequence of the downstream primer is SEQ ID No. 2; the sequence of the upstream primer of the primer pair for detecting the exogenous reference gene is SEQ ID No. 6, and the sequence of the downstream primer is SEQ ID No. 7; wherein the sequence of SEQ ID No. 1 is: ATGCGATGCGATGCGACCTCACAGTAAAAATAGGTG; the sequence of SEQ ID No. 2 is: TGACTGACTGACGGGACCCACTCCATCGAGATTTAt, wherein the lowercase letters are locked nucleic acid labeled bases; the sequence of SEQ ID No. 6 is: TGACTTAGTTGCGTTACACCCTTT or TGACTTAGTTGCGTTACACCCGTT; and the sequence of SEQ ID No. 7 is:
[0064] CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC.
[0065] As a preferred embodiment, the S2 comprises:
[0066] S21, adding the mRNA sample extracted from the exosome sample into a Tag-ARMS PCR reaction solution for detecting the V600E mutation of the mRNA BRAF gene of the human exosome;
[0067] S22, reverse transcribing the mRNA sample into cDNA using a random primer, comprising: digesting genomic DNA under the temperature and time condition of 42℃ and 2 min, then performing reverse transcription under the temperature and time condition of 25℃ and 5 min and the temperature and time condition of 42℃ and 15 min; and then inactivating reverse transcriptase activity under the temperature and time condition of 85℃ and 2 min.
[0068] S23, performing a first round of timed quantitative fluorescent PCR amplification reaction based on a first reaction condition to form a PCR product; wherein the first reaction condition comprises:
[0069] The concentration of the Tag-ARMS primer pair is 0.01-0.2 μM;
[0070] The reaction condition of the first round of timed quantitative fluorescent PCR amplification reaction is: 95℃ pre-denaturation for 3-10 min; and the following cycle is performed for 15-25 times: 95℃ denaturation for 10-30 s, 55-60℃ annealing for 15-45 s, and 60-72℃ extension for 30-60 s.
[0071] S3, using the PCR product as a template, using a system without UNG enzyme to amplify, adding a primer pair for detecting an internal reference gene, and using a Tag primer pair and a probe sequence for specifically enriching and detecting a human exosome mRNA BRAF gene V600E mutation to perform a second round of PCR amplification reaction; the upstream primer sequence of the Tag primer pair is SEQ ID No. 3 sequence, and the downstream primer sequence is SEQ ID No. 4 sequence; the probe sequence is SEQ ID No. 5 sequence; the upstream primer sequence of the primer pair for detecting the internal reference gene is SEQ ID No. 6 sequence, and the downstream primer sequence is SEQ ID No. 7 sequence, and the probe sequence is SEQ ID No. 8 sequence; the SEQ ID No. 3 sequence is: ATGCGATGCGATGCGAC or ATGCGATGCGAGGCGAC; the SEQ ID No. 4 sequence is: TGACTGACTGACGGGACCCA or TGACTGACTGACGGGAGCCA; the SEQ ID No. 5 sequence is: TGGTCTAGCTACAGATAA or TGGTCTAGCTACAGAGAA; the SEQ ID No. 6 sequence is: TGACTTAGTTGCGTTACACCCTTT or TGACTTAGTTGCGTTACACCCGTT; the SEQ ID No. 7 sequence is: CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC; and the SEQ ID No. 8 is: CAAAACCTAACTTGCGCAGA or CAAAACCTAGCTTGCGCAGA.
[0072] As a preferred embodiment, the S3 comprises:
[0073] S31, taking 2 μL of the PCR product;
[0074] S32, adding a primer pair for detecting an internal reference gene, and using a Tag primer pair and a probe sequence for specifically enriching and detecting a human exosome mRNA BRAF gene V600E mutation;
[0075] S33, performing a second round of timed quantitative fluorescent PCR amplification reaction based on second reaction conditions; wherein the second reaction conditions comprise:
[0076] The concentration of the Tag primer pair is 0.1-0.4 μM; and the concentration of the probe is 0.1-0.2 μM;
[0077] The reaction conditions of the second round of timed quantitative fluorescent PCR amplification reaction are as follows: 95℃ pre-denaturation for 3-10min; 35-45 cycles of 95℃ denaturation for 10-30s, 55-60℃ annealing for 15-45s, and 60-72℃ extension for 30-60s.
[0078] S4, judging the mutation state of the BRAF gene V600E site of the exosome sample mRNA, comprising: judging the mutation state of the BRAF gene V600E site of the mRNA sample of the exosome according to the CT value.
[0079] As a preferred embodiment, the last base at the 3' end of the sequence of the downstream primer of the Tag-ARMS primer pair is modified by a locked nucleic acid.
[0080] As a preferred embodiment, the 5' end of the probe sequence is labeled with FAM fluorescence, and the 3' end is modified with MGB.
[0081] As a preferred embodiment, the exogenous reference gene is a human ACTB gene, the sequence of the upstream primer of the primer pair for detecting the exogenous reference gene is SEQ ID No. 6, the sequence of the downstream primer of the primer pair for detecting the exogenous reference gene is SEQ ID No. 7, and the sequence of the probe of the primer pair for detecting the exogenous reference gene is SEQ ID No. 8; the sequence of SEQ ID No. 6 is: TGACTTAGTTGCGTTACACCCTTT or TGACTTAGTTGCGTTACACCCGTT; the sequence of SEQ ID No. 7 is: CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC; and the sequence of SEQ ID No. 8 is: CAAAACCTAACTTGCGCAGA or CAAAACCTAGCTTGCGCAGA.
[0082] As a preferred embodiment, the 5' end of the probe sequence of the primer pair for detecting the exogenous reference gene is labeled with VIC fluorescence, and the 3' end is modified with MGB.
[0083] As a preferred embodiment, the upstream primer of the Tag-ARMS primer pair has a sequence that is 70% or more identical to the sequence shown in SEQ ID No. 1; the downstream primer of the Tag-ARMS primer pair has a sequence that is 70% or more identical to the sequence shown in SEQ ID No. 2; the upstream primer of the Tag primer pair has a sequence that is 70% or more identical to the sequence shown in SEQ ID No. 3; and the downstream primer of the Tag primer pair has a sequence that is 70% or more identical to the sequence shown in SEQ ID No. 4.
[0084] As a preferred embodiment, the probe has a sequence of 70% or more identical to the sequence shown in SEQ ID No. 5.
[0085] Embodiment two
[0086] The embodiment provides a PCR reagent kit for detecting a human exosome mRNA BRAF gene V600E mutation, characterized in that the PCR reagent kit comprises the primer pair and the probe described in embodiment one and implements the non-invasive exosome mRNA BRAF V600E mutation Tag-PCR detection method described in embodiment one, wherein the reagent kit comprises any one or several of the following reagents:
[0087] The first PCR reaction solution comprises Taq DNA polymerase, Mg 2+ , a PCR reaction buffer, dATP, dCTP, dTTP, dGTP, dUTP and UNG enzyme;
[0088] The second PCR reaction solution comprises Taq DNA polymerase, Mg 2+ , a PCR reaction buffer, dATP, dCTP, dTTP and dGTP;
[0089] The positive control comprises: a BRAF wild-type plasmid and a BRAF mutant plasmid, wherein the ratio of the BRAF wild-type plasmid to the BRAF mutant plasmid is 320:1.
[0090] The negative control comprises: a BRAF wild-type plasmid.
[0091] When the negative control in the reagent kit has no "S" type amplification curve and no Ct value and the Ct value of the positive control is less than or equal to 38, the result of the reagent kit is valid; when the Ct value of the exogenous reference gene of the mRNA sample is less than or equal to 38, the mRNA sample is valid, and when the FAM channel Ct value is less than or equal to 38, it is judged that the BRAF gene V600E site has a mutation.
[0092] Embodiment three
[0093] The embodiment provides a detection reagent or a detection kit comprising the primer sequence and / or the probe of embodiment one.
[0094] Application embodiment 1: design and synthesis of specific primers and probes.
[0095] According to the nucleic acid sequences of human BRAF genes and ACTB genes published in the NCBI database, specific primers and probes for detecting corresponding sites are designed.
[0096] The primers and probes for detecting BRAF genes and reference genes are synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd., and the sequences are as follows.
[0097] BRAF-T-F1 (SEQ ID No. 1):ATGCGATGCGATGCGACCTCACAGTAAAAATAGGTG;
[0098] BRAF-T-R1 (SEQ ID No. 2): TGACTGACTGACGGGACCCACTCCATCGAGATTTAt (lowercase letters are locked nucleic acid marker bases);
[0099] BRAF-T2-F1 (SEQ ID No. 3):ATGCGATGCGATGCGAC;
[0100] BRAF-T2-R1(SEQ ID No.4):TGACTGACTGACGGGACCCA;
[0101] BRAF-ARMS-P1(SEQ ID No.5):TGGTCTAGCTACAGATAA;
[0102] ACTB-F1 (SEQ ID No. 6): TGACTTAGTTGCGTTACACCCTTT;
[0103] ACTB-R1(SEQ ID No.7):CTGCTGTCACCTTCACCGTTC;
[0104] ACTB-P1(SEQ ID No.8):CAAAACCTAACTTGCGCAGA;
[0105] The last base at the 3' end of BRAF-T-R1 (SEQ ID No. 2) is labeled with locked nucleic acid.
[0106] The 5' end of BRAF-ARMS-P1 (SEQ ID No. 5) is labeled with FAM fluorescence. The 3' end is modified with MGB.
[0107] ACTB-P1 has a VIC fluorescence label at its 5' end and an MGB modification at its 3' end.
[0108] Application Example 2:
[0109] Sensitivity and specificity experiments of primers and probes (based on a real-time PCR platform)
[0110] like Figure 2 As shown, the sensitivity testing samples were four saliva samples: A, B, C, and D. The gene mutation frequencies were 10%, 1%, 0.1%, and 0.01%, respectively.
[0111] As shown in Figure 3 E, F, G, and H samples (mixed with internal reference plasmid) were used for specific detection, where E was normal human genomic mRNA, F was TERT plasmid, G was unmutated BRAF plasmid, and H was mixed mRNA of non-target genes.
[0112] The saliva sample was pretreated with PEG 6000. After mixing PEG 6000 with the sample at a ratio of 1:1, it was placed at 4°C overnight to precipitate the exosome DNA in the saliva sample. After centrifugation at 12000 rpm for 30 min, the supernatant was taken and treated with the nucleic acid extraction or purification kit (Shanghai Lisheng Biological Technology Co., Ltd. Shanghai Biological Equipment 20230114) for the sample that needed to extract exosome RNA.
[0113] After RNA extraction, the RNA sample was reverse transcribed into cDNA using random primers with the MCE reverse transcription kit RT Master Mix for qPCR II (gDNAdigester plus).
[0114] The detection system of ordinary Tag-ARMS PCR was configured according to the following Table 1:
[0115] Table 1
[0116]
[0117]
[0118] The number of samples configured was 8+2 (negative control and positive control). After configuration, the samples were added to the ice box at 4°C, and PCR reaction was immediately performed according to the conditions shown in the following Table 2.
[0119] Table 2
[0120]
[0121] After the PCR reaction was completed, 5 μL of the product was taken for standby, and the remaining product could be stored at 4°C for standby.
[0122] The detection system of Tag-qPCR was configured according to the following Table 3. Note that the PCR premix in this round does not contain UNG enzyme and dUTP.
[0123] Table 3
[0124]
[0125]
[0126] The number of samples was configured as 8+2 (negative control and positive control), and after the configuration was completed, the samples were added on the ice box at 4℃, and immediately PCR reaction was carried out according to the conditions shown in Table 4 below.
[0127] Table 4
[0128]
[0129] The detection results are shown in Table 5 below, and the detection sensitivity of the kit can reach 0.01%.
[0130] Table 5
[0131] Sample Name FAM Channel Ct Value VIC Channel Ct Value Result A 19.7 17.2 Mutant Positive B 24.1 17.4 Mutant Positive C 25.0 17.0 Mutant Positive D 27.7 17.6 Mutant Positive E / 16.7 Mutant Negative F / 17.2 Mutant Negative G / 16.7 Mutant Negative H / 17.8 Mutant Negative Positive Control 22.0 17.4 Mutant Positive Negative Control / / Mutant Negative
[0132] While the preferred embodiments of the application have been described, modifications and alterations may occur to others upon reading the preceding description and accompanying drawings. It is intended that the application be construed as including all such modifications and alterations. Accordingly, it is intended that the application be construed as including all such modifications and alterations.
Claims
1. A non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method, characterized in that, Comprising: S1, separating an exosome sample, comprising: treating the exosome sample with an equal volume of PEG 6000, mixing uniformly, precipitating and separating the exosome sample overnight at a temperature environment of 4 DEG C; centrifuging the precipitated and separated exosome sample at 12000 rpm for 30 min; extracting and purifying an mRNA sample in a supernatant sample; wherein the exosome sample is from a body fluid, the body fluid being saliva and / or urine; S2, using an exogenous internal reference gene and a primer pair for detecting the exogenous internal reference gene as templates, adding a specific Tag-ARMS primer pair for enriching an exosome mRNA BRAF gene V600E mutation, and performing a first round of PCR amplification reaction to form a PCR product; an upstream primer sequence of the Tag-ARMS primer pair is SEQ ID No. 1 sequence, a downstream primer sequence is SEQ ID No. 2 sequence, an upstream primer sequence of the primer pair for detecting the exogenous internal reference gene is SEQ ID No. 6 sequence, and a downstream primer sequence is SEQ ID No. 7 sequence; wherein the SEQ ID No. 1 sequence is: ATGCGATGCGATGCGACCTCACAGTAAAAATAGGTG; the SEQ ID No. 2 sequence is: TGACTGACTGACGGGACCCACTCCATCGAGATTTAt, wherein the lowercase letter is a locked nucleic acid labeled base; the SEQ ID No. 6 sequence is: TGACTTAGTTGCGTTACACCCTTT or TGACTTAGTTGCGTTACACCCGTT; and the SEQ ID No. 7 sequence is: CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC; S3, using PCR product as template, using primer pair for detecting internal reference gene, and using Tag primer pair and probe sequence for specifically enriching and detecting mRNA BRAF gene V600E mutation of human exosome to perform second round of PCR amplification reaction; the sequence of the upstream primer of the Tag primer pair is SEQ ID No. 3, and the sequence of the downstream primer is SEQ ID No. 4; the sequence of the probe is SEQ ID No. 5; the sequence of the upstream primer of the primer pair for detecting internal reference gene is SEQ ID No. 6, and the sequence of the downstream primer is SEQ ID No. 7, and the sequence of the probe is SEQ ID No. 8; the sequence of SEQ ID No. 3 is: ATGCGATGCGATGCGAC or ATGCGATGCGAGGCGAC; the sequence of SEQ ID No. 4 is: TGACTGACTGACGGGACCCA or TGACTGACTGACGGGAGCCA; the sequence of SEQ ID No. 5 is: TGGTCTAGCTACAGATAA or TGGTCTAGCTACAGAGAA; the sequence of SEQ ID No. 6 is: TGACTTAGTTGCGTTACACCCTTT or TGACTTAGTTGCGTTACACCCGTT; the sequence of SEQ ID No. 7 is: CTGCTGTCACCTTCACCGTTC or CTGCTGTCACCTTCACGGTTC; and the sequence of SEQ ID No. 8 is: CAAAACCTAACTTGCGCAGA or CAAAACCTAGCTTGCGCAGA; S4, judging the mutation state of the mRNA of the exosome sample at the BRAF gene V600E site, comprising: judging the mutation state of the mRNA of the exosome at the BRAF gene V600E site according to the CT value.
2. The non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method according to claim 1, characterized in that, The concentration of the purified mRNA sample is 5-10 ng / μL.
3. The non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method according to claim 2, characterized in that, The S2 comprises: S21, adding the mRNA sample extracted from the exosome sample into the Tag-ARMS PCR reaction solution for specifically enriching and detecting mRNA BRAF gene V600E mutation of human exosome; S22, using random primer to reversely transcribe the mRNA sample into cDNA, comprising: digesting genomic DNA under the temperature and time condition of 42℃ and 2 min, and then performing reverse transcription under the temperature and time condition of 25℃ and 5 min and the temperature and time condition of 42℃ and 15 min; and then inactivating reverse transcriptase activity under the temperature and time condition of 85℃ and 2 min; S23, performing first round of timed quantitative fluorescent PCR amplification reaction based on first reaction condition to form PCR product; wherein the first reaction condition comprises: The concentration of the Tag-ARMS primer pair is 0.01-0.2 μM; The reaction condition of the first round of timed quantitative fluorescent PCR amplification reaction is: 95℃ pre-denaturation for 3-10 min; and the following cycles are performed for 15-25 times: 95℃ denaturation for 10-30 s, 55-60℃ annealing for 15-45 s, and 60-72℃ extension for 30-60 s.
4. The non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method according to claim 3, characterized in that, The S3 comprises: S31, taking the PCR product 2 μL; S32, adding the primer pair for detecting the internal reference gene, and simultaneously using the Tag primer pair and the probe sequence for specifically enriching and detecting the mRNA BRAF gene V600E mutation of human exosome; S33, performing a second round of timed quantitative fluorescent PCR amplification reaction based on the second reaction condition; wherein the second reaction condition comprises: The concentration of the Tag primer pair is 0.1-0.4 μM; and the concentration of the probe is 0.1-0.2 μM; The reaction condition of the second round of timed quantitative fluorescent PCR amplification reaction is: 95℃ pre-denaturation for 3-10 min; and the following cycles are performed for 35-45 times: 95℃ denaturation for 10-30 s, 55-60℃ annealing for 15-45 s, and 60-72℃ extension for 30-60 s.
5. The non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method according to claim 4, characterized in that, The last base at the 3' end of the sequence of the downstream primer of the Tag-ARMS primer pair is modified by locked nucleic acid; and the 5' end of the sequence of the probe is labeled with FAM fluorescence, and the 3' end is modified by MGB.
6. The non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method according to claim 5, characterized in that, The exogenous internal reference gene is the human ACTB gene.
7. The non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method according to claim 6, characterized in that, The 5' end of the sequence of the probe of the primer pair for detecting the exogenous internal reference gene is labeled with VIC fluorescence, and the 3' end is modified by MGB.
8. The non-invasive exosomal mRNA BRAF V600E mutation Tag-PCR detection method according to claim 7, characterized in that, The upstream primer of the Tag-ARMS primer pair has a sequence that is more than 70% identical to the sequence shown in SEQ ID No. 1; the downstream primer of the Tag-ARMS primer pair has a sequence that is more than 70% identical to the sequence shown in SEQ ID No. 2; the upstream primer of the Tag primer pair has a sequence that is more than 70% identical to the sequence shown in SEQ ID No. 3; the downstream primer of the Tag primer pair has a sequence that is more than 70% identical to the sequence shown in SEQ ID No. 4; and the probe has a sequence that is more than 70% identical to the sequence shown in SEQ ID No.
5.
9. A PCR reaction kit for detecting a V600E mutation of a human exosome mRNA BRAF gene, characterized by, The kit comprises any one or several of the following reagents: The first PCR reaction solution includes Taq DNA polymerase, Mg 2+ , PCR reaction buffer, dATP, dCTP, dTTP, dGTP, dUTP, and UNG enzyme. The second PCR reaction solution includes Taq DNA polymerase, Mg 2+ , PCR reaction buffer, dATP, dCTP, dTTP and dGTP. The positive control comprises: a BRAF wild-type plasmid and a BRAF mutant plasmid, wherein the ratio of the BRAF wild-type plasmid to the BRAF mutant plasmid is 320:1; The negative control comprises: a BRAF wild-type plasmid; When the negative control in the kit has no "S" type amplification curve and no Ct value, and the Ct value of the positive control is ≤38, the result of the kit is valid; when the Ct value of the exogenous internal reference gene of the mRNA sample is ≤38, the mRNA sample is valid, at this time, the Ct value of the FAM channel is ≤38, and it is judged that the BRAF gene V600E site has a mutation.
10. A test reagent or test kit comprising the primer sequence of any one of claims 1-8 and / or the probe.
Citation Information
Patent Citations
Kit for detecting B-raf gene V600E mutation, and detection method thereof
CN108277281A
Nucleotide sequence for detecting BRAF gene V600E mutation and application thereof
CN109576372A
Kit for detecting mutation of V600E locus of BRAF (v-taf mourine sarcoma viral oncogene homolog B1) gene
CN111304329A
PCR (Polymerase Chain Reaction) detection method for mutation of human BRAF (v-raf Murine Sacoma Viral Oncogene Homolog) gene V600E, primer, probe and kit
CN107400716A
Kit for detecting human BRAF gene V600E and TERT gene promoter mutation
CN120210372A