Individualized mRNA composition, vector, mRNA vaccine and application thereof

By combining mRNA vaccines encoding tumor neoantigens and related antigens, the limited tumor-killing effect of existing personalized RNA vaccines has been addressed, achieving highly precise tumor killing and immune system activation, thus improving treatment efficacy and preventing recurrence.

CN120919293APending Publication Date: 2025-11-11SICHUAN CUNDE THERAPEUTICS CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511092211.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-12-28
Filing Date
2023-12-28
Publication Date
2025-11-11

AI Technical Summary

Technical Problem

Existing personalized RNA vaccines have limited efficacy in killing tumors, and traditional immunotherapy suffers from problems such as non-responsiveness in some patients and high adverse reactions.

Method used

By combining mRNAs encoding tumor neoantigens and related antigens, the targeted killing ability of tumor-specific T cells is enhanced, and co-stimulatory factor mRNAs are added to activate the immune system, thus forming a personalized mRNA vaccine.

Benefits of technology

It achieves highly precise tumor killing, enhances the activation and response of the immune system, improves treatment efficacy, and prevents recurrence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120919293A_ABST
    Figure CN120919293A_ABST
Patent Text Reader

Abstract

The invention provides an individualized mRNA composition, a carrier, an mRNA vaccine and application thereof, and belongs to the technical field of biological vaccines. Wherein the individualized mRNA composition comprises at least one neoantigen mRNA encoding a tumor neoantigen and at least one associated antigen mRNA encoding a tumor associated antigen. According to the present invention, the new antigen mRNA and the related antigen mRNA are combined to obtain the individualized vaccine material having the high tumor killing biological activity characteristic, such that the targeting killing ability of the tumor specific T cell is increased while the immune system activation progress is accelerated, the human body immune response can be improved, and the possible recurrence in the subsequent process can be prevented.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of the invention application filed on December 28, 2023, with Chinese application number 202311838393.9 and entitled "Personalized mRNA Composition, Vector, mRNA Vaccine and Its Application".

[0002] Cross-reference declaration

[0003] This invention claims priority to the Chinese application with application number "2022116972578", application date December 28, 2022, entitled "A Personalized mRNA Composition, Vector, mRNA Vaccine and Its Application", which is incorporated herein by reference in its entirety as a part of this invention. Technical Field

[0004] This invention belongs to the field of biological vaccine technology, and in particular relates to a personalized mRNA composition, vector, mRNA vaccine and its application. Background Technology

[0005] Immunotherapy, as the third revolution in cancer treatment, primarily aims to achieve "living with cancer" by strengthening and restoring the patient's own immune system's ability to recognize and kill cancer cells, or by providing the patient with external immune support to help kill cancer cells. Compared to radiotherapy, chemotherapy, and targeted therapy, immunotherapy has advantages such as simple treatment methods, targeting only cancer cells, and not damaging normal cells. Among immunotherapies, those based on immune checkpoint inhibitors and cytotoxic T-lymphocyte-associated protein 4 (ICI) antibodies have developed rapidly and achieved some success in the immunotherapy of advanced solid tumors. However, more than 50% of patients do not respond to ICIs due to a lack of tumor-specific lymphocyte infiltration, and more than 20% of patients experience grade ≥3 immunotherapy-related adverse reactions. Therefore, exploring novel immune strategies to enhance tumor-specific lymphocyte infiltration and further improve the objective response rate (ORR) of immunotherapy for solid tumor patients may be the future direction of precision immunotherapy for solid tumors.

[0006] Over 95% of mutations in tumors are unique and patient-specific (Weide et al. 2008: J. Immunother. 31, 180-188). Based on these mutations, they can be transcribed into mRNA, translated into mutant peptides, and the resulting MHC-peptide complex with the major histocompatibility complex (MHC) is presented to the surface of tumor cells via the Golgi apparatus. This complex can be specifically recognized by the tumor cell receptor (TCR), thereby inducing specific killing of tumor cells. Compared to traditional tumor-associated antigens (TAAs), immunotherapy targeting neoantigens corresponding to mutations has advantages such as high specificity, no central tolerance or autoimmune problems, fewer side effects, and the ability to achieve personalized precision immunotherapy. For example, the personalized RNA vaccine for cancer disclosed in patent EP2012000006W utilizes neoantigens to provide targeted, personalized cancer immunization to patients. However, the actual tumor-killing effect of such personalized RNA vaccines targeting only neoantigens is limited. Therefore, more vaccines with good tumor-killing effects need to be developed in this field. Summary of the Invention

[0007] To address the problems existing in the prior art, this invention provides a personalized mRNA composition, vector, mRNA vaccine, and their applications. This invention, on the one hand, targets neoantigen mRNA to achieve highly precise tumor killing and enhance the tumor-specific T-cell targeting and killing ability; on the other hand, it increases related antigen mRNA, allowing it to enter the immune system synchronously with the neoantigen mRNA. This further enhances the tumor-specific T-cell targeting and killing ability while rapidly activating the immune system, thereby comprehensively improving treatment progress and efficacy. Details are as follows:

[0008] In a first aspect, the present invention provides a personalized mRNA composition. The mRNA composition comprises: at least one neoantigen mRNA encoding a tumor neoantigen and at least one related antigen mRNA encoding a tumor-associated antigen.

[0009] In some embodiments, the neoantigen transcription template corresponding to the neoantigen mRNA is a highly immunogenic mutant sequence selected by sequential peptide screening and mutation site screening.

[0010] In some embodiments, the mRNA composition further includes at least one co-stimulatory factor mRNA encoding a co-stimulatory factor for promoting an immune response induced by the tumor neoantigen and the tumor-associated antigen.

[0011] In some embodiments, the carrier of the mRNA composition is an antigen-presenting cell.

[0012] In some embodiments, the co-stimulatory factor is any one of IL-2, IL-7, IL-12, IL-15, CD40L, CD40, CD27L, CD27, CD28, CD275, CD278, CD134, CD137, CD154, GITR, HVEM, LFA-1, CD2, CD58, ICAM-1, TNFSF4, TNFSF5, TNFSF7, TNFSF9, TNFSF14, and TNFSF18.

[0013] In some embodiments, the tumor neoantigen and the tumor-associated antigen may or may not originate from the same individual.

[0014] In some embodiments, the tumor-associated antigen is a highly expressed tumor-associated antigen.

[0015] In some embodiments, the tumor-associated antigen is any one of WT1, MSLN, and FSHR.

[0016] In some embodiments, the RNA length of neoantigen mRNA is 600–800 nt; and / or the RNA length of associated antigen mRNA is 1500–2000 nt; and / or the RNA length of co-stimulatory factor mRNA is 1100–3000 nt.

[0017] For example, the RNA length of neoantigen mRNA can be any value or combination of 600nt, 650nt, 700nt, 750nt, and 800nt.

[0018] For example, the RNA length of the relevant antigen mRNA can be any value or combination of 1500nt, 1600nt, 1700nt, 1750nt, 1800nt, 1850nt, 1900nt, and 2000nt.

[0019] For example, the RNA length of the co-stimulatory factor mRNA can be any value or combination of 1100nt, 1300nt, 1500nt, 1650nt, 1800nt, and 1900nt.

[0020] In a second aspect, the present invention provides a vector comprising the mRNA composition described in the first aspect above.

[0021] In some embodiments, the carrier is one or more of the following: lipids, liposomes, lipid complexes, lipid nanoparticles, polymeric nanoparticles, cells, simulated nanoparticles, nanotubes, or conjugates containing the mRNA composition.

[0022] Thirdly, the present invention provides an mRNA vaccine. The mRNA vaccine comprises the mRNA composition described in the first aspect, or comprises the vector described in the second aspect.

[0023] Fourthly, the present invention provides an application of the mRNA composition described in the first aspect, the vector described in the second aspect, or the mRNA vaccine described in the third aspect.

[0024] In some embodiments, the application includes: application in the preparation of cancer-specific T cells; or application in the preparation of cancer-specific TCR-T cells; or application in the preparation of cancer-specific diagnostic reagents; or application in cancer treatment and / or prevention.

[0025] In some embodiments, the cancer is any one of breast cancer, ovarian cancer, stomach cancer, liver cancer, prostate cancer, lung cancer, and colon cancer.

[0026] The beneficial effects of this invention are as follows: by combining neoantigen mRNA and related antigen mRNA, personalized vaccine materials with high tumor-killing biological activity are obtained. When applied to corresponding tumor treatments, these materials can not only increase the tumor-specific T-cell targeted killing ability and accelerate the activation of the immune system, but also improve the body's immune response and prevent possible recurrence. Attached Figure Description

[0027] Figure 1 The results of protein detection for CD40L mRNA expression in the DC tumor vaccine-1 prepared in Example 4 of this invention are shown.

[0028] Figure 2 The results of protein detection for WT1 mRNA expression in the DC tumor vaccine-1 prepared in Example 4 of this invention are shown.

[0029] Figure 3 Western blot analysis of tumor neoantigen mRNA-1 and tumor neoantigen mRNA-2 expressed proteins in the DC tumor vaccines prepared in Examples 4 and 6 of the present invention is shown.

[0030] Figure 4 The relevant detection data of tumor-specific CD8+ T cells in Example 8 of the present invention are shown; wherein, Figure A shows the number of IFN-γ expressed by tumor-specific CD8+ T cells, and Figure B shows the number of TNFα expressed by tumor-specific CD8+ T cells;

[0031] Figure 5 The experimental results of tumor weight in each group in Example 9 of the present invention are shown;

[0032] Figure 6The experimental results of tumor inhibition rates in each group in Example 9 of the present invention are shown;

[0033] Figure 7 The experimental results of tumor inhibition rate in each group in Example 10 of the present invention are shown;

[0034] Figure 8 The experimental results of tumor inhibition rates in each group in Example 11 of the present invention are shown;

[0035] Figure 9 The experimental results of tumor inhibition rate in each group in Example 12 of the present invention are shown;

[0036] Figure 10 The experimental results of tumor inhibition rate in each group in Example 13 of the present invention are shown;

[0037] Figure 11 The experimental results of tumor inhibition rate in each group in Example 14 of the present invention are shown;

[0038] Figure 12 The experimental results of tumor inhibition rate in each group in Example 15 of the present invention are shown;

[0039] Figure 13 The experimental results of tumor inhibition rates in each group in Example 16 of the present invention are shown;

[0040] Figure 14 The experimental results of tumor inhibition rate in each group in Example 17 of the present invention are shown;

[0041] Figure 15 The experimental results of tumor inhibition rates in each group in Example 18 of the present invention are shown;

[0042] Figure 16 The experimental results of tumor inhibition rate in each group in Example 19 of the present invention are shown;

[0043] Figure 17 The experimental results of tumor inhibition rate in each group in Example 20 of the present invention are shown;

[0044] Figure 18 The experimental results of tumor inhibition rate in each group in Example 21 of the present invention are shown;

[0045] Figure 19 The experimental results of tumor inhibition rate in each group in Example 22 of the present invention are shown;

[0046] Figure 20 The experimental results of tumor inhibition rate in each group in Example 23 of the present invention are shown;

[0047] Figure 21 The experimental results of tumor inhibition rate in each group in Example 24 of the present invention are shown. Detailed Implementation

[0048] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.

[0049] Various aspects of the present invention are described in detail in the following embodiments. The embodiments are not intended to limit the invention. Each embodiment can be applied to any aspect of the invention. In this application, unless otherwise stated, the use of "or" means "and / or".

[0050] To facilitate understanding of the inventive concept by those skilled in the art and for the convenience of the applicant, the tumors in the following specific embodiments are all described using ovarian cancer as an example; however, the present invention is not limited to the field of ovarian cancer. The specific details are as follows:

[0051] In a first aspect, embodiments of the present invention provide a personalized mRNA composition. The mRNA composition comprises: at least one neoantigen mRNA encoding a tumor neoantigen and at least one related antigen mRNA encoding a tumor-associated antigen.

[0052] In practice, the neoantigen mRNAs selected are those with high immunogenicity among all neoantigens. Furthermore, the mutation sites of the selected neoantigens are chosen by summing the scores of all peptides at the same mutation site, selecting the mutation site with the highest score. In actual implementation, multiple neoantigen mRNAs can also be selected according to this standard; for example, the top 5 neoantigens can be selected based on the mutation sites corresponding to the top 5 mutations.

[0053] Tumor-associated antigen (TA) mRNA is a highly immunogenic tumor-associated antigen that can be used for immunotherapy of tumors with high TA expression. Furthermore, vaccines based on TA mRNA have demonstrated safety and efficacy in the clinical immunotherapy of diseases such as ovarian cancer and acute myeloid leukemia. As TA is highly expressed in over 70% of ovarian cancer patients, adding this antigen can enhance the targeting of stimulated tumor-specific T cells to ovarian cancer cells.

[0054] This embodiment combines neoantigen mRNA and related antigen mRNA to obtain personalized vaccine materials with high tumor-killing biological activity. On the one hand, the neoantigen mRNA is the main component, which can achieve highly precise killing of tumors and enhance the tumor-specific T cell targeted killing ability. On the other hand, the addition of related antigen mRNA allows it to enter the immune system synchronously with the neoantigen mRNA. This can further increase the tumor-specific T cell targeted killing ability while rapidly activating the immune system, thereby achieving the goal of comprehensively improving the treatment progress and effect.

[0055] Furthermore, since this embodiment uses mRNA as the vaccine raw material, after it enters the human body, it needs to be translated into polypeptides in a vector first, and then the presentation function of the vector is combined to activate the immune system. The immune system formed in this way has memory and can improve the human body's immune response to the corresponding tumor, thereby preventing the possibility of subsequent recurrence.

[0056] In some embodiments, the neoantigen transcription template corresponding to the neoantigen mRNA is a highly immunogenic mutant sequence that has undergone peptide screening and mutation site screening in sequence.

[0057] In practice, the patient's normal tissue sequence was used as a control sample, and sequence alignment was performed with the patient's tumor sample to screen for all tumor neoantigens. Then, the tumor neoantigens were scored according to the following sorting criteria, ranked from highest to lowest peptide score, and the top 10 neoantigens with high immunogenicity were selected. Next, the scores of all peptides at the same mutation site were summed, and the mutation sites were ranked (i.e., further screening for mutation sequences with even higher immunogenicity), selecting the top 5 mutation points (the mutation sequences corresponding to these 5 mutation points are the 5 selected high immunogenic mutation sequences). Finally, the mutation sequences corresponding to these 5 mutation points were used to synthesize a neoantigen transcription template for subsequent preparation of neoantigen mRNA encoding the tumor neoantigen.

[0058] The sorting criteria included: transcriptome sequencing data supported by mutant sequences, TPM expression level >3, affinity <300nM, mutation frequency >0.1, and non-homologous peptides.

[0059] The mRNA composition provided in this embodiment can also be composed of multiple highly immunogenic mutant sequences, which makes the transcribed neoantigen mRNA have higher immunogenicity, thereby further enhancing the tumor-specific T cell targeted killing ability and improving the precision killing of tumors.

[0060] In addition, to ensure that the screened tumor neoantigen mutations do not exist in normal tissues, the authenticity of the mutation sites in the tumor samples can be verified again. The specific verification procedure can be as follows: after determining the selected neoantigen sequences, use PCR and Sanger sequencing methods to verify the accuracy of the neoantigen mutation sites in tumor tissue genomic DNA and blood genomic DNA, to ensure that the screened neoantigen mutations do not exist in normal tissues.

[0061] In some embodiments, the mRNA composition further includes at least one costimulatory factor mRNA encoding a costimulatory factor for promoting an immune response induced by tumor neoantigens and tumor-associated antigens.

[0062] Co-stimulatory factor mRNAs bind to corresponding proteins produced by mature carrier cells, increasing the secretion of interleukins by these cells, which promote the production of cytotoxic T lymphocytes (CTLs). These interleukins (such as IL-12) play a role in inducing multifunctional effector / memory cytotoxic T lymphocytes and can serve as a marker of immune cell differentiation.

[0063] In some embodiments, the carrier of the mRNA composition is an antigen-presenting cell. Specifically, the antigen-presenting cell may be a dendritic cell.

[0064] Dendritic cells (DCs) are antigen-presenting cells (APCs), and their anti-tumor mechanism is as follows: ① DCs can highly express MHC class I and MHC class II molecules. MHC molecules bind to the tumor antigens they capture and process, forming peptide-MHC molecule complexes, which are then presented to T cells, thereby initiating MHC class I restricted cytotoxic T lymphocyte (CTL) responses and MHC class II restricted CD4+Th1 responses. Simultaneously, DCs also provide the second signal necessary for T cell activation through their highly expressed co-stimulatory molecules (CD80 / B7-1, CD86 / B7-2, CD40, etc.), thus initiating the immune response. ② DCs bind to T cells and secrete large amounts of IL-12 and IL-18, activating T cell proliferation, inducing CTL generation, and dominating the Th1 immune response, which is beneficial for tumor clearance; they also activate perforin granzyme B and the FasL / Fas-mediated pathway to enhance NK cell cytotoxicity; ③ DCs secrete chemokines (CCKs) that specifically chemotactically attract naïve T cells, promoting T cell aggregation and enhancing T cell activation. Maintaining effector T cells in the tumor site for a long time may affect tumor angiogenesis by releasing certain anti-angiogenic substances (such as IL-12 and IFN-γ) and pro-angiogenic factors. The aforementioned CCKs further activate DCs through positive feedback paracrine signaling, upregulating the expression of IL-12 and CD80 and CD86; at the same time, DCs also directly present antigen peptides to CD8+ T cells, activating CD8+ T cells with the help of activated CD4+ T cells. CD4+ and CD8+ T cells can further enhance the body's anti-tumor immune response by secreting cytokines or directly killing cells.

[0065] In some embodiments, the co-stimulatory factor is any one of CD40L, CD40, CD27L, CD27, CD28, CD275, CD278, CD134, CD137, CD154, GITR, HVEM, LFA-1, CD2, CD58, ICAM-1, TNFSF4, TNFSF5, TNFSF7, TNFSF9, TNFSF14, and TNFSF18.

[0066] In this embodiment, CD40L is used as an example to illustrate the role of co-stimulatory factors. Specifically, CD40L mRNA increases the secretion of IL-12 by binding to CD40 produced by mature DCs. IL-12 is a key signal that promotes the production of cytotoxic T lymphocytes (hereinafter referred to as CTLs).

[0067] In some embodiments, tumor neoantigens and tumor-associated antigens may or may not originate from the same individual. Specifically, tumor neoantigens are individualized tumor neoantigens derived from the patient, exhibiting extremely high specificity for that patient. Tumor-associated antigens, due to their high expression in ovarian cancer and not being limited to a single patient, can originate from the patient's body or be known tumor-associated antigens pre-stored in an antigen library.

[0068] In some embodiments, the tumor-associated antigen is a highly expressed tumor-associated antigen.

[0069] In some embodiments, the tumor-associated antigen is any one of WT1, MSLN, and FSHR.

[0070] In some embodiments, neoantigen mRNA is prepared from a corresponding plasmid template, and the release criteria for the prepared material as an immunoassay include: a content of 1-4 μg / μL, an A260 / A280 ratio of 1.50-4.00, an RNA length of 600-800 nt, integrity ≥80%, truncation <20%, capping efficiency ≥70%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μL.

[0071] In specific implementation, the content can be any value or combination of 1 μg / μL, 1.5 μg / μL, 2 μg / μL, 3 μg / μL, and 4 μg / μL; the A260 / A280 ratio can be any value or combination of 1.50, 2.00, 2.50, 3.00, 3.50, and 4.00; the RNA length can be any value or combination of 600 nt, 650 nt, 700 nt, 750 nt, and 800 nt; the integrity can be any value or combination of 80%, 83%, 86%, 89%, 93%, 95%, and 98%; and the truncation can be 5%, 8%, 10%, 11%, or 14%. The capping efficiency can be any value or combination of 17% and 19%; the DNA residue can be any value or combination of 70%, 73%, 77%, 80%, 85%, 89%, 93%, 95%, and 99%; the DNA residue can be any value or combination of 1μg / μg, 1.5μg / μg, 2μg / μg, 2.5μg / μg, 3ng / μg, 3.5ng / μg, and 3.9ng / μg; the protein (enzyme) residue can be any value or combination of 5ng / μl, 5.7ng / μl, 6.5ng / μl, 7ng / μl, 7.5ng / μl, 8ng / μl, 9ng / μl, and 9.8ng / μl.

[0072] In some embodiments, the relevant antigen mRNA is prepared from the corresponding plasmid template, and the release criteria for the prepared material include: a content of 1-4 μg / μL, an A260 / A280 ratio of 1.50-4.00, an RNA length of 1500-2000 nt, integrity ≥80%, truncation <20%, capping efficiency ≥70%, DNA residue <4 ng / μg, and protein residue <10 ng / μL.

[0073] In specific implementation, the concentration can be any value or combination of 1 μg / μL, 1.5 μg / μL, 2 μg / μL, 3 μg / μL, and 4 μg / μL; the A260 / A280 ratio can be any value or combination of 1.50, 2.00, 2.50, 3.00, 3.50, and 4.00; the RNA length can be any value or combination of 1500 nt, 1600 nt, 1700 nt, 1750 nt, 1800 nt, 1850 nt, 1900 nt, and 2000 nt; the integrity can be any value or combination of 80%, 83%, 86%, 89%, 93%, 95%, and 98%; and the truncation rate can be 5% or 8%. The capping efficiency can be any value or combination of 10%, 11%, 14%, 17%, and 19%; the DNA residue can be any value or combination of 1μg / μg, 1.5μg / μg, 2μg / μg, 2.5μg / μg, 3ng / μg, 3.5ng / μg, and 3.9ng / μg; the protein (enzyme) residue can be any value or combination of 5ng / μl, 5.7ng / μl, 6.5ng / μl, 7ng / μl, 7.5ng / μl, 8ng / μl, 9ng / μl, and 9.8ng / μl.

[0074] In some embodiments, the co-stimulatory factor mRNA is prepared from the corresponding plasmid template, and the release criteria for the prepared material as an immunological material include: a content of 1-4 μg / μL, an A260 / A280 ratio of 1.00-4.00, an RNA length of 1100-3000 nt, integrity ≥80%, truncation <20%, capping efficiency ≥70%, DNA residue <4 ng / μg, and protein residue <10 ng / μL.

[0075] In specific implementation, the content can be any value or combination of 1 μg / μL, 1.5 μg / μL, 2 μg / μL, 3 μg / μL, and 4 μg / μL; the A260 / A280 ratio can be any value or combination of 1.50, 2.00, 2.50, 3.00, 3.50, and 4.00; the RNA length can be any value or combination of 1100 nt, 1300 nt, 1500 nt, 1650 nt, 1800 nt, and 1900 nt; the integrity can be any value or combination of 80%, 83%, 86%, 89%, 93%, 95%, and 98%; and the truncation of excessively long RNA can be 5%, 8%, 10%, 11%, or 11%. The percentage can be any value or combination of %, 14%, 17%, and 19%; the capping efficiency can be any value or combination of 70%, 73%, 77%, 80%, 85%, 89%, 93%, 95%, and 99%; the DNA residue can be any value or combination of 1μg / μg, 1.5μg / μg, 2μg / μg, 2.5μg / μg, 3ng / μg, 3.5ng / μg, and 3.9ng / μg; the protein (enzyme) residue can be any value or combination of 5ng / μl, 5.7ng / μl, 6.5ng / μl, 7ng / μl, 7.5ng / μl, 8ng / μl, 9ng / μl, and 9.8ng / μl.

[0076] In this invention, tumor neoantigen mRNA, related antigen mRNA, and co-stimulatory factor mRNA are co-introduced into autologous dendritic cells to obtain a highly expressed personalized mRNA vaccine. This vaccine synergistically enhances immunity and clinical response through multiple mechanisms. Specifically, the mechanisms are: 1) Autologous dendritic cells improve the reduced number of dendritic cells and systemic dysfunction in cancer patients; 2) A complete tumor antigen library—i.e., a combination of neoantigens and related antigens—is developed to increase tumor-specific T cell targeted killing; 3) Immune co-stimulatory factors can activate innate immunity, overcome immunosuppression in the tumor microenvironment, promote type I T helper cell (Th1 cell) responses, improve the in vivo microenvironment in cancer patients, and provide a more effective immunotherapy approach.

[0077] Secondly, embodiments of the present invention provide a method for preparing the mRNA composition described in the first aspect above. This preparation method includes:

[0078] Step 1: Prepare neoantigen mRNA by in vitro transcription based on neoantigen plasmid;

[0079] Step 2: Based on the relevant antigen plasmid, prepare the relevant antigen mRNA through in vitro transcription;

[0080] Step 3: Based on the co-stimulatory factor plasmid, prepare co-stimulatory factor mRNA through in vitro transcription.

[0081] In practice, step 1 can be carried out as follows:

[0082] First, neoantigen plasmids are prepared: highly immunogenic mutant sequences are synthesized into neoantigen transcription templates and prepared into neoantigen plasmids for the preparation of neoantigen mRNA.

[0083] Then, neoantigen mRNA was prepared by in vitro transcription: BbsI restriction endonuclease was used to react the neoantigen plasmid (each 1 μg of neoantigen plasmid was reacted with 0.1–2 μL of BbsI, such as reacting with any value of BbsI in 0.1 μL, 0.4 μL, 0.9 μL, 1.4 μL, 1.7 μL, and 2.0 μL) at 32–39°C (such as any temperature range of 32°C, 35°C, 37°C, and 39°C or combinations thereof) for 0.5–2 h (such as any value of 0.5 h, 1.0 h, 1.5 h, and 2 h or combinations thereof) to complete the linearization of the neoantigen plasmid;

[0084] Linear plasmid DNA was purified using a PCR product purification kit and eluted with nuclease-free water; samples were then taken for linearization confirmation and DNA content and purity testing.

[0085] An in vitro transcription system was prepared using linearized neoantigen plasmid as a template. Each 11 μg linearized neoantigen plasmid was mixed with 1–4 μL of T7 transcriptase (any value or combination thereof, such as 1 μL, 2 μL, 3 μL, or 4 μL), 1–4 μL of 100 mM GTP (any value or combination thereof, such as 1 μL, 2 μL, 3 μL, or 4 μL), 1–4 μL of 100 mM ATP (any value or combination thereof, such as 1 μL, 2 μL, 3 μL, or 4 μL), 1–4 μL of 100 mM UTP (any value or combination thereof, such as 1 μL, 2 μL, 3 μL, or 4 μL), 1–4 μL of 100 mM CTP (any value or combination thereof, such as 1 μL, 2 μL, 3 μL, or 4 μL), and 1–4 μL of 100 mM... The reaction is performed with DTT (e.g., any value or combination of 1 μL, 2 μL, 3 μL, and 4 μL), and incubated at 32–39°C (e.g., any temperature range or combination of 32°C, 35°C, 37°C, and 39°C) for 1–4 h (e.g., any value or combination of 1 h, 1.0 h, 1.5 h, and 2 h). After transcription, 0.5–3 μL / μg Dnase I is added and mixed (e.g., any value or combination of 0.5 μL / μg, 1.0 μL / μg, 1.5 μL / μg, 2.0 μL / μg, 2.5 μL / μg, and 3 μL / μg). The DNA template is digested by incubating at 32–39°C (e.g., any temperature range or combination of 32°C, 35°C, 37°C, and 39°C) for 5–20 min (e.g., any value or combination of 5 min, 10 min, 15 min, and 20 min).

[0086] Neoantigen mRNA was purified using a PCR product purification kit, eluted with nuclease-free water, and the purity and content of neoantigen RNA were determined.

[0087] Each 1 μg of purified neoantigen mRNA is mixed with 0.1–1 μL of 10 mM GTP (e.g., any value or combination of 0.1 μL, 0.3 μL, 0.7 μL, and 1 μL), 0.01–0.1 μL of 20 mM SAM (e.g., any value or combination of 0.01 μL, 0.03 μL, 0.07 μL, and 0.1 μL), and 0.01–0.1 μL of... Capping modification was performed by incubating 2'-O-methyltransferase (e.g., any value or combination of 0.01 μL, 0.03 μL, 0.07 μL, and 0.1 μL) or 0.01–0.1 μL of capped enzyme reaction (e.g., any value or combination of 0.01 μL, 0.03 μL, 0.07 μL, and 0.1 μL) at 32–39 °C (e.g., any temperature range or combination of 32 °C, 35 °C, 37 °C, and 39 °C) for 1–4 h (e.g., any value or combination of 1 h, 1.0 h, 1.5 h, and 2 h).

[0088] The neoantigen mRNA was purified using a PCR product purification kit and eluted with nuclease-free water. The purity, content, length, integrity, truncation of ultra-long RNA, capping efficiency, DNA residue, and protein (enzyme) residue were then detected.

[0089] Adjust the concentration to the specified standard (2 μg / μL), dispense into 44 μg / vial (40 μg specification), and store at -90 to -70℃ (such as any temperature range or combination of -90℃, -85℃, -80℃, -75℃ and -70℃) for 24 hours, then transfer to a liquid nitrogen tank for storage.

[0090] The release criteria for neoantigen mRNA include: a content of 1–4 μg / μL, a purity (expressed as the ratio of OD(A260 / A280)) of 1.50–4.00, an RNA length of 600–800 nt, integrity ≥80%, truncation <20%, capping efficiency ≥70%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μL.

[0091] In practice, the specific operations of step 2 are similar to those of step 1, and will not be repeated here. The only difference is that the release criteria are slightly different. In step 2, the release criteria for the relevant antigen mRNA include: a content of 1-4 μg / μL, a purity (expressed as the ratio of OD(A260 / A280)) of 1.50-4.00, an RNA length of 1500-2000 nt, integrity ≥80%, truncation <20%, capping efficiency ≥70%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0092] In practice, the specific operations of step 3 are similar to those of step 1, and will not be repeated here. The only difference is that the release criteria are slightly different. In step 3, the release criteria for co-stimulatory factor mRNA include: a content of 1-4 μg / μL, a purity (expressed as the ratio of OD(A260 / A280)) of 1.50-4.00, an RNA length of 1100-3000 nt, integrity ≥80%, truncation <20%, capping efficiency ≥70%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0093] Thirdly, embodiments of the present invention provide a carrier. This carrier comprises the mRNA composition described in the first aspect above. In some embodiments, the carrier may be any one or more of lipids, liposomes, lipid complexes, lipid nanoparticles, polymeric nanoparticles, cells, simulated nanoparticles, nanotubes, or conjugates comprising the mRNA composition described in the first aspect above. The cells may be antigen-presenting cells (e.g., dendritic cells, DCs) or B cells.

[0094] Specifically, for example, the mRNA composition may be complexed with a polymer or lipid component, or the mRNA composition may be encapsulated in liposomes in some respects, or the mRNA composition may be encapsulated in lipid nanoparticles (LNPs).

[0095] In this embodiment, the use of LNPs enables the effective delivery of chemically modified or unmodified mRNA vaccines.

[0096] In this embodiment, the liposomes are amphiphilic lipids that can form a bilayer in an aqueous environment to encapsulate an RNA-containing aqueous core. These lipids may have anionic, cationic, or zwitterionic hydrophilic head groups. Liposomes may be formed from a single lipid or a mixture of lipids. The mixture may include (i) a mixture of anionic lipids, (ii) a mixture of cationic lipids, (iii) a mixture of zwitterionic lipids, (iv) a mixture of anionic and cationic lipids, (v) a mixture of anionic and zwitterionic lipids, (vi) a mixture of zwitterionic and cationic lipids, or (vii) a mixture of anionic lipids, cationic lipids, and zwitterionic lipids.

[0097] In this embodiment, polymer microparticles or nanoparticles may also be used to encapsulate or adsorb mRNA. These particles can be substantially non-toxic and biodegradable. Particles used for mRNA delivery may have optimal size and zeta potential. For example, the diameter of the microparticles can range from 0.02 μm to 8 μm. In the case of compositions with groups of micro or nanoparticles of different diameters, at least 80%, 85%, 90%, or 95% of these particles ideally have a diameter in the range of 0.03-7 μm. The particles may also have a zeta potential between 40-100 mV to maximize the adsorption of mRNA onto the particles. Non-toxic and biodegradable polymers include, but are not limited to, poly(ahydroxyacid), polyhydroxybutyric acid, polylactones (including polycaprolactone), polydioxanone, polyvalerol, polyorthoesters, polyanhydrides, polycyanoacrylates, tyrosine-derived polycarbonates, polyvinylpyrrolidone, or polyesteramides, and combinations thereof.

[0098] In this embodiment, autologous dendritic cells (DCs) can improve the reduction in DC numbers and systemic dysfunction in cancer patients. Furthermore, the use of autologous DCs as a carrier leverages the characteristic of DCs to highly express the aforementioned related antigens and neoantigens, enabling efficient presentation of these two antigens and effectively stimulating tumor-killing effector T cells.

[0099] Furthermore, the personalized neoantigens in this embodiment are selected from tumor neoantigens specific to each patient. These are expressed only by tumor cells, thus triggering a genuine tumor-specific T-cell response and preventing off-target damage to non-tumor tissues. Simultaneously, these neoantigens are novel epitopes derived from somatic mutations, potentially bypassing T-cell central tolerance to their own epitopes and inducing an immune response against the tumor. Moreover, the enhanced neoantigen-specific T-cell responses from these vaccines persist and provide the potential for post-treatment immune memory, offering the possibility of long-term prevention of disease relapse.

[0100] In this embodiment, tumor-associated antigens (TAAs) refer to a class of antigen molecules present on both tumor cells and normal cells, commonly used in clinical tumor diagnosis. They are not specific to tumor cells; normal cells can synthesize them in trace amounts, but they are highly expressed during tumor cell proliferation. In solid tumor treatment, TAAs are also the preferred tumor targets. Utilizing DC vaccines to highly express this antigen allows for efficient antigen presentation, effectively stimulating the killing of tumor-killing effector T cells. Specifically, the relevant antigen can be WT1.

[0101] In this embodiment, the co-stimulatory factor, such as CD40L, is described in detail using CD40L as an example: through the CD40-CD40L co-stimulatory axis, DCs are induced to secrete IL-12. IL-12 is an important cytokine in innate and adaptive immunity, which can enhance the immunity of helper T cells type 1 (Th1), increase the cytotoxicity of cytotoxic T lymphocytes, and inhibit angiogenesis.

[0102] The main concept of the vector (such as a DC vaccine) carrying an mRNA composition provided in this embodiment is as follows: Since cancer cells (such as ovarian cancer cells) have overexpressed antigens and neoantigens generated by mutations, we can take advantage of this characteristic of cancer cells and use both neoantigens and related antigens as targets, which can improve the killing effect on tumors.

[0103] Fourthly, embodiments of the present invention provide a method for preparing the carrier described in the third aspect above. The preparation method includes:

[0104] Step 4: Load the mRNA composition described in the first aspect into a vector.

[0105] When the vector is a cell, the preparation method further includes: step 5, inducing the vector loaded with the mRNA composition.

[0106] In practice, we will take DC as an example to explain in detail. The specific operation can be as follows:

[0107] With 1×10 6 ~1×10 8 cells / mL (e.g., 1×10⁻⁶) 6 cells / mL, 10×10 6 cells / mL, 40×10 6 cells / mL, 70×10 6 cells / mL and 100×10 6 The concentration of any value (or combination thereof) in the electroporation buffer was resuspended at 1 × 10⁻⁶ cells / mL, and 1 × 10⁻⁶ cells / mL was added to each electroporation vessel. 5 ~5×10 7 One (0.1-0.5 mL) mDC (e.g., 1×10) 6 cells / mL, 50×10 6 cells / mL, 100×10 6 cells / mL, 200×10 6 cells / mL, 300×10 6 cells / mL, 400×10 6 cells / mL and 500×10 6 Add 1 part RNA mixture (any value or combination thereof in 1 × 10⁻⁶ / mL) to the mixture (the ratio of the mixture is 1 × 10⁻⁶ / mL). 6Each DC cell is given 1–4 μg of co-stimulatory factor CD40L mRNA, 1–4 μg of overexpressed WT1 mRNA, and 0.1–3 μg of tumor neoantigen mRNA (e.g., any value of CD40L mRNA, 1 μg, 2 μg, 3 μg, or 4 μg; any value of overexpressed WT1 mRNA, 1 μg, 2 μg, or 3 μg; and any value of tumor neoantigen mRNA, 0.1 μg, 0.5 μg, 1 μg, 1.5 μg, 2.0 μg, 2.5 μg, or 3 μg). The cells are then co-electropograded using an electroporator (voltage range of 200–350 V, such as any value or combination of 200 V, 250 V, 300 V, or 350 V).

[0108] The electroporation instrument used was the Gene Pulser Xcell electroporator manufactured by Bio-Rad.

[0109] Among them, the neoantigen mRNA can be an mRNA with 1 to 10 sequences for screening. That is, it can be a neoantigen mRNA with 1 sequence, or it can be a neoantigen mRNA with 2, 4, 6 or 10 sequences.

[0110] After electroporation, the cells were injected at a rate of 1 × 10⁻⁶. 6 ~5×10 6 cells / mL (e.g., 1×10⁻⁶) 6 cells / mL, 2×10 6 cells / mL, 3×10 6 cells / mL, 4×10 6 cells / mL and 5×10 6 The cells (at any value in CFU / mL) were transferred into AIM-V medium containing GM-CSF and IL-4 and incubated in a CO2 incubator. After 2–6 hours (e.g., any value or combination of 2h, 3h, 4h, 5h, and 6h) from the start of electroporation, the cells were transferred out of the culture bag, centrifuged, resuspended, and counted. The stock solution was then harvested. This stock solution is the DC tumor vaccine.

[0111] Fifthly, embodiments of the present invention provide an mRNA vaccine. This mRNA vaccine comprises the mRNA composition described in the first aspect above, or comprises the vector described in the third aspect above. As described herein, mRNA vaccines can be used to induce a balanced immune response, including cellular and / or humoral immunity, without many of the risks associated with DNA vaccination.

[0112] In a sixth aspect, embodiments of the present invention provide an application of the mRNA composition described in the first aspect, the vector described in the third aspect, or the mRNA vaccine described in the fifth aspect.

[0113] In some embodiments, the application may be in cancer treatment and / or prevention, or in the preparation of cancer-specific T cells, or in the preparation of cancer-specific TCR-T cells, or in the preparation of cancer-specific diagnostic reagents.

[0114] In some embodiments, the cancer can be any one of breast cancer, ovarian cancer, stomach cancer, liver cancer, prostate cancer, lung cancer, and colon cancer.

[0115] The present invention also provides the following implementation schemes:

[0116] Implementation Scheme 1. A personalized mRNA composition, characterized in that the mRNA composition comprises: at least one neoantigen mRNA encoding a tumor neoantigen and at least one related antigen mRNA encoding a tumor-associated antigen.

[0117] Implementation Scheme 2. The mRNA composition according to Implementation Scheme 1, characterized in that the neoantigen transcription template corresponding to the neoantigen mRNA is a highly immunogenic mutant sequence obtained by sequentially screening for peptides and mutation sites.

[0118] Implementation Scheme 3. The mRNA composition according to Implementation Scheme 1 or 2, characterized in that the mRNA composition further comprises: at least one costimulatory factor mRNA encoding a costimulatory factor.

[0119] Implementation Scheme 4. The mRNA composition according to Implementation Scheme 3, characterized in that the co-stimulatory factor is any one of IL-2, IL-7, IL-12, IL-15, CD40L, CD40, CD27L, CD27, CD28, CD275, CD278, CD134, CD137, CD154, GITR, HVEM, LFA-1, CD2, CD58, ICAM-1, TNFSF4, TNFSF5, TNFSF7, TNFSF9, TNFSF14, and TNFSF18.

[0120] Implementation Scheme 5. The mRNA composition according to Implementation Scheme 1, characterized in that the tumor-associated antigen is any one of WT1, MSLN, and FSHR.

[0121] Implementation Scheme 6. The mRNA composition according to Implementation Scheme 3, characterized in that the RNA length of the neoantigen mRNA is 600-800 nt; and / or the RNA length of the related antigen mRNA is 1500-2000 nt; and / or the RNA length of the co-stimulatory factor mRNA is 1100-3000 nt.

[0122] Implementation Scheme 7. A vector, characterized in that the vector comprises the mRNA composition described in any one of Implementation Schemes 1-6.

[0123] Implementation Scheme 8. The carrier according to Implementation Scheme 10, characterized in that the carrier is one or more of the following: lipids, liposomes, lipid complexes, lipid nanoparticles, polymeric nanoparticles, DC cells, B cells, simulated nanoparticles, nanotubes, or conjugates containing the mRNA composition.

[0124] Implementation Scheme 9. An mRNA vaccine, characterized in that the mRNA vaccine comprises the mRNA composition described in any one of Implementation Schemes 1-6, or comprises the vector described in Implementation Scheme 7 or 8.

[0125] Implementation Scheme 10. Application of an mRNA composition according to any one of Implementation Schemes 1-6, or a vector according to Implementation Scheme 7 or 8, or an mRNA vaccine according to Implementation Scheme 9.

[0126] Implementation Scheme 11. The application according to Implementation Scheme 10, characterized in that the application includes: application in the preparation of cancer-specific T cells; or application in the preparation of cancer-specific TCR-T cells; or application in the preparation of cancer-specific diagnostic reagents.

[0127] Implementation Scheme 12. The application according to Implementation Scheme 11, characterized in that the cancer is any one of breast cancer, ovarian cancer, gastric cancer, liver cancer, prostate cancer, lung cancer, and colon cancer.

[0128] To enable those skilled in the art to better understand the in vitro antigen immunogenicity assessment method provided in the embodiments of the present invention, detailed descriptions are provided below through specific examples. Unless otherwise specified, all reagents and instruments used are existing commercial products and can be purchased directly.

[0129] In the following specific embodiments, the tumor-associated antigen used is WT1, the vector used is dendritic cells, and the co-stimulatory factor used is CD40L.

[0130] The ovarian cancer patient involved in this embodiment underwent ovarian cancer resection at West China Hospital. With the approval of the Ethics Committee of West China Hospital, patient samples were collected and used, and the patient or their family were informed, with both parties signing informed consent forms. Tumor tissue samples were immediately placed in plastic bottles containing mRNA preservation solution after collection from the operating room and labeled with patient information. Additionally, 5-8 mL of the patient's peripheral blood was collected in EDTA tubes as a control sample.

[0131] After checking sample integrity and total sample size, sequencing analysis was performed. The sequencing results were then screened based on the following criteria: transcriptome sequencing data supported by a mutant sequence, TPM expression level >5, affinity <100 nM, mutation frequency >0.1, and non-homologous peptides. Samples not meeting these criteria were excluded. The remaining samples were then sorted by peptide score from highest to lowest, and the top 10 highly immunogenic neoantigens were selected. The scores of all peptides at the same mutation site were summed, and the mutation sites were ranked, with the top 5 mutations selected.

[0132] The accuracy of neoantigen mutation sites was verified using PCR and Sanger sequencing to extract genomic DNA from tumor tissue and peripheral blood from patients. This ensured that the screened neoantigen mutations were not present in normal tissues.

[0133] Example 1. Preparation of neoantigen mRNA

[0134] In this embodiment, the neoantigen transcription template is a highly immunogenic mutant sequence that has been screened out, and then a third party is commissioned to prepare a neoantigen plasmid based on the neoantigen template.

[0135] Neoantigen mRNA preparation by in vitro transcription: 0.1 μL of BBSI restriction endonuclease was mixed with 1 μg of neoantigen plasmid and incubated at 32℃ for 0.5 h to linearize the neoantigen plasmid; the linear plasmid DNA was purified using a PCR product purification kit and washed with nuclease-free water; samples were taken for linearization confirmation and DNA content and purity testing; an in vitro transcription system was prepared using the linearized neoantigen plasmid as a template, with each 11 μg of linearized neoantigen plasmid reacted with 1 μL of T7 transcriptase, 1 μL of 100 mM GTP, 1 μL of 100 mM ATP, 1 μL of 100 mM UTP, 1 μL of 100 mM CTP, and 1 μL of 100 mM DTT, and incubated at 32℃ for 1 h. After transcription, 0.5 μL / μg DNase was added. I. Mix well and incubate at 32℃ for 5 min to digest the DNA template; purify neoantigen mRNA using a PCR product purification kit, wash with nuclease-free water, and detect the purity and content of neoantigen RNA; 1 μg of purified neoantigen mRNA is reacted with 0.1 μL 10mM GTP, 0.01 μL 20mM SAM, 0.01 μL 2'-O-methyltransferase, and 0.01 μL capping enzyme, and incubated at 32℃ for 1 h for capping modification; purify again using a PCR product purification kit, wash with nuclease-free water, and detect the purity, content, RNA length, integrity, truncation, capping efficiency, DNA residue, and protein (enzyme) residue of neoantigen mRNA; adjust the concentration to the specified standard (2 μg / μL), aliquot into 44 μg / vial (40 μg specification), store at -70℃ for 24 h, and then transfer to a liquid nitrogen tank for storage.

[0136] The release criteria for neoantigen mRNA are as follows: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) greater than 2.0, RNA length of 600 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0137] In this embodiment, two neoantigen mRNAs were prepared according to the above procedures, and their specific sequences are as follows:

[0138] The neoantigen mRNA-1 (SEQ ID NO: 1) is shown in Table 1.

[0139] Table 1. mRNA sequence information of neoantigen mRNA-1

[0140] RNA name Gene mRNA sequence HLA-A0201 SH3BP5L AACCUGAUGCAGAUCAGCGAGCAGAUU

[0141] The neoantigen mRNA-2 (SEQ ID NO: 2) is shown in Table 2.

[0142] Table 2. mRNA sequence information of neoantigen mRNA-2

[0143] RNA name Peptide information mRNA sequence SPINT2-0201 VLLAGLFVMV GUGCUUCUGGCGGGGCUGUUCGUGAUGGUG

[0144] Example 2. Preparation of related antigen WT1 mRNA

[0145] The specific operations and conditions in this embodiment are similar to those in Embodiment 1 above, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for the relevant antigen mRNA are: a content of 1 μg / μL, a purity (expressed as the ratio of OD(A260 / A280)) of less than 2.0, an RNA length of 1500 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0146] The RNA sequence (SEQ ID NO: 3) of the relevant antigen WT1 mRNA prepared in this example is as follows:

[0147]

[0148] Example 3. Preparation of co-stimulatory factor CD40L mRNA

[0149] The specific operations and conditions in this embodiment are similar to those in Embodiment 1 above, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for co-stimulatory factor CD40L mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 1100 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0150] The RNA sequence (SEQ ID NO: 4) of the co-stimulatory factor CD40L mRNA prepared in this example is as follows:

[0151] AUGAUCGAAACAUACAACCAAACUUCUCCCCGAUCUGCGGCCACUGGACUGCCCAUCAGCAUGAAAAUUUUUAUGUAUUUACUUACUGUUUUUCUUAUCACCCAGAUGAUUGGGUCAGCACUUUUUGCUGUGUAUCUUCAUAGAAGGUUGGACAAGAUAGAAGAUGAAAGGAAUCUUCAUGAAGAUUUUGUAUUCA UGAAAACGAUACAGAGAUGCAACACAGGAGAAAGAUCCUUAUCCUUACUGAACUGUGAGGAGAUUAAAAGCCAGUUUGAAGGCUUUGUGAAGGUAUAAUGUUAAACAAGGAGGAGACGAAGAAAGAAAACAGCUUUGAAAUGCAAAAAGGUGAUCAGAAUCCUCAAAUUGCGGCACAUGUCAUAAAGUGAGGCCAGC AGUAAAACAACAUCUGUGUUACAGUGGGCUGAAAAAGGAUACUACACCAUGAGCAACAACUUGGUAACCCUGGAAAAUGGGAAACAGCUGACCGUUAAAAGACAAGGACUCUAUUAUAUCUAUGCCCAAGUCACCUUCUGUUCCAAUCGGGAAGCUUCGAGUCAAGCUCCAUUUAUAGCCAGCCUCUGCCUAAAGU CCCCCGGUAGAUUCGAGAAUCUUACUCAGAGCUGCAAAUACCCACAGUUCCGCCAAACCUUGCGGGCAACAAUCCAUUCACUUGGGAGGAGUAUUUGAAUUGCAACCAGGUGCUUCGGUGUUUGUCAAUGUGACUGAUCCAAGCCAAGUGAGCCAUGGCACUGGCUUCACGUCCUUUGGCUUACUCAAACUCUAAA

[0152] Example 4. Preparation of DC tumor vaccine-1 loaded with mRNA composition

[0153] Electroporation was used to load relevant antigen WT1 mRNA, tumor neoantigen mRNA, and co-stimulatory factor CD40L mRNA into mDCs. The loaded mDCs were then induced to obtain mature dendritic cells loaded with these antigens, tumor neoantigens, and co-stimulatory factors. The specific procedures are as follows:

[0154] With 1×106 The cells were resuspended in the electroporation buffer at a concentration of 1 × 10⁻⁶ cells / mL, and 1 × 10⁻⁶ cells / mL was added to each electroporation vessel. 6 Add 1 part RNA mixture (containing 1×10⁶ mDCs / mL mDC) to 1 part RNA mixture (this mixture contains 1×10⁶ mDCs / mL mDC). 6 One dendritic cell line (DC) containing 1 μg of CD40L mRNA, 1 μg of WT1 mRNA, and 0.1 μg of tumor neoantigen mRNA-1 was co-electropoverted using an electroporator (voltage value of 200V). The electroporator used was a Gene Pulser Xcell electroporator manufactured by Bio-Rad.

[0155] After electroporation, the cells were injected at a rate of 1 × 10⁻⁶. 6 Cells were transferred at a concentration of 1 cell / mL into AIM-V medium containing GM-CSF and IL-4, and cultured in a CO2 incubator. After 2 hours from the start of electroporation, the cells were transferred out of the culture bag, centrifuged, resuspended, and counted. The stock solution was then harvested. This stock solution is DC tumor vaccine-1.

[0156] CD40L mRNA expression validation: The successful generation of CD40L mRNA in DC cells was validated by detecting the expression of the effector molecule CD40L. The validation procedure was as follows: Cells from the harvested stock solution were washed with FACS buffer, centrifuged, and stained with a Dead Cell Discriminator; cells were fixed with Fixation buffer and a StopReagent Discriminator; fixed cells were washed with FACS buffer; cells were then resuspended in 1×Perm / washbuffer and divided into a control group and a CD40L group; 2.5 μL of purified CD154 was added to the control group, while no such addition was added to the CD40L group, and the cells were incubated at room temperature for 30 min; then 20 μL of APC-CD154 was added to both the control and CD40L groups, and the cells were incubated at room temperature for 30 min; after washing the cells, the RNA expression levels in the cells of the control and CD40L groups were detected by flow cytometry, and the data were analyzed using FlowJo.

[0157] Figure 1 The results of protein detection for CD40L mRNA expression in the DC tumor vaccine-1 (S group) prepared in Example 4 of this invention are shown. Figure 1 As shown, the expression level of CD154 in DC tumor vaccine-1 reached 60.2%–94.9%, with an average expression intensity of 80.3%, while the expression level of CD154 in DC cells of control group C (without electroporation of CD40L mRNA) was below 10%, with an average expression intensity of only 2.3%. These results indicate that CD40L mRNA was successfully generated in DC cells.

[0158] WT1 mRNA expression verification: Successful generation in DC cells was verified by detecting the protein expressed by overexpressing antigen (WT1) RNA. The verification procedure in this embodiment is similar to that for CD40L mRNA expression verification, except that the WTI group was supplemented with purified WT1 antibody, while the control group was not. After incubation for 30 min, 1.25 μL of fluorescent secondary antibody APC Rat anti-Mouse IgG1 was added to both the control and WTI groups.

[0159] Figure 2 The protein detection results of WT1 mRNA expression in the DC tumor vaccine-1 prepared in Example 4 of the present invention are shown. Figure 2 As shown, the expression level of WT1 in DC tumor vaccine-1 can reach 65.1% to 92.4%, with an average expression level of 76.7%. In contrast, the expression level of WT1 in DC cells of the control group (without electroporation of WT1 mRNA) is below 10%, with an average expression intensity of only 3.97%, indicating that the overexpression antigen (WT1) RNA was successfully generated in DC cells.

[0160] Validation of tumor neoantigen mRNA-1 expression: The protein formed by the translation and expression of neoantigen RNA in cells was directly detected by Western blotting. The detection method disclosed in patent CN111440228B was followed by the following steps: Cells in the harvested stock solution were washed with PBS and centrifuged. The supernatant was discarded, and lysis buffer (IP cell lysis buffer, PMSF, and protease inhibitor cocktail in a volume ratio of 1:0.002:0.002) was added. The mixture was vortexed, and then 5X loadling buffer was added and vortexed again. The mixture was briefly centrifuged and heated at 75°C for 5 minutes. The cells were then pulverized using a cell disruptor to obtain a protein solution. The protein solution was subjected to 12% SDS-PAGE electrophoresis and transferred to a PVDF membrane. The membrane was then blocked with 5% skim milk at room temperature for 1 hour, washed three times with PBST for 5 minutes each time, and then primary antibody (5% milk) was added. The membrane was incubated overnight at 4°C. The washing steps were repeated, and secondary antibody dilution buffer (5% skim milk and mouse antibody mixed at a ratio of 1:500000) was added. The membrane was incubated at 4°C for 1 hour. Finally, the protein blot was analyzed using a chemiluminescence imaging analysis system.

[0161] Figure 3 Western blot analysis of tumor neoantigen mRNA-1 and tumor neoantigen mRNA-2 expressed proteins in the DC tumor vaccines prepared in Examples 4 and 6 of this invention is shown. Figure 3 As shown, tumor neoantigen mRNA-1 can express protein in DC tumor vaccines. However, DC cells in the control group (without electroporation of tumor neoantigen mRNA-1) showed no blot at the same location, indicating that the corresponding protein was not expressed in the control group.

[0162] Example 5. Preparation of DC tumor vaccine-2 loaded with mRNA composition

[0163] The preparation method and specific conditions in this embodiment are similar to those in Example 4, the only difference being that the RNA mixture is made from 1×10 6 The solution consists of one dendritic cell (DC) cell, 1 μg of WT1 mRNA, and 0.1 μg of tumor neoantigen mRNA-1. All other components are identical and will not be repeated in this embodiment. The resulting stock solution is named DC Tumor Vaccine-2.

[0164] The verification of WT1 mRNA expression and tumor neoantigen mRNA-1 expression in this embodiment are performed using the same methods and results as in Example 4. Therefore, they will not be described again in this embodiment.

[0165] Example 6. Preparation of DC tumor vaccine-3 loaded with mRNA composition

[0166] The preparation method and specific conditions in this embodiment are similar to those in Example 4, the only difference being that the RNA mixture is made from 1×10 6 The solution consisted of one dendritic cell (DC) cell, 1 μg of CD40L mRNA, 1 μg of WT1 mRNA, and 0.1 μg of tumor neoantigen mRNA-2. All other components were identical and will not be repeated in this embodiment. The resulting stock solution was named DC Tumor Vaccine-3.

[0167] The WT1 mRNA expression verification in this embodiment and the corresponding operation methods and results are the same as those in Example 4. Therefore, they will not be described again in this embodiment.

[0168] The verification procedure for tumor neoantigen mRNA-2 expression is the same as that in Example 4, and will not be repeated in this example. Figure 3 Western blot analysis of tumor neoantigen mRNA-1 and tumor neoantigen mRNA-2 expressed proteins in the DC tumor vaccines prepared in Examples 4 and 6 of this invention is shown. Figure 3 As shown, tumor neoantigen mRNA-2 can express protein in DC tumor vaccines, while DC cells in the control group (without electroporation of tumor neoantigen mRNA-2) showed no blot at the same location, indicating that the corresponding protein was not expressed in the control group.

[0169] Example 7. Preparation of DC tumor vaccine-4 loaded with mRNA composition

[0170] The preparation method and specific conditions in this embodiment are similar to those in Example 4, the only difference being that the RNA mixture is made from 1×10 6The solution consisted of one dendritic cell (DC) cell, 1 μg of WT1 mRNA, and 0.1 μg of tumor neoantigen mRNA-2. All other components were identical and will not be repeated in this embodiment. The resulting stock solution was named DC Tumor Vaccine-4.

[0171] The verification of WT1 mRNA expression and tumor neoantigen mRNA-2 expression in this embodiment are performed using the same methods and results as in Example 6. Therefore, they will not be described again in this embodiment.

[0172] Example 8. In vitro evaluation of the immunogenicity of DC tumor vaccine

[0173] The evaluation groups included: CD40L / WT1 / neoantigen treatment group, WT1 / neoantigen treatment group, control group, neoantigen treatment group, WT1 treatment group, and CD40L treatment group.

[0174] The CD40L / WT1 / neoantigen therapy group consisted of: co-stimulating and culturing the DC tumor vaccine-1 prepared in Example 4 with CD8+ T cells at a cell ratio of 1:10 to activate T cells, resulting in tumor-specific CD8+ T cell suspension No. 1, i.e., the CD40L / WT1 / neoantigen group. The WT1 / neoantigen therapy group consisted of: co-stimulating and culturing the DC tumor vaccine-2 prepared in Example 5 with CD8+ T cells at a cell ratio of 1:10 to activate T cells, resulting in tumor-specific CD8+ T cell suspension No. 1, i.e., the WT1 / neoantigen group.

[0175] The control group consisted of mature dendritic cells (DCs) without RNA, prepared using enzyme-free water instead of the RNA mixture. These mature DCs were then co-incubated with CD8+ T cells to stimulate cell culture, resulting in a CD8+ T cell suspension, which served as the blank control group. The neoantigen therapy group consisted of DCs loaded with tumor neoantigen mRNA-1 prepared in the above steps, co-stimulated with CD8+ T cells at a 1:10 cell ratio to activate T cells, resulting in tumor-specific CD8+ T cell suspension #2, which served as the tumor neoantigen therapy group. The WT1 therapy group consisted of DCs loaded with WT1 mRNA prepared in the above steps, co-stimulated with CD8+ T cells at a 1:10 cell ratio to activate T cells, resulting in tumor-specific CD8+ T cell suspension #3, which served as the WT1 therapy group. The CD40L treatment group consists of: DCs loaded with CD40L mRNA prepared in the above steps are co-stimulated with CD8+ T cells at a cell ratio of 1:10 to activate T cells, resulting in cell suspension No. 4 of tumor-specific CD8+ T cells, which is the CD40L treatment group.

[0176] All six groups were cultured in vitro for 10 days, during which the corresponding DC cells were stimulated for three rounds, with a three-day interval between each round.

[0177] The specific evaluation method is as follows: using ICS detection technology to detect tumor-specific CD8+ T cell effector factors IFN-γ and TNFα in vitro. Figure 4 The relevant detection data of tumor-specific CD8+ T cells in the embodiments of the present invention are shown; wherein, Figure A shows the number of tumor-specific CD8+ T cells expressing IFN-γ, and Figure B shows the number of tumor-specific CD8+ T cells expressing TNFα.

[0178] Experimental results are as follows Figure 4 As shown in the data, the expression of CD8+ T cell-specific markers IFN-γ and TNF-α was upregulated after three rounds of antigen-loaded stimulation with DC tumor vaccine-1 and DC tumor vaccine-2, demonstrating a stronger ability to kill tumor cells.

[0179] Furthermore, data from the CD40L / WT1 / neoantigen treatment group and the WT1 / neoantigen treatment group showed that when CD40L mRNA was added to the mRNA composition consisting of WT1 mRNA and tumor neoantigen mRNA-1, the upregulation of the expression of CD8+ T cell-specific markers IFN-γ and TNF-α stimulated by the addition of CD40L mRNA was significantly higher than that stimulated by the mRNA composition consisting of WT1 mRNA and tumor neoantigen mRNA-1. In other words, the addition of CD40L mRNA can further enhance the immunogenicity of the DC tumor vaccine.

[0180] Example 9. In vivo efficacy evaluation of DC tumor vaccine

[0181] We used the ovarian cancer cell line OVCAR8 (HLA-A*02:01) to simulate human tumor cells, and subcutaneously inoculated immunodeficient mice to construct a tumor-bearing model. Then, we used in vitro-domesticated CD8+T humanized mice to reconstruct the human immune system. The aim was to observe the immune response induced by repeated intravenous injection of DC tumor vaccine-3 into NOG-dKO mice, thereby inhibiting tumor growth.

[0182] Laboratory animals: Species & strains: MHC class I- and class II-deficient NOG (abbreviated as NOG-dKO), NOG background is NOD / Shi-Prkdc scid Il2rγ tm1Sug / Jic.

[0183] Detailed experimental procedure:

[0184] Sixty female NOG-dKO mice were used in the experiment and divided into three donors for repeated experiments. Each donor assigned 20 mice, which were then divided into six groups (as shown in Table 3): Group 1 was given tumor-bearing, in vitro-acclimated CD8+ T cells and PBS with the same volume of DCs as other groups (tumor-bearing control group, labeled as control group); Group 2 was given tumor-bearing, in vitro-acclimated CD8+ T cells and 1×10 6 DCs loaded with CD40L mRNA at a concentration of [concentration] (CD40L treatment group, designated as group 2); group 3 received tumor-bearing, in vitro-acclimated CD8+ T cells and 1×10 [units of something]. 6 DCs loaded with WT1 mRNA at a concentration of [concentration] (WT1 treatment group, designated group 3); group 4 received tumor-bearing, DC-dominated CD8+ T cells and 1×10 [units of] [amount of] [cells ... 6 DCs loaded with neoantigen mRNA-2 at a certain concentration (neoantigen treatment group, labeled group 4); group 5 received tumor-bearing, in vitro-acclimated CD8+ T cells and 1×10 6 Group 5 received a concentration of DC tumor vaccine-3 (antigen combination therapy group); Group 6 received tumor-bearing, DC-dominated CD8+ T cells and 1×10 6 Concentration of DC tumor vaccine-4 (combination therapy group, labeled group 6).

[0185] Table 3. Experimental procedure information for each group in the in vivo efficacy evaluation

[0186]

[0187] Note: In this embodiment, the DC and CD8+ T cells used are derived from the same patient (i.e., the donor). The only difference between the DC tumor vaccine-3 and DC tumor vaccine-4 prepared in this embodiment is the RNA composition. The cells used are all derived from the same patient.

[0188] First, administer 1×10⁻⁶ mmol / L to each mouse in each of the above groups via subcutaneous injection. 5 Tumor cells. Three to ten days after tumor formation, each mouse was injected with 1×10⁻⁶ tumor cells via tail vein injection. 7 The concentration of in vitro-acclimated CD8+ T cells was 0.10 mL. Following administration of the in vitro-acclimated CD8+ T cells, each mouse in group 2 was injected with 1 × 10⁻⁶ cells via tail vein. 6 The mice were injected with dendritic cells carrying CD40L mRNA at a dose of 0.10 mL; 1 × 10⁻⁶ cells were injected into each mouse in groups 3 and 4 via tail vein injection. 60.10 mL of dendritic cells (DCs) loaded with WT1 mRNA and DCs loaded with tumor neoantigen mRNA-2 were injected into each mouse in groups 5 and 6 via tail vein injection. 6 The DC tumor vaccine-4 and DC tumor vaccine-3 were administered at a single-dose concentration of 0.10 mL. Subsequently, the vaccine was administered every 6 days for a total of 4 doses. All mice were euthanized and dissected at the end of the experiment. Animal biomarkers included small animal in vivo imaging and tumor weight monitoring to measure tumor size.

[0189] Taking one donor as an example, based on the animal's weight measured before tumor bearing, the animals were randomly divided into 4 groups for the study. The specific grouping is shown in Table 4 below.

[0190] Table 4. In vivo efficacy evaluation data for each group

[0191]

[0192] Figure 5 The experimental results of tumor weight in each group in Example 9 of the present invention are shown. Figure 5 The experimental results show that the tumor shrinkage rate was as follows: control group < CD40L treatment group < WT1 treatment group < neoantigen treatment group < WT1 / neoantigen treatment group < CD40L / WT1 / neoantigen treatment group. That is, the DC tumor vaccines-3 and-4 prepared in this application have significant tumor-killing effects, and their killing effect is significantly higher than that of using WT1 mRNA or tumor neoantigen mRNA-2 alone. Furthermore, by Figure 5 The experimental results of groups 2, 5, and 6 show that the tumor weight corresponding to the addition of CD40L mRNA to the mRNA composition consisting of WT1 mRNA and tumor neoantigen mRNA-2 was lower than that corresponding to the tumor weight of the mRNA composition consisting of WT1 mRNA and tumor neoantigen mRNA-2 alone. In other words, the addition of CD40L mRNA can further enhance the tumor-killing efficacy of the DC tumor vaccine.

[0193] Figure 6 The experimental results of tumor inhibition rate in each group in Example 9 of the present invention are shown. Figure 6 The experiment demonstrates the tumor inhibition rate at the endpoint after 6 doses; with group 1 as the baseline, the tumor inhibition rates for groups 2, 3, 4, 5, and 6 were calculated. Figure 6The experimental results show that groups 3 and 4 both had a certain tumor inhibition rate, but group 5, which was injected with DC tumor vaccine-4, had a significantly higher tumor inhibition rate than groups 3 and 4. In other words, the experimental data in this embodiment demonstrate that the combination of tumor neoantigens and related antigens, when used on tumors, has a more significant tumor inhibition effect compared to using them alone.

[0194] Furthermore, by Figure 6 The experimental results of groups 2, 5, and 6 show that, similarly, the tumor inhibition rate after adding CD40L mRNA to the mRNA composition consisting of WT1 mRNA and tumor neoantigen mRNA-2 was significantly higher than that of the mRNA composition consisting of WT1 mRNA and tumor neoantigen mRNA-2 alone, and much higher than the tumor inhibition rate of adding CD40L alone. In other words, the addition of CD40L mRNA can further enhance the tumor-killing efficacy of the DC tumor vaccine.

[0195] In addition, the present application also provides the following specific embodiments to verify that the composition provided in this application is also applicable to other cancers.

[0196] Example 10: In vivo efficacy of humanized drugs for ovarian cancer

[0197] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were intravenously injected and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was a co-stimulatory factor-modified DC treatment group, receiving CD40L DCs. Group 3 was a WT1 and FSHR combination treatment group, receiving WT1 and FSHR DCs. Group 4 was a neoantigen treatment group, receiving neoantigen DCs. Group 5 was an antigen combination treatment group, receiving WT1 and FSHR / neoantigen DCs. Group 6 was a combination treatment group, receiving co-stimulatory factor / WT1 and FSHR / neoantigen DCs. Drugs were administered weekly for 5 weeks, followed by a 1-week observation period. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0198] Figure 7 The experimental results of tumor inhibition rates in each group in Example 10 of the present invention are shown. Figure 7 It can be seen that, based on the detected changes in tumor size, the tumor inhibition rate was calculated. When multiple related antigens were combined (as shown in the WT1 FSHR treatment group), the tumor inhibition rate was 36.1%, indicating that the combined use of multiple related antigens also has a certain tumor inhibition rate. Furthermore, when a neoantigen was added to the related antigen mixture, the tumor inhibition rate of the WT1 / FSHR neoantigen treatment group was 56.9%, which is significantly higher than the 36.1% tumor inhibition rate.

[0199] On the other hand, when co-stimulatory factors are added to the antigen treatment group, the added co-stimulatory factors enhance the inhibitory effect of neoantigens and related antigens on tumors, thus greatly improving the inhibitory effect of neoantigens and related antigens on tumors. As can be seen from the experimental data, the tumor inhibition rate obtained after adding co-stimulatory factors can reach 70.4%, which is 13.5% higher than the tumor inhibition rate of 56.9%.

[0200] The neoantigen used in this embodiment is the neoantigen mRNA-1 produced in Example 1. The RNA sequence of FSHR (SEQ ID NO: 5) is as follows:

[0201] GGGAGACAAGCUUCCUGCAGGUCGACACCGGUGGAUCCCGGGUAC

[0202] CGAGCUCGAAUUCACCAUGGCCCUGCUCCUGGUCUCUUU

[0203] GCUGGCAUUCCUGAGCUUGGGCUCAGGAUGUCAUCAUCGGAUCUG

[0204] UCACUGCUCUAACAGGGUUUUUCUCUGCCAAGAGAGCAAGG

[0205] UGACAGAGAUUCCUUCUGACCUCCCGAGGAAUGCCAUUGAACUGA

[0206] GGUUUGUCCUCACCAAGCUUCGAGUCAUCCAAAAAGGUGCA

[0207] UUUUCAGGAUUUGGGGACCUGGAGAAAAUAGAGAUCUCUCAGAA

[0208] UGAUGUCUUGGAGGUGAUAGAGGCAGAUGUGUUCUCCAACC

[0209] UUCCCAAAUUACAUGAAAUUAGAAUUGAAAAGGCCAACAACCUGC

[0210] UCUACAUCAACCCUGAGGCCUUCCAGAACCUUCCCAACCUU

[0211] CAAUAUCUGUUAAUAUCCAACACAGGUAUUAAGCACCUUCCAGAU

[0212] GUUCACAAAGAUUCAUUCUCUCCAAAAGUUUUAUCUUGACAU

[0213] UCAAGUAACACUAAAACAUCCACACAAUUGAAAGAAAUUCUUUCGU

[0214] YYYYYYYYYYYYYYYYYY

[0215] AAUGGGAUUCAAGAAAUACACACAACUGUGCAUUCAAUGGAACCCAA

[0216] CUAGAUGAGCUGAUCUAAGCGAUAAAUAUAAAUUUAAGAG

[0217] AAUUGCCUAAUGAUGUUUCCACGGAGCCUCUGGACCAGUCAUUC

[0218] UAGAUAUUUCAAGAAAGGAUCCAUUCCCCUGCCUAGCUAU

[0219] GGCUUAGAAAAUCUUAAAGAAGCUGAGGGCCAGGUCGACUUACAAC

[0220] UUAAAAAAGCUGCCUACUCUGGAAAAGCUUGUCGCCCUCAU

[0221] GGAAGCCAGCCUCACCUAUCCCAGCCCAUUGCUGUGCCUUUGCAAA

[0222] CUGGAGACGGCAAAUCUCUGAGCUUCAUCCAAUUUGCAACA

[0223] AAUCUAUUUUAAGGCAAGAAGUUGAUUAUAUAGACUCAGGCUAGGG

[0224] GGUCAGAGAUCCUCUCUGGCAGAGGACAAUGACCAGCUAC

[0225] AGCAGAGGAUUUGACAUGACGUACACUGAGUUGACUAUGACUU

[0226] AUGCAAUGAAGUGGUUGACGUGACCUGCUCCCCUAAGCCAGA

[0227] UGCAUUCAACCCAUGUGAAGAUAUCAUGGGGUACAACAUCCUCAG

[0228] AGUCCUGAUAUGGUUUAUCAGCAUCCUGGCCAUCACUGGGA

[0229] ACAUCAUAGUGCUAGUGAUCCUAACUACCAGCCAAUAUAAACUCA

[0230] CAGUCCCCAGGUUCCUUAUGUGCAACCUGGCCUUUGCUGAU

[0231] CUCUGCAUUGGAAUCUACCUGCUGCUCAUUGCAUCAGUUGAUAUC

[0232] CAUACCAAGAGCCAAUAUCACAACUAUGCCAUUGACUGGCA

[0233] AACUGGGGCAGGCUGUGAUGCUGCUGGCUUUUUCACUGUCUUUGC

[0234] CAGUGAGCUGUCAGUCUACACUCUGACAGCUAUCACCUUGG

[0235] AAAGAUGGCAUACCAUCACGCAUGCCAUGCAGCUGGACUGCAAGG

[0236] UGCAGCUCCGCCAUGCUGCCAGUGUCAUGGUGAUGGGCUGG

[0237] AUUUUUGCUUUUGCAGCUGCCCUCUUUCCCAUCUUUGGCAUCAGC

[0238] AGCUACAUGAAGGUGAGCAUCUGCCUGCCCAUGGAUAUUGA

[0239] CAGCCCUUUGUCACAGCUGUAUGUCAUGUCCCUCCUUGUGCUCAA

[0240] UGUCCUGGCCUUUGUGGUCAUCUGUGGCUGCUAUAUCCACA

[0241] UCUACCUCACAGUGCGGAACCCCAACAUCGUGUCCUCCUCUAGUG

[0242] ACACCAGGAUCGCCAAGCGCAUGGCCAUGCUCAUCUUCACUG

[0243] ACUUCCUCUGCAUGGCACCCAUUUCUUUCUUUGCCAUUUCUGCCU

[0244] CCCUCAAGGUGCCCCUCAUCACUGUGUCCAAAGCAAAGAUUC

[0245] UGCUGGUUCUGUUUCACCCCAUCAACUCCUGUGCCAACCCCUUCC

[0246] UCUAUGCCAUCUUUACCAAAAACUUUCGCAGAGAUUUCUUCA

[0247] UUCUGCUGAGCAAGUGUGGCUGCUAUGAAAUGCAAGCCCAAAUUU

[0248] AUAGGACAGAAACUUCAUCCACUGUCCACAACACCCAUCCA

[0249] AGGAAUGGCCACUGCUCUUCAGCUCCCAGAGUCACCAGUGGUUCC

[0250] ACUUACAUACUUGUCCCUCUAAGUCAUUUAGCCCAAAACUA

[0251] AUCUAGAAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUU

[0252] CCUUUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAUUAU

[0253] GAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAU

[0254] UUUCAUUGCUGCGCUAGCAGCUCGCUUUCUUGCUGUCCAAU

[0255] UUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUG

[0256] GGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUA

[0257] AUAAAAAACAUUUAUUUUCAUUGCUGCACUAGUAAAAAAAAAAAA

[0258] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0259] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0260] Example 11: In vivo efficacy of humanized drugs for breast cancer

[0261] Female NOG-dKO mice were subcutaneously injected with HLA-A*02:01MDA-MB-231 tumor-bearing cells. Five days later, in vitro-acclimated CD8+ T cells were injected intravenously and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the co-stimulatory factor-modified DC treatment group, receiving CD40L DCs. Group 3 was the WT1 treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving WT1 / neoantigen DCs. Group 6 was the combination treatment group, receiving co-stimulatory factor / WT1 / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by a 1-week observation period. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0262] The tumor inhibition rate is calculated based on the detected changes in tumor size. Figure 8 The experimental results of tumor inhibition rates in each group in Example 11 of the present invention are shown. Figure 8It is evident that the composition provided by this invention is also applicable to breast cancer, and the tumor inhibition rate of the antigen combination therapy group is 61.3%, which is significantly higher than that of the individual related antigen therapy group and the neoantigen therapy group. On the other hand, when a co-stimulatory factor is added to the antigen combination therapy group, the added co-stimulatory factor enhances the neoantigen and related antigen, thus greatly improving the inhibitory effect of the neoantigen and related antigen on the tumor. Experimental data also show that the tumor inhibition rate obtained after adding the co-stimulatory factor can reach 77.9%, which is 16.6% higher than the 61.3% tumor inhibition rate.

[0263] In this embodiment, WT1 is the mRNA prepared in Example 2 above; the co-stimulatory factor is the mRNA prepared in Example 3 above; the neoantigen mRNA-3 for breast cancer is an RNA sequence published in the database, and the specific sequence (SEQ ID NO: 6) is as follows:

[0264] UACAAACAGUCCCAGCACAUGACAGAAGUUGUACGCCAUUGCCCACAUCACGAGCGCUGCUGACAGCGAUGGC

[0265] Example 12: In vivo efficacy of humanized drugs for gastric cancer

[0266] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01HGC-27 cells. Five days later, in vitro-acclimated CD8+ T cells were injected intravenously and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the co-stimulatory factor-modified DC treatment group, receiving CD40L DCs. Group 3 was the WT1 treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving WT1 / neoantigen DCs. Group 6 was the combination treatment group, receiving co-stimulatory factor / WT1 / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by a 1-week observation period. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0267] The tumor inhibition rate is calculated based on the detected changes in tumor size. Figure 9 The experimental results of tumor inhibition rates in each group in Example 12 of the present invention are shown. Figure 9It is evident that the composition provided by this invention is also applicable to gastric cancer, and the tumor inhibition rate of the antigen combination therapy group is 58.5%, which is significantly higher than that of the individual related antigen therapy group and the neoantigen therapy group. Furthermore, when a co-stimulatory factor is added to the antigen combination therapy group, the added co-stimulatory factor enhances the effect on neoantigens and related antigens, thus improving the inhibitory effect of neoantigens and related antigens on tumors. Experimental data also show that the tumor inhibition rate obtained after adding the co-stimulatory factor can reach 63.4%, an increase of 4.9% compared to the 58.5% tumor inhibition rate. Although the increase is not very high, it still has a certain significant effect on disease treatment.

[0268] In this embodiment, WT1 is the mRNA prepared in Example 2 above; the co-stimulatory factor is the mRNA prepared in Example 3 above; the neoantigen mRNA-4 for gastric cancer is an RNA sequence published in the database, and the specific sequence (SEQ ID NO: 7) is as follows:

[0269] CACAUCGUGGAACAGAAGAACGGCAAGGAAAGAGUGCAAUCCUGUGGCACUUCCUGCAGAAAGAGGCCGAGCUG

[0270] Example 13: In vivo efficacy of humanized drugs for liver cancer

[0271] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01HepG2 cells. Five days later, in vitro-acclimated CD8+ T cells were intravenously injected and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the co-stimulatory factor-modified DC treatment group, receiving CD40L DCs. Group 3 was the WT1 treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving WT1 / neoantigen DCs. Group 6 was the combination treatment group, receiving co-stimulatory factor / WT1 / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by a 1-week observation period. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0272] The tumor inhibition rate is calculated based on the detected changes in tumor size. Figure 10 The experimental results of tumor inhibition rates in each group in Example 13 of the present invention are shown. Figure 10It is evident that the composition provided by this invention is also applicable to liver cancer, and the tumor inhibition rate of the antigen combination therapy group was 43.7%, which is significantly higher than that of the individual related antigen therapy group and the neoantigen therapy group. Similarly, experimental data also show that when a co-stimulatory factor was added to the antigen combination therapy group, the tumor inhibition rate reached 51.7%, an 8% increase compared to the 43.7% tumor inhibition rate.

[0273] In this embodiment, WT1 is the mRNA prepared in Example 2 above; the co-stimulatory factor is the mRNA prepared in Example 3 above; the hepatocellular carcinoma neoantigen mRNA-5 is an RNA sequence published in the database, and the specific sequence (SEQ ID NO: 8) is as follows:

[0274] GCUUUAGUAAAUAUAAUGAGGACCUAUACUUACGAAAUUCUACUGUGGACCACAAGCAGAGUGCUGAAGGUGCUA

[0275] Example 14: In vivo efficacy of humanized drugs for prostate cancer

[0276] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01PC-3 cells. Five days later, in vitro-acclimated CD8+ T cells were intravenously injected and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the co-stimulatory factor-modified DC treatment group, receiving CD40L DCs. Group 3 was the WT1 treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving WT1 / neoantigen DCs. Group 6 was the combination treatment group, receiving co-stimulatory factor / WT1 / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation for 1 week. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0277] The tumor inhibition rate is calculated based on the detected changes in tumor size. Figure 11 The experimental results of tumor inhibition rates in each group in Example 14 of the present invention are shown. Figure 11 It is evident that the composition provided by this invention is also applicable to prostate cancer, and the tumor inhibition rate of the antigen combination therapy group was 46.3%, which is a significant improvement (approximately 30% higher) compared to the individual related antigen therapy group and neoantigen therapy group. Furthermore, experimental data also show that when a co-stimulatory factor was added to the antigen combination therapy group, the tumor inhibition rate increased to 53.6% due to the enhanced effect of the added co-stimulatory factor on neoantigens and related antigens.

[0278] In this embodiment, WT1 is the mRNA prepared in Example 2 above; the co-stimulatory factor is the mRNA prepared in Example 3 above; the neoantigen mRNA-6 for prostate cancer is an RNA sequence published in the database, and the specific sequence (SEQ ID NO: 9) is as follows:

[0279] UCCACACCCCCGCCCGGCACCCGCGUCCGCGCCAUGACCAUCUACAAGCAGUCACAGCACAUGACGGAGGUUGUG

[0280] Example 15: In vivo efficacy of humanized lung cancer drugs

[0281] Female NOG-dKO mice were subcutaneously injected with HLA-A*02:01H1299 tumor-bearing cells. Five days later, in vitro-acclimated CD8+ T cells were intravenously injected and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the co-stimulatory factor-modified DC treatment group, receiving CD40L DCs. Group 3 was the MSLN treatment group, receiving MSLN DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving MSLN / neoantigen DCs. Group 6 was the combination treatment group, receiving co-stimulatory factor / MSLN / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation for 1 week. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0282] The tumor inhibition rate is calculated based on the detected changes in tumor size. Figure 12 The experimental results of tumor inhibition rates in each group in Example 15 of the present invention are shown. Figure 12 It is evident that the composition provided by this invention is also applicable to lung cancer, and the tumor inhibition rate of the antigen combination therapy group was 52.5%, which is significantly higher than that of the individual related antigen therapy group and the neoantigen therapy group. Furthermore, when a co-stimulatory factor was added to the antigen combination therapy group, the tumor inhibition rate increased by approximately 10%, reaching 62.8%, due to the enhanced effect of the added co-stimulatory factor on both neoantigens and related antigens. This provides valuable reference for tumor treatment.

[0283] In this embodiment, the co-stimulatory factor used was the mRNA prepared in Example 3 above; the neoantigen mRNA-7 for lung cancer was selected from the RNA sequence published in the database, and the specific sequence (SEQ ID NO: 10) is as follows:

[0284] UUCACCUUUCUCUACUGGCAUUUGGAAGACCUCAAUGUAACUACAACCCUCUUUGGGGUCUGUUCAGUCCUGAGU

[0285] In this embodiment, the relevant antigen MSLN is prepared by the preparation method used in Example 2 above. The specific MSLN RNA sequence (SEQ ID NO: 11) is as follows:

[0286] GGGAGACAAGCUUCCUGCAGGUCGACACCGGUGGAUCCCGGGUAC

[0287] CGAGCUCGAAUUCACCAUGGCCUUGCCAACGGCUCGACC

[0288] CCUGUUGGGGUCCUGUGGGACCCCCGCCCUCGGCAGCCUCCUGUU

[0289] CCUGCUCUUCAGCCUCGGAUGGGUGCAGCCCUCGAGGACCCU

[0290] GGCUGGAGAGACAGGGCAGGAGGCUGCGCCCCUGGACGGAGUCCU

[0291] GGCCAACCCACCUAACAUUUCCAGCCUCUCCCCUCGCCAACU

[0292] CCUUGGCUUCCCGUGUGCGGAGGUGUCCGGCCUGAGCACGGAGCG

[0293] UGUCCGGGAGCUGGCUGUGGCCUUGGCACAGAAGAAUGUCA

[0294] AGCUCUCAACAGAGCAGCUGCGCUGUCUGGCUCACCGGCUCUCUG

[0295] AGCCCCCCGAGGACCUGGACGCCCUCCCAUUGGACCUGCUGC

[0296] UAUUCCUCAACCCAGAUGCGUUCUCGGGGCCCCAGGCCUGCACCC

[0297] GUUUCUUCUCCCGCAUCACGAAGGCCAAUGUGGACCUGCUCC

[0298] CGAGGGGGGCUCCCGAGCGACAGCGGCUGCUGCCUGCGGCUCUGG

[0299] CCUGCUGGGGUGUGCGGGGGUCUCUGCUGAGCGAGGCUGAU

[0300] GUGCGGGCUCUGGGAGGCCUGGCUUGCGACCUGCCUGGGCGCUUU

[0301] GUGGCCGAGUCGGCCGAAGUGCUGCUACCCCGGCUGGUGAG

[0302] CUGCCCGGGACCCCUGGACCAGGACCAGCAGGAGGCAGCCAGGGC

[0303] GGCUCUGCAGGGCGGGGGACCCCCCUACGGCCCCCCGUCGAC

[0304] AUGGUCUGUCUCCACGAUGGACGCUCUGCGGGGCCUGCUGCCCGU

[0305] GCUGGGCCAGCCCAUCAUCCGCAGCAUCCCGCAGGGCAUCGU

[0306] GGCCGCGUGGCGGCAACGCUCCUCUCGGGACCCAUCCUGGCGGCA

[0307] GCCUGAACGGACCAUCCUCCGGCCGCGGUUCCGGCGGGAAGU

[0308] GGAAAAGACAGCCUGUCCUUCAGGCAAGAAGGCCCGCGAGAUAGA

[0309] CGAGAGCCUCAUCUUCUACAAGAAGUGGGAGCUGGAAGCCU

[0310] GCGUGGAUGCGGCCCUGCUGGCCACCCAGAUGGACCGCGUGAACG

[0311] CCAUCCCCUUCACCUACGAGCAGCUGGACGUCCUAAAGCAUA

[0312] AACUGGAUGAGCUCUACCCACAAGGUUACCCCGAGUCUGUGAUCC

[0313] AGCACCUGGGCUACCUCUUCCUCAAGAUGAGCCCUGAGGAC

[0314] AUUCGCAAGUGGAAUGUGACGUCCCUGGAGACCCUGAAGGCUUU

[0315] GCUUGAAGUCAACAAAGGGCACGAAAUGAGUCCUCAGGUGGC

[0316] CACCCUGAUCGACCGCUUUGUAAGGGAAGGGGCCAGCUAGACAA

[0317] AGACACCCUAGACACCCUGACCCGCCUUCUACCCUGGGUACCU

[0318] GUGCUCCCUCAGCCCCGAGGAGCUGAGCUCCGUGCCCCCCAGCAGC

[0319] AUCUGGGCGGUCAGGCCCCAGGACCUGGACACGUGUGACCC

[0320] AAGGCAGCUGGACGUCCUCUAUCCCAAGGCCCGCCUUGCUUUCCA

[0321] GAACAUGAACGGGUCCGAAUACUUCGUGAAGAUCCAUCCU

[0322] UCCUGGGUGGGGCCCCCACGGAGGAUUUGAAGGCGCUCAGUCAGC

[0323] AGAAUGAGCAUGGACUUGGCCACGUUCAUGAAGCUGCGG

[0324] ACGGAUGCGGUGCUGCCGUUGACUGUGGCUGAGGUGCAGAAAUU

[0325] CUGGGACCCACGUGGAGGCCUGAAGGCGGAGGAGCGGCA

[0326] CCGCCCGGUGGCGGGACUGGAUCCUACGGCAGCGGCAGGACGACCU

[0327] GGACACGCUGGGGCUGGGGCUACAGGGCGGCAUCCCCAACG

[0328] GCUACCUGGUCCUAGACCUCAGCAUGCAAGAGGCCCUCUCGGGGA

[0329] CGCCCUGCCUCCUAGGACCUGGACCUGUUCUCACCGUCCUGG

[0330] CACUGCUCCUAGCCUCCACCCUGGCCUAAUCUAGAAGCUCGCUUU

[0331] CUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAA

[0332] GUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUC

[0333] UGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCG

[0334] CUAGCAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCU

[0335] UUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAUUAUGA

[0336] AGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUU

[0337] UUCAUUGCUGCACUAGUAAAAAAAAAAAAAAAAAAAAAAAA

[0338] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0339] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0340] AAAAAAAAAAAA

[0341] Example 16 Humanized In Vivo Pharmacodynamics of Colon Cancer

[0342] Female NOG-dKO mice were subcutaneously injected with HLA-A*02:01CT26 tumor-bearing cells. Five days later, in vitro-acclimated CD8+ T cells were injected intravenously and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the co-stimulatory factor-modified DC treatment group, receiving CD40L DCs. Group 3 was the MSLN treatment group, receiving MSLN DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving MSLN / neoantigen DCs. Group 6 was the combination treatment group, receiving co-stimulatory factor / MSLN / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation for 1 week. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0343] The tumor inhibition rate is calculated based on the detected changes in tumor size. Figure 13 The experimental results of tumor inhibition rates in each group in Example 16 of the present invention are shown. Figure 13 It is evident that the composition provided by this invention is also applicable to colon cancer, and the tumor inhibition rate of the antigen combination therapy group is 45.9%, which is significantly improved compared to the individual related antigen therapy group and the neoantigen therapy group. On the other hand, when a co-stimulatory factor is added to the antigen combination therapy group, the added co-stimulatory factor enhances the neoantigen and related antigens, thus greatly improving the inhibitory effect of the neoantigen and related antigens on the tumor. Experimental data also show that the tumor inhibition rate increased to 58% after the addition of the co-stimulatory factor.

[0344] In this embodiment, the specific sequence of MSLN is the same as that in Example 16; the co-stimulatory factor uses the mRNA prepared in Example 3 above; the neoantigen mRNA-8 for colorectal cancer is an RNA sequence published in the database, and the specific sequence (SEQ ID NO: 12) is as follows:

[0345] GAUAGAAACACCUUCAGACAUUCAGUGGUUGUUCCAUGCGAACCGCCUGAGGUGGGAUCCGAUUGUACGACAAUU

[0346] Based on the experimental data from Examples 11-16 above, it is evident that, in terms of the size of tumor disappearance, the combination of neoantigens and tumor-associated antigens for tumor suppression exhibits superior therapeutic efficacy. Therefore, it is clear that the personalized mRNA composition provided in this application has significant effects in tumor treatment.

[0347] Furthermore, specific embodiments of the present invention further verify that the addition of co-stimulatory factors can further promote the antitumor effects of neoantigens and tumor-associated antigens. The specific details are as follows:

[0348] The neoantigens and related antigens involved in the following examples are all neoantigens and related antigens prepared directly using Examples 1 and 2, respectively.

[0349] Example 17

[0350] Step 1, Preparation of co-stimulatory factor CD27L mRNA

[0351] The preparation method in this embodiment is similar to that in Example 3, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for co-stimulatory factor CD27L mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 1200 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0352] The RNA sequence (SEQ ID NO: 13) of the co-stimulatory factor CD27L mRNA prepared in this example is as follows:

[0353]

[0354] Step 2: In vivo efficacy of humanized ovarian cancer DC vaccine (CD27L)

[0355] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were intravenously injected and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the adjuvant-modified DC treatment group, receiving CD27L DCs. Group 3 was the tumor-associated antigen treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving tumor-associated antigen / neoantigen DCs. Group 6 was the combination treatment group, receiving adjuvant / tumor-associated antigen / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0356] Figure 14 The experimental results of tumor inhibition rates in each group in Example 17 of the present invention are shown. For example... Figure 14 As shown, when the co-stimulatory factor is CD27L, it also has the effect of enhancing related antigens and neoantigens, and the tumor inhibition rate increases from 49.2% to 64.2%.

[0357] Example 18

[0358] Step 1, Preparation of co-stimulatory factor GITR mRNA

[0359] The preparation method in this embodiment is similar to that in Example 3, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for the co-stimulatory factor GITR mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 1300 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0360] The RNA sequence (SEQ ID NO: 14) of the co-stimulatory factor GITR mRNA prepared in this example is as follows:

[0361]

[0362] Step 2, In vivo efficacy of humanized ovarian cancer DC vaccine (GITR)

[0363] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were intravenously injected and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the adjuvant-modified DC treatment group, receiving GITR DCs. Group 3 was the tumor-associated antigen treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving tumor-associated antigen / neoantigen DCs. Group 6 was the combination treatment group, receiving adjuvant / tumor-associated antigen / neoantigen DCs. Drugs were administered once weekly for 5 weeks, followed by a 1-week observation period. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0364] Figure 15 The experimental results of tumor inhibition rates in each group in Example 18 of the present invention are shown. For example... Figure 15 As shown, when the co-stimulatory factor is GITR, it also has the effect of enhancing related antigens and neoantigens. After adding GITR, the tumor inhibition rate increased from 43.1% to 64.7%.

[0365] Example 19

[0366] Step 1, prepare co-stimulatory factor LFA-1 mRNA

[0367] The preparation method in this embodiment is similar to that in Example 3, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for co-stimulatory factor LFA-1 mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 3000 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0368] The RNA sequence (SEQ ID NO: 15) of the co-stimulatory factor LFA-1 mRNA prepared in this example is as follows:

[0369]

[0370] Step 2: In vivo efficacy of humanized ovarian cancer DC vaccine (LFA-1)

[0371] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were injected intravenously and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the adjuvant-modified DC treatment group, receiving LFA-1 DCs. Group 3 was the tumor-associated antigen treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving tumor-associated antigen / neoantigen DCs. Group 6 was the combination treatment group, receiving adjuvant / tumor-associated antigen / neoantigen DCs. Drugs were administered once weekly for 5 weeks, followed by a 1-week observation period. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0372] Figure 16 The experimental results of tumor inhibition rates in each group in Example 19 of the present invention are shown. For example... Figure 16 As shown, when the co-stimulatory factor is LFA-1, it also has the effect of enhancing related antigens and neoantigens. After adding LFA-1, the tumor inhibition rate increased from 55.9% to 76.0%.

[0373] Example 20

[0374] Step 1, Preparation of co-stimulatory factor ICAM-1 mRNA

[0375] The preparation method in this embodiment is similar to that in Example 3, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for co-stimulatory factor ICAM-1 mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 2100 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0376] The RNA sequence (SEQ ID NO: 16) of the co-stimulatory factor ICAM-1 mRNA prepared in this example is as follows:

[0377]

[0378] Step 2: In vivo efficacy of humanized ovarian cancer DC vaccine (ICAM-1)

[0379] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were injected intravenously and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the adjuvant-modified DC treatment group, receiving ICAM-1 DCs. Group 3 was the tumor-associated antigen treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving tumor-associated antigen / neoantigen DCs. Group 6 was the combination treatment group, receiving adjuvant / tumor-associated antigen / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0380] Figure 17 The experimental results of tumor inhibition rates in each group in Example 20 of the present invention are shown. For example... Figure 17 As shown, when the co-stimulatory factor is ICAM-1, it also has the effect of enhancing related antigens and neoantigens. After adding ICAM-1, the tumor inhibition rate increased from 53.5% to 69.4%.

[0381] Example 21

[0382] Step 1, Preparation of co-stimulatory factor IL-2 mRNA

[0383] The preparation method in this embodiment is similar to that in Example 3, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for co-stimulatory factor IL-2 mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 1000nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4ng / μg, and protein (enzyme) residue <10ng / μl.

[0384] The RNA sequence (SEQ ID NO: 17) of the co-stimulatory factor IL-2 mRNA prepared in this example is as follows:

[0385] GGGAGACAAGCUUCCUGCAGGUCGACACCGGUGGAUCCCGGGUACCGAGCUCGAAUUCCCAUGUACAGGAUGCAACUCCUGUCUUGCAUUGCACUAAGUCUUGCACUUGUCACAAACAGUGCACCUACUUCAAGUUCUACAAAGAAAACACAGCUACAACUGGAGCAUUUACUGCUGGAUUUACAGAUGAUUUUGAAUGGAAUUAAUAAUUACAAGAAUCCCAAACUCACCAGGAUGCUCACAUUUAAGUUUUACAUGCCCAAGAAGGCCACAGAACUGAAACAUCUUCAGUGUCUAGAAGAAGAACUCAAACCUCUGGAGGAAGUGCUAAAUUUAGCUCAAAGCAAAAACUUUCACUUAAGACCCAGGGACUUAAUCAGCAAUAUCAACGUAAUAGUUCUGGAACUAAAGGGAUCUGAAACAACAUUCAUGUGUGAAUAUGCUGAUGAGACAGCAACCAUUGUAGAAUUUCUGAACAGAUGGAUUACCUUUUGUCAAAGCAUCAUCUCAACACUGACUUGAUCUAGAAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCGCUAGCAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCUGCACUAGUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0386] Step 2, in vivo efficacy of humanized ovarian cancer DC vaccine (IL-2)

[0387] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were injected intravenously and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the adjuvant-modified DC treatment group, receiving IL-2 DCs. Group 3 was the tumor-associated antigen treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving tumor-associated antigen / neoantigen DCs. Group 6 was the combination treatment group, receiving adjuvant / tumor-associated antigen / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0388] Figure 18 The experimental results of tumor inhibition rates in each group in Example 21 of the present invention are shown. For example... Figure 18 As shown, when the co-stimulatory factor is IL-2, it also has the effect of enhancing related antigens and neoantigens. After adding IL-2, the tumor inhibition rate increased from 51.4% to 64.8%.

[0389] Example 22

[0390] Step 1, Preparation of co-stimulatory factor IL-7 mRNA

[0391] The preparation method in this embodiment is similar to that in Example 3, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for co-stimulatory factor IL-7 mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 1200 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0392]

[0393] Step 2: In vivo efficacy of humanized ovarian cancer DC vaccine (IL-7)

[0394] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were injected intravenously and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the adjuvant-modified DC treatment group, receiving IL-7 DCs. Group 3 was the tumor-associated antigen treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving tumor-associated antigen / neoantigen DCs. Group 6 was the combination treatment group, receiving adjuvant / tumor-associated antigen / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0395] Figure 19 The experimental results of tumor inhibition rates in each group in Example 22 of the present invention are shown. For example... Figure 19 As shown, when the co-stimulatory factor is IL-7, it also has the effect of enhancing related antigens and neoantigens. After adding IL-7, the tumor inhibition rate increased from 51.4% to 69.7%.

[0396] Example 23

[0397] Step 1, Preparation of co-stimulatory factor IL-12 mRNA

[0398] The preparation method in this embodiment is similar to that in Example 3, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for co-stimulatory factor IL-12 mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 3000 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0399] The RNA sequence (SEQ ID NO: 19) of the co-stimulatory factor IL-12 mRNA prepared in this example is as follows:

[0400]

[0401] Step 2: In vivo efficacy of humanized ovarian cancer DC vaccine (IL-12)

[0402] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were intravenously injected and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the adjuvant-modified DC treatment group, receiving IL-12 DCs. Group 3 was the tumor-associated antigen treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving tumor-associated antigen / neoantigen DCs. Group 6 was the combination treatment group, receiving adjuvant / tumor-associated antigen / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0403] Figure 20 The experimental results of tumor inhibition rates in each group in Example 23 of the present invention are shown. For example... Figure 20 As shown, when the co-stimulatory factor is IL-12, it also has the effect of enhancing related antigens and neoantigens. After adding IL-12, the tumor inhibition rate increased from 50.2% to 79.7%.

[0404] Example 24

[0405] Step 1, Preparation of co-stimulatory factor IL-15 mRNA

[0406] The preparation method in this embodiment is similar to that in Example 3, and will not be repeated here. The only difference is that the release criteria are slightly different. In this embodiment, the release criteria for co-stimulatory factor IL-15 mRNA are: a content of 1 μg / μL, purity (expressed as the ratio of OD(A260 / A280)) less than 2.0, RNA length of 1100 nt, integrity ≥90%, truncation <10%, capping efficiency ≥90%, DNA residue <4 ng / μg, and protein (enzyme) residue <10 ng / μl.

[0407] The RNA sequence (SEQ ID NO: 20) of the co-stimulatory factor IL-15 mRNA prepared in this example is as follows:

[0408] GGGAGACAAGCUUCCUGCAGGUCGACGACCGGUGGAUCCCGGGUACCGAGCUCGAAUUCACCAUGGAAUUUCCAUGGAAUUUCCAUGUGCUACUUGGUUUUACUUCUAAACAGUCUUUUUCUAAACUAGUCAUUUUCUAAUCUAGUGCAUGGCAUUCAUUCAUUUGGGCUGUUUUCAGUGCAGGCUUCCUAAAACAGAAGCCAAUGGUGAAUUAAGUGUAUUGUAUUGAAAAAUUGAAGUCUAAUUUUCAUCUAUUCUAUGCAUAUUGAUUGUACUAUUGCAAUUGCAAUUUAUAUAUAUAUACGGAAAGUGUGUUCACCCCAGUUGCAAAGUAACAGCAAUGAUGCUUUUCUCUGGAGUUACAAGUUAUUUUCACCUUGCAUGUAGCAAGUAUUCAUUCAGUAAAAUUCUGAUUCCUUCCUAGCAAACAACAGUUUGUCUUCUAAUUGGAAUAGGAAU GGAAAAAAAAUUAAAGAAUUUUUGCAGAGUUUUGUACAUAUUGUCCAAAUUUCAUCAACACUUUAAUCUAAAGCUCGCUUUCCUUGCCUUUUUUAAAAGGUUCCUUUUCCCUAAGUCCAACUAAACUGGGGGAUAUAUAUGAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAAACAUUUAUUUUCAUGCUGCGCUAGCAGCUCGCUUUCUCUGCCAA UUUAUUAAGGUUCCUUUUGUCCCUAAGUCCAACUAAACUGGGGGGAAUAUAUGAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAAACAUUUAUUUUCAUGCUGCACUAGUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0409] Step 2: In vivo efficacy of humanized ovarian cancer DC vaccine (IL-15)

[0410] Female NOG-dKO mice were subcutaneously injected with tumor-bearing HLA-A*02:01OVCAR8 cells. Five days later, in vitro-acclimated CD8+ T cells were intravenously injected and then divided into 6 groups. Group 1 was the control group, receiving the same volume of PBS at the same time. Group 2 was the adjuvant-modified DC treatment group, receiving IL-15 DCs. Group 3 was the tumor-associated antigen treatment group, receiving WT1 DCs. Group 4 was the neoantigen treatment group, receiving neoantigen DCs. Group 5 was the antigen combination treatment group, receiving tumor-associated antigen / neoantigen DCs. Group 6 was the combination treatment group, receiving adjuvant / tumor-associated antigen / neoantigen DCs. Drugs were administered once a week for 5 weeks, followed by observation. Tumor size was monitored using in vivo imaging in small animals. The specific procedures and drug dosages were the same as in Example 9 above and will not be repeated in this example.

[0411] Figure 21 The experimental results of tumor inhibition rates in each group in Example 24 of the present invention are shown. For example... Figure 21 As shown, when the co-stimulatory factor is IL-15, it also has the effect of enhancing related antigens and neoantigens. After adding IL-15, the tumor inhibition rate increased from 60.8% to 76.0%.

[0412] Based on the experimental data of Examples 17-24 above, it can be seen that in the compositions provided in the embodiments of the present invention, when a co-stimulatory factor is added to the antigen treatment group, the tumor inhibition rate is significantly improved because the added co-stimulatory factor has an enhancing effect on both neoantigens and related antigens, and the difference in the increased tumor inhibition rate is greater than the tumor inhibition rate produced when the co-stimulatory factor is used alone.

[0413] For the sake of simplicity, the method embodiments are described as a series of actions. However, those skilled in the art should understand that the present invention is not limited to the described order of actions, as some steps can be performed in other orders or simultaneously according to the present invention. Furthermore, those skilled in the art should also understand that the embodiments described in the specification are preferred embodiments, and the actions and components involved are not necessarily essential to the present invention.

[0414] The foregoing has provided a detailed description of the mRNA composition, vector, mRNA vaccine, and their applications provided by this invention. Specific examples have been used to illustrate the principles and implementation methods of this invention. The descriptions of the above embodiments are only for the purpose of helping to understand the methods and core ideas of this invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this invention. Therefore, the content of this specification should not be construed as a limitation of this invention.

Claims

1. A personalized mRNA composition, characterized in that, The mRNA composition comprises: at least one neoantigen mRNA encoding a tumor neoantigen and at least one related antigen mRNA encoding a tumor-associated antigen.

2. The mRNA composition according to claim 1, wherein the tumor-associated antigen is any one of WT1, MSLN, and FSHR.

3. The mRNA composition according to claim 1 or 2, wherein the screening of tumor neoantigens uses the patient's normal tissue sequence as a control sample, and obtains the results by sequence alignment with the patient's tumor sample; preferably, the tumor neoantigens are scored according to sorting criteria, and screened by sorting from high to low peptide scores, wherein... The sorting criteria include: transcriptome sequencing data supported by mutant sequences, TPM expression level >3, affinity <300nM, mutation frequency >0.1, and non-homologous peptides.

4. The mRNA composition according to any one of claims 1-3, wherein the mRNA composition further comprises: At least one costimulatory factor mRNA encoding a costimulatory factor.

5. The mRNA composition according to claim 4, wherein the co-stimulatory factor is any one of IL-2, IL-7, IL-12, IL-15, CD40L, CD40, CD27L, CD27, CD28, CD275, CD278, CD134, CD137, CD154, GITR, HVEM, LFA-1, CD2, CD58, ICAM-1, TNFSF4, TNFSF5, TNFSF7, TNFSF9, TNFSF14, and TNFSF18.

6. A carrier, characterized in that, The vector comprises the mRNA composition according to any one of claims 1-5.

7. The carrier according to claim 6, wherein the carrier is one or more of the following: lipids, liposomes, lipid complexes, lipid nanoparticles, polymeric nanoparticles, DC cells, B cells, simulated nanoparticles, nanotubes, or conjugates containing the mRNA composition.

8. An mRNA vaccine, characterized in that, The mRNA vaccine comprises the mRNA composition according to any one of claims 1-5, or comprises the vector according to claim 6 or 7.

9. The use of the mRNA composition of any one of claims 1-5, the vector of claim 6 or 7, or the mRNA vaccine of claim 8 in the preparation of products for tumor prevention and / or treatment.

10. The application according to claim 9, wherein the cancer is any one of breast cancer, ovarian cancer, gastric cancer, liver cancer, prostate cancer, lung cancer, and colon cancer.