Tn-MUC1 CHIMERIC ANTIGEN RECEPTOR (CAR) T CELL THERAPY

Abstract

The name of the invention is Tn-MUC1 chimeric antigen receptor (CAR) T cell therapy. Various TnMUC1 specific chimeric antigen receptors (CARs), nucleic acids encoding the same, and methods of using the same are provided. Compositions and methods are provided that include a TnMUC1-specific CAR that treats a MUC1-associated cancer in a subject in need thereof.

Description

[0001] This application is a divisional application. The original application was filed on March 26, 2020, with application number 2020800250689 (PCT / US2020 / 024825) and invention title "Tn-MUC1 chimeric antigen receptor (CAR) T-cell therapy".

[0002] Cross-references to related applications

[0003] This application claims priority to U.S. Provisional Patent Application No. 62 / 824,532, filed March 27, 2019, and U.S. Provisional Patent Application No. 62 / 881,269, filed July 31, 2019, pursuant to 35 USC §119(e), the entire contents of which are incorporated herein by reference. Technical Background

[0004] Chimeric antigen receptor (CAR) T cells are effector immune cells genetically modified to recognize specific tumor-associated antigens and subsequently kill tumor cells. While the success of CAR T therapy has led to its approval for hematologic malignancies, its effectiveness in treating solid tumors such as breast cancer remains uncertain. Several obstacles exist for CAR T therapy in solid tumors. Most importantly, most of the cell surface antigens expressed by the most identified and well-studied tumors are also expressed by normal tissues, leading to non-specific targeting (off-target activity) of CAR T cells. Second, solid tumors often possess an immunosuppressive tumor microenvironment, which can suppress CAR T cell activity once cells reach the tumor and recognize antigens. Third, the persistence of antitumor responses is highly correlated with the persistence of adoptively-transferred cells, and the optimal persistence of CAR T cells in solid tumors has not yet matched the persistence observed in hematopoietic malignancies.

[0005] Identifying tumor-specific antigens is crucial for the sustained application of CAR T-cell therapy in solid tumors. There is a need for novel compositions and methods for treating solid tumors such as breast cancer. This invention addresses this need. Summary of the Invention

[0006] Mucin 1 (MUC1) is a cell surface mucin that typically undergoes a series of glycan additions to form a highly glycosylated protein. Figure 1O-glycosylation begins with the addition of GalNAc to serine and threonine residues. Elongation begins with the addition of galactose via the core 1 synthase (composed of C1GalT1 and its molecular chaperone C1GalT1C1 (Cosmc)) or via the core 3 synthase (B3GNT6). Anomalies in this continuous glycosylation process, such as epigenetic silencing of Cosmc, result in the hypoglycosylated product Tn-MUC1, which can be converted to STn-MUC1 by adding sialic acid to (ST6GALNAC-1).

[0007] This disclosure is based on the finding that CAR T cells targeting Tn-MUC1 exhibit potent cytolytic activity against various cancer cell lines in vitro and significant tumor eradication in vivo. In one aspect, a modified immune cell or its precursor cell is provided, comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR comprises: a MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain includes a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0008] In some exemplary embodiments, the MUC1-specific antigen-binding domain is specific to the sugar epitopes of MUC1. In some exemplary embodiments, the MUC1-specific antigen-binding domain is specific to truncated sugar epitopes of MUC1.

[0009] In some exemplary embodiments, the VH domain includes the amino acid sequence described in SEQ ID NO:5. In some exemplary embodiments, the VL domain includes the amino acid sequence described in SEQ ID NO:6. In some exemplary embodiments, the VH domain includes the amino acid sequence described in SEQ ID NO:5, and the VL domain includes the amino acid sequence described in SEQ ID NO:6. In some exemplary embodiments, the MUC1-specific antigen-binding domain includes the amino acid sequence described in SEQ ID NO:4.

[0010] In some exemplary embodiments, the transmembrane domain includes a transmembrane region selected from proteins including: type I transmembrane proteins, the α, β, or ζ chains of T cell receptors, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In some exemplary embodiments, the transmembrane domain includes the CD8 transmembrane region. In some exemplary embodiments, the transmembrane domain includes the amino acid sequence described in SEQ ID NO:7.

[0011] In some exemplary embodiments, the costimulatory signaling domain includes a costimulatory domain selected from the following proteins: members of the TNFR superfamily, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD5, CD7, LIGHT, NKG2C, B7-H3, ligands that specifically bind to CD83, DAP10, DAP12, Lck, Fas, and any derivatives or variants thereof. In some exemplary embodiments, the costimulatory signaling domain is the CD2 costimulatory signaling domain. In some exemplary embodiments, the costimulatory signaling domain includes the amino acid sequence described in SEQ ID NO:28.

[0012] In some exemplary embodiments, the intracellular signal transduction domain includes a signal transduction domain selected from the following proteins: CD3ζ, FcγRIII, FcsRI, the cytoplasmic tail of the Fc receptor, the cytoplasmic receptor with an immunoreceptor tyrosine activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In some exemplary embodiments, the intracellular signal transduction domain includes the signal transduction domain of CD3ζ. In some exemplary embodiments, the intracellular signal transduction domain includes the amino acid sequence described in SEQ ID NO:30.

[0013] In some exemplary embodiments, the CAR further includes a leader sequence. In some exemplary embodiments, the leader sequence is a CD8 leader sequence. In some exemplary embodiments, the leader sequence includes the amino acid sequence described in SEQ ID NO:48.

[0014] In some exemplary embodiments, the CAR further includes a hinge domain. In some exemplary embodiments, the hinge domain is derived from a protein selected from: an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, a hinge comprising a CD8 amino acid sequence, and any combination thereof. In some exemplary embodiments, the hinge domain is a CD8 hinge domain. In some exemplary embodiments, the hinge domain includes the amino acid sequence described in SEQ ID NO: 13.

[0015] In some embodiments, the modified immune cells further include dominant negative receptors and / or switch receptors.

[0016] In some embodiments, the dominant negative receptor is a truncated variant of a wild-type protein associated with negative signaling. In one embodiment, the truncated variant of the wild-type protein associated with negative signaling includes the amino acid sequence described in SEQ ID NO:76.

[0017] In some embodiments, the switching receptor includes: a first domain, wherein the first domain is derived from a first polypeptide associated with a negative signal; and a second domain, wherein the second domain is derived from a second polypeptide associated with a positive signal. In one embodiment, the first domain includes at least a portion of the extracellular domain of the negatively associated first polypeptide, and the second domain includes at least a portion of the intracellular domain of the positively associated second polypeptide. In one embodiment, the switching receptor further includes a switching receptor transmembrane domain. In one embodiment, the switching receptor transmembrane domain includes: a transmembrane domain of the negatively associated first polypeptide; or a transmembrane domain of the positively associated second polypeptide. In one embodiment, the negatively associated first polypeptide is selected from CTLA4, PD-1, BTLA, TIM-3, and TGFβR. In one embodiment, the positively associated second polypeptide is selected from CD28, ICOS, 4-1BB, and IL-12R.

[0018] In one embodiment, the conversion receptor includes: a first domain comprising at least a portion of the extracellular domain of PD1; a transmembrane domain comprising at least a portion of the transmembrane domain of CD28; and a second domain comprising at least a portion of the intracellular domain of CD28. In one embodiment, the conversion receptor includes the amino acid sequence described in SEQ ID NO:78. In one embodiment, the conversion receptor includes: a first domain comprising at least a portion of the extracellular domain of PD1; a transmembrane domain comprising at least a portion of the transmembrane domain of PD1; and a second domain comprising at least a portion of the intracellular domain of CD28.

[0019] In one embodiment, the conversion receptor includes the amino acid sequence described in SEQ ID NO:80.

[0020] In one embodiment, the first domain includes at least a portion of the extracellular domain of PD1, wherein the extracellular domain of PD1 includes a substitution of alanine (A) with leucine (L) at amino acid position 132.

[0021] In one embodiment, the conversion receptor includes the amino acid sequence described in SEQ ID NO:82.

[0022] In one embodiment, the switching receptor includes: a first domain comprising at least a portion of the extracellular domain of PD1, the extracellular domain of PD1 comprising replacing alanine (A) with leucine (L) at amino acid position 132; and a second domain comprising at least a portion of the intracellular domain of CD28.

[0023] In one embodiment, the switching receptor includes: a first domain comprising at least a portion of the extracellular domain of PD1, the extracellular domain of PD1 comprising replacing alanine (A) with leucine (L) at amino acid position 132; and a second domain comprising at least a portion of the intracellular domain of 4-1BB.

[0024] In one embodiment, the conversion receptor includes the amino acid sequence described in SEQ ID NO:86.

[0025] In one embodiment, the switching receptor includes: a first domain comprising at least a portion of the extracellular domain of TIM-3; and a second domain comprising at least a portion of the intracellular domain of CD28.

[0026] In one embodiment, the conversion receptor includes the amino acid sequence described in SEQ ID NO:92.

[0027] In one embodiment, the switching receptor includes: a first domain comprising at least a portion of the extracellular domain of TGFβR; and a second domain comprising at least a portion of the intracellular domain of ILl2Rαl.

[0028] In one embodiment, the conversion receptor includes the amino acid sequence described in SEQ ID NO:88.

[0029] In one embodiment, the switching receptor includes: a first domain comprising at least a portion of the extracellular domain of TGFβR; and a second domain comprising at least a portion of the intracellular domain of IL12Rβ1.

[0030] In one embodiment, the conversion receptor includes the amino acid sequence described in SEQ ID NO:90.

[0031] In some exemplary embodiments, the modified cells are modified natural killer (NK) cells, modified natural killer T (NKT) cells, or modified T cells. In some exemplary embodiments, the modified immune cells are modified T cells. In some exemplary embodiments, the modified immune cells are autologous.

[0032] In another aspect, a modified T cell is provided comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR comprises: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a hinge domain; a transmembrane domain; a CD2 co-stimulatory signaling domain; and an intracellular signaling domain.

[0033] In another aspect, a modified T cell is provided comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR comprises: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a hinge domain; a transmembrane domain; a CD2 co-stimulatory signaling domain comprising an amino acid sequence described in SEQ ID NO:28; and an intracellular signaling domain.

[0034] In another aspect, a modified T cell is provided comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR comprises: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 co-stimulatory signaling domain comprising an amino acid sequence described in SEQ ID NO:28; and a CD3ζ intracellular signaling domain.

[0035] In another aspect, modified T cells are provided that include a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) including the amino acid sequence described in SEQ ID NO:2, 39, 41, 43, 45 or 47.

[0036] In another aspect, isolated nucleic acid sequences are provided that encode a chimeric antigen receptor comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0037] In some exemplary embodiments, the MUC1-specific antigen-binding domain is specific to the sugar epitopes of MUC1. In some exemplary embodiments, the MUC1-specific antigen-binding domain is specific to truncated sugar epitopes of MUC1.

[0038] In some exemplary embodiments, the VH domain includes the amino acid sequence described in SEQ ID NO:5. In some exemplary embodiments, the VL domain includes the amino acid sequence described in SEQ ID NO:6. In some exemplary embodiments, the VH domain includes the amino acid sequence described in SEQ ID NO:5, and the VL domain includes the amino acid sequence described in SEQ ID NO:6. In some exemplary embodiments, the MUC1-specific antigen-binding domain includes the amino acid sequence described in SEQ ID NO:4.

[0039] In some exemplary embodiments, the MUC1-specific antigen-binding domain is encoded by a nucleic acid sequence including the nucleotide sequence described in SEQ ID NO:3.

[0040] In some exemplary embodiments, the transmembrane domain includes a transmembrane region selected from the following proteins: type I transmembrane proteins, the α, β, or ζ chains of T cell receptors, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In some exemplary embodiments, the transmembrane domain includes the CD8 transmembrane region. In some exemplary embodiments, the transmembrane domain is encoded by a nucleic acid sequence including the nucleotide sequence described in SEQ ID NO:8.

[0041] In some exemplary embodiments, the costimulatory signaling domain includes a costimulatory domain selected from the following proteins: members of the TNFR superfamily, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD5, CD7, LIGHT, NKG2C, B7-H3, ligands that specifically bind to CD83, DAP10, DAP12, Lck, Fas, and any derivatives or variants thereof. In some exemplary embodiments, the costimulatory signaling domain is the CD2 costimulatory signaling domain. In some exemplary embodiments, the costimulatory signaling domain includes the amino acid sequence described in SEQ ID NO:28. In some exemplary embodiments, the costimulatory signaling domain is encoded by a nucleic acid sequence including the nucleotide sequence described in SEQ ID NO:29.

[0042] In some exemplary embodiments, the intracellular signal transduction domain includes the CD3ζ signal transduction domain. In some exemplary embodiments, the intracellular signal transduction domain is encoded by a nucleic acid sequence including the nucleotide sequence described in SEQ ID NO:31.

[0043] In some exemplary embodiments, the CAR further includes a CD8 leader sequence. In some exemplary embodiments, the leader sequence includes the amino acid sequence described in SEQ ID NO:48.

[0044] In some exemplary embodiments, the CAR further includes a CD8 hinge domain. In some exemplary embodiments, the hinge domain is encoded by a nucleic acid sequence comprising a nucleic acid sequence of the nucleotide sequence described in SEQ ID NO:14.

[0045] In another aspect, isolated nucleic acid sequences are provided that encode a chimeric antigen receptor comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a hinge domain; a transmembrane domain; a CD2 co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0046] In another aspect, an isolated nucleic acid sequence is provided encoding a chimeric antigen receptor comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a hinge domain; a transmembrane domain; a CD2 co-stimulatory signal transduction domain comprising a nucleic acid sequence comprising a nucleotide sequence described in SEQ ID NO:29; and an intracellular signal transduction domain.

[0047] In another aspect, isolated nucleic acid sequences are provided that encode a chimeric antigen receptor comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 co-stimulatory signal transduction domain comprising a nucleic acid sequence comprising a nucleotide sequence described in SEQ ID NO:29; and a CD3ζ intracellular signal transduction domain.

[0048] In another aspect, isolated nucleic acid sequences encoding chimeric antigen receptors are provided, comprising nucleic acid sequences containing the nucleotide sequences described in SEQ ID NO: 1, 38, 40, 42, 44, or 46.

[0049] In another aspect, an isolated nucleic acid sequence is provided that encodes an ICOS co-stimulatory signal transduction domain, which includes the nucleotide sequence described in SEQ ID NO:27.

[0050] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUC1 is provided, encoded by a nucleic acid from any of the foregoing embodiments.

[0051] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUC1 is provided, comprising: a MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0052] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUC1 is provided, comprising: a MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a hinge domain; a transmembrane domain; a CD2 co-stimulatory signal transduction domain including the amino acid sequence described in SEQ ID NO:28; and an intracellular signal transduction domain.

[0053] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUC1 is provided, comprising: a MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 co-stimulatory signal transduction domain including the amino acid sequence described in SEQ ID NO:28; and a CD3ζ intracellular signal transduction domain.

[0054] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUC1 is provided, comprising the amino acid sequence described in SEQ ID NO:47.

[0055] In another aspect, an expression construct is provided, comprising isolated nucleic acids from any of the foregoing embodiments. In some exemplary embodiments, the expression construct further comprises an EF-1α promoter. In some exemplary embodiments, the expression construct further comprises a rev response element (RRE). In some exemplary embodiments, the expression construct further comprises a marmot hepatitis virus post-transcriptional regulatory element (WPRE). In some exemplary embodiments, the expression construct further comprises a cPPT sequence. In some exemplary embodiments, the expression construct further comprises an EF-1α promoter, a rev response element (RRE), a marmot hepatitis virus post-transcriptional regulatory element (WPRE), and a cPPT sequence.

[0056] In some exemplary embodiments, the expression construct is a viral vector selected from retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated virus vectors. In some exemplary embodiments, the expression construct is a lentiviral vector. In some exemplary embodiments, the expression construct is a self-inactivating lentiviral vector.

[0057] On the other hand, a method is provided for generating modified immune cells or precursor cells of any of the foregoing embodiments, comprising introducing isolated nucleic acids of any of the foregoing embodiments, or expression constructs of any of the foregoing embodiments, into immune cells or precursor cells.

[0058] In another aspect, a method for treating MUC1-related cancer in subjects in need is provided, the method comprising administering to the subject a therapeutically effective composition comprising any of the foregoing embodiments of modified immune cells.

[0059] In some exemplary embodiments, MUC1-related cancers are selected from multiple myeloma, non-small cell lung cancer, breast cancer, pancreatic cancer, ovarian cancer, and fallopian tube cancer.

[0060] In some exemplary embodiments, MUC1-related cancer is breast cancer. In some exemplary embodiments, breast cancer is characterized by aberrant glycosylation of MUC1. In some exemplary embodiments, breast cancer is selected from hormone receptor-positive breast cancer, hormone receptor-negative breast cancer, estrogen receptor-negative breast cancer, progesterone receptor-negative breast cancer, and Her2 receptor-negative breast cancer. In some exemplary embodiments, breast cancer is metastatic breast cancer. In some exemplary embodiments, breast cancer is triple-negative breast cancer.

[0061] In another aspect, a method for treating MUC1-related cancer in a subject in need is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells, the modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0062] In another aspect, a method for treating MUC1-associated multiple myeloma in a subject in need is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells, the modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0063] In another aspect, a method for treating MUC1-associated non-small cell lung cancer in a subject of need is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells, the modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0064] In another aspect, a method for treating MUC1-associated triple-negative breast cancer in a subject of need is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells, the modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0065] In another aspect, a method for treating MUC1-associated pancreatic cancer in a subject in need is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells, the modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0066] In another aspect, a method for treating MUC1-associated ovarian and fallopian tube cancer in subjects of need is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells, the modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0067] In some exemplary embodiments, the method of any of the foregoing embodiments further includes administering lymphocyte-depleting chemotherapy to the subject. In some exemplary embodiments, lymphocyte-depleting chemotherapy includes administering a therapeutically effective amount of cyclophosphamide to the subject. In some exemplary embodiments, lymphocyte-depleting chemotherapy includes administering a therapeutically effective amount of fludarabine to the subject. In some exemplary embodiments, lymphocyte-depleting chemotherapy includes administering both a therapeutically effective amount of cyclophosphamide and a therapeutically effective amount of fludarabine to the subject.

[0068] In some exemplary embodiments, the method of any of the foregoing embodiments further includes administering a cytokine release syndrome (CRS) management protocol to the subject. In some exemplary embodiments, the CRS management protocol includes a therapeutically effective amount of tocilizumab. In some exemplary embodiments, the CRS management protocol includes a therapeutically effective amount of tocilizumab and / or a corticosteroid.

[0069] In some exemplary embodiments, the modified immune cells or modified T cells are autologous.

[0070] In some exemplary embodiments, the modified immune cells or modified T cells are administered via intratumoral delivery. In some exemplary embodiments, the modified immune cells or modified T cells are administered via intravenous delivery. In some exemplary embodiments, the modified immune cells or modified T cells are administered via intraperitoneal delivery.

[0071] The modified immune cells or their precursor cells of any of the foregoing embodiments are used in the methods of any of the foregoing embodiments. The isolated nucleic acid sequences of any of the foregoing embodiments are used in the methods of any of the foregoing embodiments. The chimeric antigen receptors of any of the foregoing embodiments are used in the methods of any of the foregoing embodiments. The expression vectors of any of the foregoing embodiments are used in the methods of any of the foregoing embodiments. Attached Figure Description

[0072] The following detailed description of specific embodiments of the invention will be better understood when read in conjunction with the accompanying drawings. Exemplary embodiments are illustrated in the drawings to illustrate the invention. However, it should be understood that the invention is not limited to the precise arrangement and means of the embodiments shown in the drawings.

[0073] Figure 1 This is a schematic diagram illustrating the initiation of O-glycan biosynthesis, highlighting the core glycan and associated glycosyltransferases.

[0074] Figure 2A and 2B This is a set of charts illustrating the gene expression analysis of MUC1 and glycosylation enzymes by qPCR. Gene expression was measured in four breast cancer cell lines (BT-20, MCF7, MDA-MB-231, and MDA-MB-453) and compared with gene expression in the non-tumorigenic breast epithelial cell line MCF10A.

[0075] Figure 3A and 3BThis is a set of images depicting the expression of Tn-MUC1 in breast cancer tissue as assessed by immunohistochemistry using anti-5E5 antibody. Figure 3A The diagram illustrates 3+ staining in breast cancer tissue, without staining of the surrounding stroma. Figure 3B The diagram illustrates 2+ staining in breast cancer tissue, without staining of the surrounding stroma.

[0076] Figure 4 This is a series of charts illustrating the cytotoxicity assays using anti-Tn-MUC1 CAR T cells and four breast cancer cell lines. 5E5-CAR, CD19-specific CAR, or NTD T cells were co-cultured with breast cancer cell lines at an effector:target ratio of 10:1. Cell lysis was measured every 15 minutes via real-time impedance measurement within 100 hours of T cell addition.

[0077] Figures 5A-5C It is a series of charts and images illustrating the discovery that intraperitoneal and intratumoral delivery of 5E5-CAR T cells enhances antitumor efficacy.

[0078] Figure 6A and 6B It is a series of charts and images that illustrate the finding that intraperitoneal delivery of mouse HMFG1-CAR T cells in human MUC1 transgenic mice leads to off-target toxicity not observed in mouse 5E5-CAR T cells.

[0079] Figures 7A-7C It is a series of charts that illustrate the gene expression of MUC1, ST6GALNAC1, B3GNT6, C1GALT1, and C1GALT1C1 in 50 breast cancer samples derived from patients, compared to the average gene expression in 10 matched normal breast tissue samples derived from patients.

[0080] Figure 8 This is a set of flow cytometry graphs showing the expression of various TnMUC1 CAR transgenes.

[0081] Figure 9 The results of the CFSE assay are shown, which demonstrate the multivariate TnMUC1 CAR-T cell response to MCF7 cell proliferation.

[0082] Figure 10 It is a set of three charts, which, from left to right, show the secretion levels of IL-2, TNFα, and IFNg in various TnMUC1 CAR-T cells.

[0083] Figure 11 This is a graph showing the total photon flux per second measured over time in mice after intravenous administration of the various TnMUC1 CAR-T cells shown.

[0084] Figure 12A and 12B This is a graph showing the levels of various TnMUC1CAR-T cells measured in the peripheral blood of infused mice on day 42 post-infusion.

[0085] Figure 13 This is a graph demonstrating the cytotoxicity of CART-TnMUC1, CART-TnMUC1-BBz, and negative control cells (CART-19 and NTD) on the Hs766T pancreatic cancer cell line.

[0086] Figures 14A-14C It is a series of charts that show the targeted cell killing of CART-TnMUC1 cells in various cell lines.

[0087] Figure 15A and 15B It is a series of charts showing the targeted cell killing of CART-TnMUC1 cells in response to the Tn antigen in various cell lines shown.

[0088] Figure 16 A series of bioluminescent images depicting tumor burden in a mouse model of pancreatic cancer are shown.

[0089] Figures 17A-17C It is a series of figures and images showing the proliferation of CART-TnMUC1 cells in response to antigen-expressing target cells.

[0090] Figure 18 It is a series of charts that show the production of cytokines and chemokines in various cell lines.

[0091] Figure 19 This is a graph showing the data obtained from the IFNγELISA experiment.

[0092] Figure 20 It is a series of graphs showing the quantification of various T cells in the peripheral blood of mice on days 21 and 42 after T cell infusion.

[0093] Figure 21 Micrographs of Jurkat CBG / GFPCD19-P2A-Cosmc cells (left) and MCF-7 cells (right) stained with anti-TnMUC1 antibody.

[0094] Figure 22 This is a schematic diagram showing the experimental setup used to test the reproducibility of TnMUC1 CTA assays.

[0095] Figure 23 This is a schematic diagram of the plasmid map of pTRPE_5E5(H2L)_CD2z.

[0096] Figure 24 This is a schematic diagram of the plasmid map of pGEM-SS1-CD2z.

[0097] Figure 25 This is a schematic diagram of the pTRPE_5E5-BBz plasmid.

[0098] Figure 26 This is a schematic diagram showing the pTRPE_5E5(H2L) carrier skeleton.

[0099] Figure 27 This is a schematic diagram showing the study design for the Phase 1 and Phase 1a portions of the clinical trial.

[0100] Figure 28 This is a schematic diagram showing the overall patient pathway in a clinical trial.

[0101] Figure 29 This is a schematic diagram showing the dose escalation protocol in a clinical trial.

[0102] Figure 30 This is a schematic diagram showing the dose escalation groups in clinical trials.

[0103] Figure 31 It is a series of graphs showing the total number of T cells transduced from 5 different normal healthy donors as illustrated by CAR.

[0104] Figure 32 It is a series of graphs showing the doubling of T cell populations from 5 different normal healthy donors transduced with CAR, as shown.

[0105] Figure 33 It is a series of graphs showing the average cell volume of T cells transduced from four different normal healthy donors using the CAR shown.

[0106] Figure 34 This is a set of flow cytometry graphs showing CAR expression in T cells from five different normal healthy donors. Detailed Implementation

[0107] definition

[0108] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may be used in the practice of testing the invention, preferred materials and methods are described herein. The following terminology will be used in describing and claiming protection for this invention.

[0109] It should also be understood that the terminology used herein is for the purpose of describing particular implementations only and is not intended to be limiting.

[0110] The articles “a” and “a kind” used in this article refer to one or more of the grammatical objects (i.e., at least one). For example, “a component” means one or more components.

[0111] As used herein, “approximately” when referring to a measurable value such as a quantity, a period of time, etc., means a change of ±20% or ±10% from a given value, more preferably ±5%, even more preferably ±1%, and even more preferably ±0.1%, provided that such change is suitable for implementing the disclosed method.

[0112] "Activation," as used herein, refers to the state of T cells that have been adequately stimulated to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term "activated T cell," etc., refers to T cells that have undergone cell division.

[0113] As used in this article, the term “alleviate” disease refers to reducing the severity of one or more symptoms of the disease.

[0114] "Allogeneic" refers to any substance that originates from different animals of the same species.

[0115] The term "antibody," as used herein, refers to an immunoglobulin molecule that specifically binds to an antigen. Antibodies can be complete immunoglobulins derived from natural or recombinant sources and can be the immunoreactive portion of a complete immunoglobulin. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies of this invention can exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab, and F(ab)2, as well as single-chain antibodies (scFv) and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85: 5879-5883; Bird et al., 1988, Science 242: 423-426).

[0116] The term "antibody fragment" refers to a portion of a complete antibody and specifically to the antigenic determination variable region of the complete antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies formed from antibody fragments, scFv antibodies, and multispecific antibodies.

[0117] "Antibody heavy chain," as used in this article, refers to the larger chain of the two types of polypeptide chains that exist in all antibody molecules in their naturally occurring conformation.

[0118] "Antibody light chain," as used herein, refers to the smaller chain in the two types of polypeptide chains that exist in all antibody molecules in their naturally occurring conformation. α and β light chains refer to the two main isotypes of antibody light chains.

[0119] As used herein, the term "synthetic antibody" refers to an antibody produced using recombinant DNA technology, such as, for example, an antibody expressed by a phage as described herein. The term should also be interpreted as an antibody that has been synthesized from a DNA molecule encoding an antibody, and that the DNA molecule expresses an antibody protein or specifies the amino acid sequence of an antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence techniques available in the art and widely known.

[0120] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response may involve antibody production, or activation of specific immune-competent cells, or both. Those skilled in the art will understand that any macromolecule—indeed, all proteins or peptides—can be used as an antigen. Furthermore, antigens may be derived from recombinant or genomic DNA. Those skilled in the art will understand that any DNA—which includes nucleotide sequences or partial nucleotide sequences encoding proteins that elicit an immune response—and therefore encodes the term "antigen" as used herein. Furthermore, those skilled in the art will understand that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It will be readily apparent that the invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in different combinations to elicit a desired immune response. Moreover, those skilled in the art will understand that an antigen need not be encoded by a "gene" at all. It will be readily apparent that antigens can be generated, synthesized, or derived from biological samples. Such biological samples may include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.

[0121] As used in this article, the term "self" refers to any substance that originates from the same individual and is subsequently reintroduced into that individual.

[0122] As used herein, the term "chimeric antigen receptor" or "CAR" refers to an artificial T-cell receptor engineered to be expressed on immune effector cells and to bind specifically to an antigen. CARs can be used as adoptive cell transfer therapy. T cells are removed from a patient and modified to express a receptor specific to a particular form of the antigen. In some embodiments, the CAR is specific to a selected target. CARs may also include an intracellular activation domain, a transmembrane domain, and an extracellular domain, the extracellular domain including an antigen-binding region.

[0123] The term "cleavage" refers to the breaking of covalent bonds (e.g., in the backbone of a nucleic acid molecule) or the hydrolysis of peptide bonds. Cleavage can be initiated by a variety of methods, including but not limited to the enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-strand and double-strand cleavage are possible. Double-strand cleavage can occur as a result of two distinct single-strand cleavage events. DNA cleavage can result in blunt ends or staggered ends. In some embodiments, fusion peptides can be used to target the cleavage of double-stranded DNA.

[0124] As used herein, the term "conserved sequence modification" is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of an antibody containing an amino acid sequence. Such conserved modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies of the present invention using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conserved amino acid substitution is a substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids having basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, one or more amino acid residues in the CDR region of an antibody can be replaced by other amino acid residues from the same side chain family, and the ability of the altered antibody to bind antigens can be tested using the functional assay methods described herein.

[0125] As used herein, the term "co-stimulatory ligand" includes molecules on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to cognate co-stimulatory molecules on T cells. This provides signals mediating T cell responses, including but not limited to proliferation, activation, and differentiation, in addition to the primary signaling provided, for example, by binding the TCR / CD3 complex to a peptide-loaded MHC molecule. Co-stimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin β receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies binding to Toll ligand receptors, and ligands that specifically bind to B7-H3. Costimulatory ligands also include, in particular, antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0126] "Co-stimulatory molecules" refer to associated binding partners on T cells that specifically bind to co-stimulatory ligands, thereby mediating co-stimulatory responses in T cells, such as, but not limited to, proliferation. Co-stimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors.

[0127] As used in this article, “co-stimulatory signal” refers to a signal that binds to primary signals (such as TCR / CD3 linkage) and leads to the upregulation or downregulation of T cell proliferation and / or key molecules.

[0128] "Disease" is a state of health in animals in which they are unable to maintain homeostasis, and in which, if the disease is not treated, the animal's health continues to deteriorate. In contrast, "disorder" in animals is a state of health in which the animal is able to maintain homeostasis, but in which the animal's health is less favorable than it would be without the disorder. Without treatment, disorder does not necessarily lead to a further decline in the animal's health.

[0129] "Donor antigen" refers to an antigen expressed by donor tissue that is to be transplanted into the recipient body.

[0130] "Receptor antigen" refers to the target of an immune response to a donor antigen.

[0131] As used in this article, the term "downregulation" refers to reducing or eliminating the expression of one or more genes.

[0132] The terms "effective amount" or "therapeutic effective amount" are used interchangeably herein and refer to the ability of a compound, formulation, material, or composition as described herein to effectively achieve a specific biological outcome or provide a therapeutic or preventative benefit. Such outcomes may include, but are not limited to, an amount of the composition, when administered to a mammal, causing a detectable level of immunosuppression or immune tolerance compared to an immune response detected in the absence of the compositions of the present invention. Immune responses can be readily assessed using many methods recognized in the art. Those skilled in the art will understand that variations in the amount of the compositions administered herein can be readily determined based on many factors, such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, and the specific compound being administered.

[0133] "Encoding" refers to the inherent property of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA, or mRNA) as a template for the synthesis of other polymers and macromolecules having defined nucleotide sequences (e.g., rRNA, tRNA, and mRNA) or defined amino acid sequences in biological processes, and the resulting biological properties. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, then the gene encodes that protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually provided in the sequence listing) and the non-coding strand (which serves as a template for the transcription of a gene or cDNA) can be referred to as encoding a protein or other product of that gene or cDNA.

[0134] As used in this article, "endogenous" means any substance that originates from or is produced within an organism, cell, tissue, or system.

[0135] As used herein, the term "epitope" is defined as a small chemical molecule on an antigen that can elicit an immune response, inducing a B and / or T cell response. An antigen may have one or more epitopes. Most antigens have multiple epitopes; that is, they are multivalent. Typically, an epitope is about 10 amino acids and / or sugars in size. In some exemplary embodiments, an epitope is about 4 to 18 amino acids, about 5 to 16 amino acids, about 6 to 14 amino acids, about 7 to 12 amino acids, or about 8 to 10 amino acids. Those skilled in the art will understand that, in general, the overall three-dimensional structure of the molecule, rather than its specific linear sequence, is the primary criterion for antigen specificity, and thus distinguishes different epitopes. Based on this disclosure, the peptides used in the present invention can be epitopes.

[0136] As used herein, the term “exogenous” refers to any substance introduced from or produced outside of an organism, cell, tissue, or system.

[0137] As used herein, the term "expansion" refers to an increase in quantity, such as an increase in the number of T cells. In one embodiment, the number of T cells expanded in vitro is increased relative to their initial quantity in the culture medium. In another embodiment, the number of T cells expanded in vitro is increased relative to other cell types in the culture medium. As used herein, the term "ex vivo" refers to cells that have been removed from a living organism (such as a human) and multiplied outside the organism (e.g., in a petri dish, test tube, or bioreactor).

[0138] As used herein, the term “expression” is defined as the transcription and / or translation of a specific nucleotide sequence driven by its promoter.

[0139] "Expression vector" refers to a vector comprising a recombinant polynucleotide including an expression control sequence operatively linked to a nucleotide sequence to be expressed. The expression vector includes sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as clomiphene citrates, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus, and adeno-associated virus) incorporating the recombinant polynucleotide.

[0140] As used herein, “homology” refers to the identity of subunit sequences between two polymer molecules, such as two nucleic acid molecules, two DNA molecules, two RNA molecules, or two polypeptide molecules. When a subunit position in two molecules is occupied by the same monomeric subunit; for example, if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. Homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half the positions in two sequences (e.g., five positions in a polymer of ten subunits) are homologous, then the two sequences are 50% homologous; if 90% of the positions (e.g., nine out of ten) are matching or homologous, then the two sequences are 90% homologous.

[0141] Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2, or other antigen-binding sequence of the antibody) containing minimal sequences derived from non-human immunoglobulins. In most cases, humanized antibodies are human immunoglobulins (receptor antibodies) where residues from the receptor's complementarity-determining region (CDR) are replaced by residues from a non-human species (e.g., mouse, rat, or rabbit) (donor antibody) with the desired specificity, affinity, and ability. In some cases, Fv frame region (FR) residues of human immunoglobulins are replaced by corresponding non-human residues. Furthermore, humanized antibodies may include residues not found in the receptor antibody or in the introduced CDR or frame sequence. These modifications can further improve and optimize antibody performance. Typically, humanized antibodies will include substantially all of the following: at least one and typically two variable domains, wherein all or substantially all CDR regions correspond to those CDR regions of non-human immunoglobulins, and all or substantially all FR regions are those of human immunoglobulin sequences. Humanized antibodies will also preferably include at least a portion of the immunoglobulin constant region (Fc), typically at least a portion of the human immunoglobulin constant region. For further details, see Jones et al., Nature, 321:522-525, 1986; Reichmann et al., Nature, 332:323-329, 1988; Presta, Curr. Op. Struct. Biol., 2:593-596, 1992.

[0142] "Complete human" refers to immunoglobulins such as antibodies, in which the entire molecule is of human origin or consists of an amino acid sequence identical to that of the human form of the antibody.

[0143] As used herein, the term "identity" refers to the subunit sequence identity between two polymer molecules, particularly between two amino acid molecules, such as two polypeptide molecules. Two amino acid sequences are identical when they have the same residues at the same positions, e.g., if each position in two polypeptide molecules is occupied by arginine. The identity or degree of identical residues at the same alignment positions of two amino acid sequences is usually expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matched or identical positions; for example, if half the positions in two sequences (e.g., 5 positions in a polymer of 10 amino acids) are identical, the identity of the two sequences is 50%; if 90% of the positions (e.g., 9 out of 10) are matched or identical, the identity of the two amino acid sequences is 90%.

[0144] As used herein, the term "immunoglobulin" or "Ig" is defined as a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes referred to as BCRs (B cell receptors) or antigen receptors. Five members of this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is a primary antibody found in bodily secretions such as saliva, tears, breast milk, gastrointestinal secretions, and mucus secretions from the respiratory and genitourinary tracts. IgG is the most common circulating antibody. IgM is the major immunoglobulin produced in the primary immune response in most subjects. It is the most effective immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in the fight against bacteria and viruses. IgD is an immunoglobulin that does not have a known antibody function but can act as an antigen receptor. IgE is an immunoglobulin that mediates immediate anaphylaxis after exposure to an allergen by inducing the release of mediators from mast cells and basophils.

[0145] As used herein, the term “immune response” is defined as a cellular response to an antigen that occurs when lymphocytes identify an antigenic molecule as a foreign substance and induce antibody formation and / or activate lymphocytes to remove the antigen.

[0146] As used in this article, the term "immune stimulation" refers to an increase in the overall immune response.

[0147] As used in this article, the term "immunosuppression" refers to a reduction in the overall immune response.

[0148] As used herein, “illustrating material” includes publications, recordings, diagrams, or any other medium of expression that can be used to convey the usefulness of the compositions and methods of the present invention. The illustrating material for the kits of the present invention may, for example, be affixed to a container containing the nucleic acids, peptides, and / or compositions of the present invention, or be shipped together with a container containing the nucleic acids, peptides, and / or compositions. Optionally, the illustrating material may be shipped separately from the container, with the aim of allowing the illustrating material and the compounds to be used collaboratively by the recipient.

[0149] The term "isolated" means altered or removed from its natural state. For example, nucleic acids or peptides naturally present in living animals are not "isolated," but the same nucleic acids or peptides that are partially or completely separated from their natural coexisting material are "isolated." Isolated nucleic acids or proteins can exist in a substantially purified form or can exist in non-natural environments (such as, for example, host cells).

[0150] As used in this article, the term "knockdown" refers to a reduction in the expression of one or more genes.

[0151] As used in this article, the term "knockout" refers to the elimination of gene expression of one or more genes.

[0152] As used in this article, "lentivirus" refers to the genus *Lentinvirus* within the family Retroviridae. Lentivirals are the only retroviruses capable of infecting non-dividing cells; they deliver significant amounts of genetic information into the host cell's DNA, making them one of the most efficient gene delivery vectors. HIV, S1V, and FIV are examples of lentiviruses. Lentiviral vectors provide tools for achieving significant levels of gene transfer in vivo.

[0153] As used herein, the term "limited toxicity" means that the peptides, polynucleotides, cells and / or antibodies of the present invention exhibit substantially no negative biological effects, antitumor effects or substantially no negative physiological symptoms on healthy cells, non-tumor cells, non-disease cells, non-target cells or such cell populations in vitro or in vivo.

[0154] As used herein, the term "modified" refers to an alteration in the molecular or cellular state or structure of the present invention. Molecules can be modified in a variety of ways, including chemically, structurally, and functionally. Cells can be modified by introducing nucleic acids.

[0155] As used herein, the term “modulation” refers to a detectable increase or decrease in response levels in a subject compared to response levels in a subject without treatment or a compound, and / or compared to response levels in a subject otherwise treated in the same manner but without treatment. This term includes perturbing and / or influencing natural signals or responses, thereby mediating a beneficial therapeutic response in a subject (e.g., a human).

[0156] In the context of this invention, the following abbreviations are used for commonly occurring nucleic acid bases. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.

[0157] Unless otherwise specified, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. A nucleotide sequence encoding a protein or RNA phrase may also include introns to the extent that the nucleotide sequence encoding that protein may include one or more introns in some versions.

[0158] "Parenteral" administration of immunogenic compositions includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection, or infusion techniques.

[0159] As used herein, the term "polynucleotide" is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Therefore, the terms nucleic acid and polynucleotide are used interchangeably herein. Those skilled in the art will generally understand that nucleic acids are polynucleotides, which can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by any means available in the art and by synthetic means, including but not limited to recombinant means, i.e., using common cloning techniques and PCR. TM Cloning from recombinant libraries or cell genome nucleic acid sequences.

[0160] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. Polypeptides include any peptide or protein comprising two or more amino acids linked together by peptide bonds. As used herein, the term refers to short chains, such as those commonly referred to in the art as peptides, oligopeptides, and oligomers, and also to longer chains, which are commonly referred to in the art as proteins, of which there are many types. “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0161] As used herein, the term "autoantigen" is defined as an antigen expressed by a host cell or tissue. An autoantigen may be a tumor antigen, but in some embodiments, it is expressed in both normal and tumor cells. Those skilled in the art will readily understand that autoantigens can be overexpressed in cells.

[0162] As used herein, the term "specific binding" for antibodies refers to an antibody that recognizes a specific antigen but substantially does not recognize or bind to other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to antigens from one or more species. However, this cross-species reactivity itself does not change the antibody's specific class. In another instance, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, this cross-reactivity itself does not change the antibody's specific class. In some instances, the terms "specific binding" or "specifically binding" may be used in reference to the interaction of an antibody, protein, or peptide with a second chemical species, indicating that the interaction depends on the presence of a specific structure on the chemical species (e.g., an antigenic determinant or epitope); for example, an antibody recognizes and binds to a specific protein structure rather than generally recognizing and binding to proteins. If an antibody is specific for epitope "A," the presence of molecules including epitope A (or free, unlabeled A) in a reaction involving labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.

[0163] The term "stimulus" refers to a primary response induced by a signal transduction event (such as, but not limited to, signal transduction via the TCR / CD3 complex) that mediates the binding of a stimulating molecule (e.g., the TCR / CD3 complex) to its associated ligand. Stimuli can mediate altered expression of certain molecules, such as downregulation of TGF-β and / or reorganization of the cytoskeleton.

[0164] "Stimulating molecules," as used in this article, refer to molecules on T cells that specifically bind to associated stimulating ligands present on antigen-presenting cells.

[0165] As used herein, “stimulatory ligand” refers to a ligand that, when present on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.), specifically binds to associated binding partners (referred to herein as “stimulatory molecules”) on T cells, thereby mediating primary T cell responses, including but not limited to activation, initiation of an immune response, and proliferation. Stimulatory ligands are well known in the art and include, in particular, MHC class I molecules loaded with peptides, anti-CD3 antibodies, hyperagonist anti-CD28 antibodies, and hyperagonist anti-CD2 antibodies.

[0166] The term "subject" is intended to include any living organism (e.g., a mammal) in which an immune response may be elicited. As used herein, a "subject" or "patient" can be a human or a non-human mammal. Non-human mammals include, for example, livestock and pets, such as sheep, cattle, pigs, canines, felines, and rodents. In an exemplary embodiment, the subject is a human.

[0167] As used herein, “substantially purified” cells are cells that are substantially free of other cell types. Substantially purified cells also refer to cells that have been isolated from other cell types naturally associated with them in their natural state. In some cases, a substantially purified cell population refers to a homologous group of cells. In other cases, the term refers only to cells that have been isolated from cells naturally associated with them in their natural state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

[0168] "Target site" or "target sequence" refers to a portion of the genomic nucleic acid sequence that is limited to a portion of the nucleic acid that will specifically bind to a binding molecule under conditions sufficient to cause binding.

[0169] As used herein, the term "T cell receptor" or "TCR" refers to a membrane protein complex involved in the activation of T cells in response to antigen presentation. The TCR is responsible for recognizing antigens that bind to the major histocompatibility complex molecule. The TCR consists of heterodimers of α (alpha) and β (beta) chains, although in some cells it consists of γ and δ (γ / δ) chains. The TCR may exist in both α / β and γ / δ forms, which are structurally similar but have different anatomical locations and functions. Each chain consists of two extracellular domains: a variable domain and a constant domain. In some embodiments, the TCR can be modified on any cell containing the TCR, including, for example, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, and γδ T cells.

[0170] As used herein, the term "therapeutic" refers to treatment and / or prevention. Therapeutic effects are achieved through the suppression, mitigation, or eradication of the disease state.

[0171] As used herein, the terms “transfected,” “transformed,” or “transduced” refer to the process of transferring or introducing exogenous nucleic acids into host cells. “Transfected,” “transformed,” or “transduced” cells are cells that have been transfected, transformed, or transduced with exogenous nucleic acids. Cells include primary subject cells and their progeny.

[0172] As used herein, the term “treatment” means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.

[0173] A “vector” is a composition of matter comprising isolated nucleic acids and capable of delivering those isolated nucleic acids into cells. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term “vector” includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include, but are not limited to, Sendai virus vectors, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.

[0174] "Heterogeneous" refers to any substance derived from animals of different species.

[0175] Scope: Throughout this disclosure, various aspects of the invention may be presented in the form of scope. It should be understood that the scope description is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Therefore, the scope description should be considered as specifically disclosing all possible sub-scopes as well as a single numerical value within said scope. For example, a scope description from 1 to 6 should be considered as having specifically disclosed sub-scopes such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and a single number within said scope, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the size of the scope.

[0176] illustrate

[0177] This invention provides a MUC1-specific chimeric antigen receptor (CAR; for example, a Tn-MUC1 CAR) and modified cells containing the receptor. It also provides compositions and methods for treating cancer using a MUC1-specific CAR. Specifically, the Tn-MUC1 CAR of this invention is applicable to the treatment of both liquid tumors (e.g., multiple myeloma) and solid tumors (e.g., breast cancer, non-small cell lung cancer, ovarian and fallopian tube cancer, pancreatic cancer, etc.).

[0178] This paper demonstrates that Tn-MUC1 is a compelling tumor-specific antigen in a variety of cancers for adoptive immunotherapy against antibodies. CAR T cells targeting Tn-MUC1 exhibit potent cytolytic activity against cancer cell lines in vitro and significant tumor eradication in vivo. While strategies targeting MUC1 outside the tumor-specific glycosylation background can exhibit off-target toxicity, CAR T cells targeting Tn-MUC1 overcome this potential toxicity and prolong the therapeutic window for solid tumors such as breast cancer.

[0179] Chimeric antigen receptor (CAR)

[0180] This invention provides compositions and methods for use with modified immune cells or their precursor cells (e.g., modified T cells), comprising a chimeric antigen receptor (CAR) having affinity for MUC1 or a glycosylated form of MUC1 (e.g., Tn-MUC1). The subject CAR of this invention comprises an antigen-binding domain (e.g., a Tn-MUC1-binding domain), a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain. The subject CAR of this invention may optionally include a hinge domain. Therefore, the subject CAR of this invention comprises an antigen-binding domain (e.g., a Tn-MUC1-binding domain), a hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain. In some embodiments, each domain of the subject CAR is separated by a linker.

[0181] The antigen-binding domain can be operatively linked to another domain of the CAR, such as a transmembrane domain, a co-stimulatory signaling domain, or an intracellular signaling domain (each described elsewhere herein), for expression in the cell. In one embodiment, a first nucleic acid sequence encoding the antigen-binding domain is operatively linked to a second nucleic acid sequence encoding the transmembrane domain, and further operatively linked to a third nucleic acid sequence encoding the structure of the co-stimulatory signaling domain.

[0182] The antigen-binding domain described herein can be combined with any transmembrane domain, any co-stimulatory signal transduction domain, any intracellular signal transduction domain, or any other domain described herein that may be included in the CAR of the present invention.

[0183] In one aspect, the present invention includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, comprising: a MUC1-specific antigen-binding domain, an optional hinge domain, a transmembrane domain, a co-stimulatory signal transduction domain, and an intracellular signal transduction domain.

[0184] In one aspect, the present invention includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, comprising: a TnMUC1-specific antigen-binding domain, an optional hinge domain, a transmembrane domain, a co-stimulatory signal transduction domain, and an intracellular signal transduction domain.

[0185] In one exemplary embodiment, the present invention includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, comprising: a MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 co-stimulatory signal transduction domain; and a CD3ζ intracellular signal transduction domain.

[0186] In one exemplary embodiment, the present invention includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, comprising: a MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; a 4-1BB co-stimulatory signal transduction domain; and a CD3ζ intracellular signal transduction domain.

[0187] In one exemplary embodiment, the present invention includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, comprising: a MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; an ICOS co-stimulatory signal transduction domain; and a CD3ζ intracellular signal transduction domain.

[0188] In some embodiments, the genetically modified immune cells (e.g., T cells) or their precursor cells of the present invention comprise a chimeric antigen receptor (CAR) with affinity for MUC1. In some embodiments, the genetically modified immune cells (e.g., T cells) or their precursor cells of the present invention comprise a chimeric antigen receptor (CAR) with affinity for Tn-MUC1.

[0189] In some embodiments, the genetically modified cells are T cells. In some embodiments, the genetically modified cells are natural killer (NK) cells. In some embodiments, the genetically modified cells are NKT cells.

[0190] Therefore, in one exemplary embodiment, this document provides a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: a MUC1-specific antigen-binding domain, an optional hinge domain, a transmembrane domain, a co-stimulatory signal transduction domain, and an intracellular signal transduction domain.

[0191] Therefore, in one exemplary embodiment, this document provides a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: a TnMUC1-specific antigen-binding domain, an optional hinge domain, a transmembrane domain, a co-stimulatory signal transduction domain, and an intracellular signal transduction domain.

[0192] Therefore, in one exemplary embodiment, the present invention provides a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: an MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 co-stimulatory signal transduction domain; and a CD3ζ intracellular signal transduction domain.

[0193] Therefore, in one exemplary embodiment, the present invention provides a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: an MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; a 4-1BB co-stimulatory signal transduction domain; and a CD3ζ intracellular signal transduction domain.

[0194] Therefore, in one exemplary embodiment, the present invention provides a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: an MUC1-specific antigen-binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; a CD8 hinge domain; a CD8 transmembrane domain; an ICOS co-stimulatory signal transduction domain; and a CD3ζ intracellular signal transduction domain.

[0195] In some embodiments of the present invention, the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NO:1, 38, 40, 42, 44, or 46. In some embodiments of the present invention, the CAR comprises the amino acid sequence of SEQ ID NO:2, 39, 41, 43, 45, or 47.

[0196] The sequences of individual domains and CARs are shown in Table 1.

[0197] Table 1

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216] Therefore, the subject CAR can be a CAR with affinity for Tn-MUC1, comprising a Tn-MUC1 binding domain comprising the amino acid sequences described in SEQ ID NO:4, 5, 6 and / or 19-24. The subject Tn-MUC1 CAR may further comprise a leader sequence comprising the amino acid sequence described in SEQ ID NO:48. The subject Tn-MUC1 CAR may further comprise a hinge domain comprising the amino acid sequence described in SEQ ID NO:13. The subject Tn-MUC1 CAR may further comprise a transmembrane domain comprising the amino acid sequences described in SEQ ID NO:7 and / or 15. The subject Tn-MUC1 CAR may further comprise a co-stimulatory signal transduction domain comprising the amino acid sequences described in SEQ ID NO:9, 17, 25, 28, 32, 34 and / or 36. The Tn-MUC1 CAR may further include an intracellular signal transduction domain comprising the amino acid sequences described in SEQ ID NO:11 and / or 30. The Tn-MUC1 CAR may include the amino acid sequences described in SEQ ID NO:2, 39, 41, 43, 45 and / or 47.

[0217] Therefore, the subject CAR can be a CAR with affinity for Tn-MUC1, comprising a Tn-MUC1 binding domain comprising the amino acid sequences described in SEQ ID NO:4, 5, 6 and / or 19-24. The subject Tn-MUC1 CAR may further comprise a leader sequence comprising the amino acid sequence described in SEQ ID NO:48. The subject Tn-MUC1 CAR may further comprise a hinge domain comprising the amino acid sequence described in SEQ ID NO:13. The subject Tn-MUC1 CAR may further comprise a transmembrane domain comprising the amino acid sequence described in SEQ ID NO:7 or 15. The subject Tn-MUC1 CAR may further comprise a co-stimulatory signal transduction domain comprising the amino acid sequence described in SEQ ID NO:9, 17, 25, 28, 32, 34 or 36. The Tn-MUC1 CAR may further include an intracellular signal transduction domain comprising the amino acid sequence described in SEQ ID NO: 11 or 30. The Tn-MUC1 CAR may include the amino acid sequence described in SEQ ID NO: 2, 39, 41, 43, 45, or 47.

[0218] Antigen-binding domain

[0219] The antigen-binding domain of a CAR is its extracellular region for binding to specific target antigens, including proteins, carbohydrates, and glycolipids. In some embodiments, the CAR includes an affinity for target antigens (e.g., tumor-associated antigens) on target cells (e.g., cancer cells). Target antigens may include any type of protein or epitope associated with the target cell. For example, the CAR may include an affinity for a target antigen on the target cell that indicates the specific state of the target cell.

[0220] In some embodiments, the CAR of the present invention includes an antigen-binding domain that binds to MUC1. In some embodiments, the antigen-binding domain binds to a glycosylated form or a sugar epitope of MUC1. In some embodiments, the antigen-binding domain is specific for a truncated sugar epitope of MUC1. In some embodiments, the antigen-binding domain is specific for Tn-MUC1. In some embodiments, the antigen-binding domain of the present invention includes an antibody or fragment thereof that binds to a MUC1 molecule or a sugar epitope of MUC1 (Tn-MUC1). In some exemplary embodiments, the antigen-binding domain is an scFv antibody that binds to Tn-MUC1. The selection of the antigen-binding domain depends on the type and amount of antigen present on the surface of the target cell. For example, the antigen-binding domain may be selected to recognize an antigen that acts as a cell surface marker on the target cell associated with a specific state of the target cell.

[0221] As described herein, the CARs of this disclosure that have affinity for specific target antigens on target cells may include a target-specific binding domain. In some embodiments, the target-specific binding domain is a murine target-specific binding domain, e.g., a target-specific binding domain of murine origin. In some embodiments, the target-specific binding domain is a human target-specific binding domain, e.g., a target-specific binding domain of human origin. In an exemplary embodiment, the CAR of this disclosure that has affinity for Tn-MUC1 on target cells may include a Tn-MUC1 binding domain. In some embodiments, the Tn-MUC1 binding domain is a murine Tn-MUC1 binding domain, e.g., a Tn-MUC1 binding domain of murine origin. In some embodiments, the Tn-MUC1 binding domain is humanized. In some embodiments, the Tn-MUC1 binding domain is a human Tn-MUC1 binding domain, e.g., a Tn-MUC1 binding domain of human origin.

[0222] In some embodiments, the Tn-MUC1 binding domain is derived from the 5E5 antibody disclosed in PCT Publication No. WO2008 / 040362, the entire contents of which are incorporated herein by reference. Therefore, the CAR of this disclosure includes the Tn-MUC1 binding domain derived from the 5E5 antibody disclosed in PCT Publication No. WO2008 / 040362. In some embodiments, the Tn-MUC1 binding domain is a humanized Tn-MUC1 binding domain. In some embodiments, the humanized Tn-MUC1 binding domain is derived from either the humanized 5E5 heavy chain or light chain sequence disclosed in PCT Publication No. WO2015 / 159076, the entire contents of which are incorporated herein by reference. Therefore, the CAR of this disclosure includes a humanized Tn-MUC1 binding domain derived from either the humanized 5E5 heavy chain or light chain sequence disclosed in PCT Publication No. WO2015 / 159076. The CAR disclosed herein may include humanized Tn-MUC binding domains as disclosed herein, any transdomain membrane domains, optionally any hinge domains, any co-stimulatory domains, and any intracellular signal transduction domains.

[0223] In some embodiments, the CAR of this disclosure may have affinity for one or more target antigens on one or more target cells. In some embodiments, the CAR may have affinity for one or more target antigens on a single target cell. In such embodiments, the CAR is a bispecific CAR or a multispecific CAR. In some embodiments, the CAR includes one or more target-specific binding domains that confer affinity for one or more target antigens. In some embodiments, the CAR includes one or more target-specific binding domains that confer affinity for the same target antigen. For example, a CAR including one or more target-specific binding domains having affinity for the same target antigen can bind to different epitopes of the target antigen. When multiple target-specific binding domains are present in the CAR, the binding domains may be arranged in tandem and may be separated by a linker peptide. For example, in a CAR including two target-specific binding domains, the binding domains are covalently linked to each other on a single polypeptide chain via a peptide linker, an Fc hinge region, or a membrane hinge region.

[0224] The antigen-binding domain can include any domain that binds to an antigen and can include, but is not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragments thereof. Therefore, in one embodiment, the antigen-binding domain portion includes a mammalian antibody or a fragment thereof. In another embodiment, the antigen-binding domain of the CAR is selected from anti-Tn-MUC1 antibodies or fragments thereof. In some embodiments, the antigen-binding domain is selected from antibodies, antigen-binding domains (Fab), and single-chain variable fragments (scFv). In some embodiments, the Tn-MUC1 binding domain of the present invention is selected from Tn-MUC1-specific antibodies, Tn-MUC1-specific Fab, and Tn-MUC1-specific scFv. In one embodiment, the Tn-MUC1 binding domain is a Tn-MUC1-specific antibody. In one embodiment, the Tn-MUC1 binding domain is a Tn-MUC1-specific Fab. In one embodiment, the Tn-MUC1 binding domain is a Tn-MUC1-specific scFv.

[0225] As used herein, the term "single-chain variable fragment" or "scFv" is a fusion protein of a variable region of the heavy chain (VH) and light chain (VL) of an immunoglobulin (e.g., mouse or human) that covalently links to form a VH::VL heterodimer. The heavy chain (VH) and light chain (VL) are either directly coupled or coupled via a peptide linker or spacer region that links the N-terminus of the VH to the C-terminus of the VL, or vice versa. The terms "linker" and "spacer region" are used interchangeably herein. In some embodiments, the antigen-binding domain (e.g., the Tn-MUC1 binding domain) includes an scFv with a VH–linker–VL configuration from the N-terminus to the C-terminus. In some embodiments, the antigen-binding domain (e.g., the Tn-MUC1 binding domain) includes an scFv with a VL–linker–VH configuration from the N-terminus to the C-terminus. Those skilled in the art will be able to select a suitable configuration for use in this invention.

[0226] Linkers are typically enriched with glycine for flexibility and with serine or threonine for solubility. Linkers can connect the heavy chain variable region and the light chain variable region of an extracellular antigen-binding domain. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6):1910-1917 (2008) and WO 2014 / 087010, the contents of which are incorporated herein by reference in their entirety. Various linker sequences are known in the art, including but not limited to glycine-serine (GS) linkers, such as (GS) n (GSGGS) n (SEQ ID NO:52), (GGGS) n(SEQ ID NO:53) and (GGGGS) n (SEQ ID NO:54), where n represents an integer of at least 1. Exemplary adapter sequences may include amino acid sequences, including but not limited to GGSG (SEQ ID NO:55), GGSGG (SEQ ID NO:56), GGSSG (SEQ ID NO:57), GGSGG (SEQ ID NO:58), GGGSG (SEQ ID NO:59), GSSSG (SEQ ID NO:60), GGGGS (SEQ ID NO:61), GGGGSGGGGGSGGGGS (SEQ ID NO:62), etc. Those skilled in the art will be able to select suitable adapter sequences for use in this invention. In one embodiment, the antigen-binding domain of the present invention (e.g., the Tn-MUC1 binding domain) includes a heavy chain variable region (VH) and a light chain variable region (VL), wherein VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 62), which may be encoded by a nucleic acid sequence comprising the nucleotide sequence GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGATCT (SEQ ID NO: 63).

[0227] Despite the removal of the constant region and the introduction of a linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be expressed from nucleic acids including VH- and VL-coding sequences, as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). See also U.S. Patent Serial Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Publications Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (see, e.g., Zhao et al., Hyrbidoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomalli et al., Thromb Haemost 2007 97(6):955-63; Fifeeta., J Clin Invst 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40)). Agonistic scFvs with irritant activity have been described (see, e.g., Peter et al., J Bioi Chem 2003 25 278(38):367 40-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).

[0228] As used herein, “Fab” refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have an Fc region. For example, an antibody digested by papain produces two Fab fragments and an Fc fragment (e.g., the heavy (H) chain constant region; the Fc region that does not bind to the antigen).

[0229] As used herein, “F(ab′)2” refers to an antibody fragment produced by digesting a complete IgG antibody with pepsin, wherein the fragment has two antigen-binding (ab′) (bivalent) regions, each of which comprises two independent amino acid chains, a portion of the H chain and the light chain (L) linked by an SS bond to bind to the antigen, and the remaining H chain being linked together. The “F(ab′)2” fragment can be divided into two independent Fab’ fragments.

[0230] In some cases, the antigen-binding domain can be derived from the same type of CAR that will ultimately be used. For example, for use in humans, the antigen-binding domain of a CAR may include human antibodies or fragments thereof as described elsewhere in this document.

[0231] In an exemplary embodiment, the Tn-MUC1 CAR of the present invention includes a Tn-MUC1 binding domain, such as a Tn-MUC1-specific scFv. In one embodiment, the Tn-MUC1 binding domain includes the amino acid sequence described in SEQ ID NO:4. In one embodiment, the Tn-MUC1 binding domain is encoded by a nucleic acid sequence including the nucleotide sequence described in SEQ ID NO:3.

[0232] In one embodiment, the Tn-MUC1 binding domain includes a light chain variable region comprising the amino acid sequence described in SEQ ID NO:6. The light chain variable region of the Tn-MUC1 binding domain includes three light chain complementarity-determining regions (CDRs). As used herein, a “complementarity-determining region” or “CDR” refers to a variable chain region of an antigen-binding molecule that binds a specific antigen. Therefore, the Tn-MUC1 binding domain may include a light chain variable region comprising: CDR1 comprising the amino acid sequence described in SEQ ID NO:19; CDR2 comprising the amino acid sequence described in SEQ ID NO:20; and CDR3 comprising the amino acid sequence described in SEQ ID NO:21.

[0233] In one embodiment, the Tn-MUC1 binding domain includes a heavy chain variable region comprising the amino acid sequence described in SEQ ID NO:5. The Tn-MUC1 binding domain may include a heavy chain variable region comprising: CDR1 comprising the amino acid sequence described in SEQ ID NO:22; CDR2 comprising the amino acid sequence described in SEQ ID NO:23; and CDR3 comprising the amino acid sequence described in SEQ ID NO:24.

[0234] Those skilled in the art will recognize the tolerable variation of the Tn-MUC1 binding domain while maintaining specific binding to Tn-MUC1. For example, in some embodiments, the Tn-MUC1 binding domain comprises an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any amino acid sequence described in SEQ ID NO:4-6 and 19-24.

[0235] In some embodiments, the Tn-MUC1 binding domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence described in SEQ ID NO:3.

[0236] The antigen-binding domain can be operatively linked to another domain of the CAR, such as a transmembrane domain or a co-stimulatory signal transduction domain, both of which are described elsewhere herein. In one embodiment, the nucleic acid encoding the antigen-binding domain is operatively linked to nucleic acids encoding the transmembrane domain and the co-stimulatory signal transduction domain.

[0237] The antigen-binding domains described herein, such as antibodies or fragments thereof that bind to Tn-MUC1, can be combined with any transmembrane domain, any intracellular or cytoplasmic domain described herein, or any other domain described herein that may be included in a CAR.

[0238] Transmembrane domain

[0239] Regarding the transmembrane domain, the CAR of the present invention (e.g., Tn-MUC1 CAR) can be designed to include a transmembrane domain that links the antigen-binding domain of the CAR to the intracellular domain. The transmembrane domain of the subject CAR is a region capable of crossing the plasma membrane of a cell (e.g., an immune cell or its precursor). The transmembrane domain is used for insertion into the cell membrane, such as the eukaryotic cell membrane. In some embodiments, the transmembrane domain is situated between the antigen-binding domain and the intracellular domain of the CAR.

[0240] In one implementation, the transmembrane domain naturally associates with one or more domains in the CAR. In some cases, the transmembrane domain can be selected or modified by amino acid substitution to prevent such domains from binding to transmembrane domains of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex.

[0241] The transmembrane domain can be derived from a natural or synthetic source. When the source is natural, the domain can originate from any membrane-binding or transmembrane protein, such as a type I transmembrane protein. When the source is synthetic, the transmembrane domain can be any artificial sequence that facilitates CAR insertion into the cell membrane, such as an artificial hydrophobic sequence. Examples of transmembrane regions for specific uses in this invention include, but are not limited to, transmembrane domains derived from (i.e., including at least one or more of the following transmembrane regions): the α, β, or ζ chains of T cell receptors, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In some embodiments, the transmembrane domain may be synthetic, in which case it will primarily comprise hydrophobic residues such as leucine and valine. In some exemplary embodiments, a triplet of phenylalanine, tryptophan, and valine is found at each end of the synthesized transmembrane domain.

[0242] The transmembrane domains described herein can be combined with any antigen-binding domains described herein, any co-stimulatory signaling domains described herein, any intracellular signaling domains described herein, or any other domains described herein that may be included in the subject CAR.

[0243] In some embodiments, the transmembrane domain further includes a hinge region. The subject matter of the present invention, the CAR, may also include a hinge region. The hinge region of the CAR is a hydrophilic region located between the antigen-binding domain and the transmembrane domain. In some embodiments, this domain facilitates appropriate protein folding of the CAR. The hinge region is an optional component of the CAR. The hinge region may include a domain selected from the Fc fragment of an antibody, the hinge region of an antibody, the CH2 region of an antibody, the CH3 region of an antibody, an artificial hinge sequence, or a combination thereof. Examples of hinge regions include, but are not limited to, the CD8a hinge, artificial hinges made from peptides that can be as small as three glycine residues (Gly), and the CH1 and CH3 domains of IgG (such as human IgG4).

[0244] In some embodiments, the subject matter CAR of this disclosure includes a hinge region that connects the antigen-binding domain to a transmembrane domain, which in turn connects to an intracellular domain. The hinge region is preferably capable of supporting the antigen-binding domain to recognize and bind antigens on target cells (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3(2):125-135). In some embodiments, the hinge region is a flexible domain, thus allowing the antigen-binding domain to have a structure and density that are specifically designed to recognize target antigens on cells such as tumor cells. The flexibility of the hinge region allows it to adopt many different conformations.

[0245] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge region is a receptor-derived hinge region polypeptide (e.g., a hinge region derived from CD8).

[0246] The hinge region can have a length of about 4 amino acids to about 50 amino acids, such as about 4 amino acids to about 10 amino acids, about 10 amino acids to about 15 amino acids, about 15 amino acids to about 20 amino acids, about 20 amino acids to about 25 amino acids, about 25 amino acids to about 30 amino acids, about 30 amino acids to about 40 amino acids, or about 40 amino acids to about 50 amino acids.

[0247] Suitable hinge areas can be easily selected and can have any number of suitable lengths, such as 1 amino acid (e.g., Gly) to 20 amino acids, 2 amino acids to 15 amino acids, 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6 or 7 amino acids.

[0248] For example, the hinge region includes a glycine polymer (G)n, a glycine-serine polymer (including, for example, (GS)n, (GSGGS)n (SEQ ID NO: 52), and (GGGS)n (SEQ ID NO: 53), where n is an integer of at least 1), a glycine-alanine polymer, an alanine-serine polymer, and other flexible joints known in the art. Glycine and glycine-serine polymers can be used; both Gly and Serine are relatively unstructured and can therefore be used as a neutral tether between the components. Glycine polymers can be used; glycine is even significantly more abundant than alanine. Spatially, and less restricted than residues with longer side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2:73-142). Exemplary hinge regions may include amino acid sequences, including but not limited to GGSG (SEQ ID NO:55), GGSGG (SEQ ID NO:56), GGSG (SEQ ID NO:57), GGSGG (SEQ ID NO:58), GGGSG (SEQ ID NO:59), GSSSG (SEQ ID NO:60), etc.

[0249] In some embodiments, the hinge region is the immunoglobulin heavy chain hinge region. The amino acid sequences of immunoglobulin hinge regions are known in the art; see, for example, Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1):162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4):1779-1789. As a non-limiting example, the immunoglobulin hinge region may include one of the following amino acid sequences: DKTHT (SEQ ID NO:64); CPCC (SEQ ID NO:65); CPEPKSCDTPPPCPR (SEQ ID NO:66) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHT (SEQ ID NO:67); KSCDKTHTCP (SEQ ID NO:68); KCCVDCP (SEQ ID NO:69); KYGPPCP (SEQ ID NO:70); EPKSCDKTHTCPPCP (SEQ ID NO:71) (human IgG1 hinge); ERKCCVECPPCP (SEQ ID NO:72) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO:73) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO:64); DKTHT (SEQ ID NO:64); CPCC (SEQ ID NO:65); CPEPKSCDTPPPCPR (SEQ ID NO:66) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHTCPPCP (SEQ ID NO:67); KSCDKTHTCPPCP (SEQ ID NO:68); KCCVDCP (SEQ ID NO:69); KYGPPCP (SEQ ID NO:70); EPKSCDKTHTCPPCP (SEQ ID NO:71) (human IgG1 hinge); ERKCCVECPPCP (SEQ ID NO:72) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO:73) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO:64); ELKTPLGDTTHTCPRCP (SEQ ID NO:73); ELKTPLGDTTHTCPRCP (SEQ NO:74)(human IgG4 hinge); etc.

[0250] The hinge region may include the amino acid sequence of the hinge region of human IgG1, IgG2, IgG3, or IgG4. In one embodiment, the hinge region may include one or more amino acid substitutions and / or insertions and / or deletions compared to the wild-type (naturally occurring) hinge region. For example, His229 of the human IgG1 hinge may be substituted with Tyr so that the hinge region includes the sequence EPKSCDKTYTCPPCP (SEQ ID NO:75); see, e.g., Yan et al., J. Biol. Chem. (2012) 287:5891-5897. In one embodiment, the hinge region may include an amino acid sequence derived from human CD8 or a variant thereof.

[0251] In one embodiment, the transmembrane domain includes a CD8α transmembrane domain. In some embodiments, the subject CAR includes a CD8α transmembrane domain comprising the amino acid sequence described in SEQ ID NO:7, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:8.

[0252] In another embodiment, the subject CAR includes a CD8α hinge domain and a CD8α transmembrane domain. In one embodiment, the CD8α hinge domain includes the amino acid sequence described in SEQ ID NO:13, which may be encoded by a nucleic acid sequence including the nucleotide sequence described in SEQ ID NO:14.

[0253] In one embodiment, the transmembrane domain includes a CD28 transmembrane domain. In some embodiments, the subject CAR includes a CD28 transmembrane domain comprising the amino acid sequence described in SEQ ID NO:15, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:16.

[0254] Those skilled in the art are aware of permissible variations in transmembrane and / or hinge domains while maintaining their intended function. For example, in some embodiments, the transmembrane or hinge domain comprises an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any amino acid sequence described in SEQ ID NO: 7, 13, and 15. For example, in some embodiments, the transdomain or hinge domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any nucleotide sequence described in SEQ ID NO: 8, 14, and 16.

[0255] Transmembrane domains can be combined with any hinged domains and / or may include one or more transmembrane domains as described herein.

[0256] The transmembrane domains described herein, such as the α, β, or ζ chains of T cell receptors, and the transmembrane regions of CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9, may be combined with any antigen-binding domain, any co-stimulatory signaling domain, intracellular domain, or cytoplasmic domain described herein, or any other domain described herein that may be included in a CAR.

[0257] In one embodiment, the transmembrane domain may be synthetic, in which case it will primarily contain hydrophobic residues, such as leucine and valine. In an exemplary embodiment, a triplet of phenylalanine, tryptophan, and valine is found at each end of the synthetic transmembrane domain.

[0258] In some embodiments, the subject CAR may further include a spacer region domain between the extracellular and transmembrane domains of the CAR, or between the intracellular and transmembrane domains of the CAR. As used herein, the term "spacer region domain" generally means any oligopeptide or polypeptide that functions to link the transmembrane domain to the extracellular or intracellular domain within a polypeptide chain. The spacer region domain may comprise up to 300 amino acids, e.g., 10 to 100 amino acids, or 25 to 50 amino acids. In some embodiments, the spacer region domain may be a short oligopeptide or polypeptide linker, e.g., between 2 and 10 amino acids in length. For example, glycine-serine dinucleotides provide a particularly suitable linker between the transmembrane domain and the intracellular signaling domain of the subject CAR.

[0259] Therefore, the subject matter CAR of this disclosure may include any transmembrane domain, hinge domain or spacer domain described herein.

[0260] Intracellular domains

[0261] The subject matter of this invention, CAR, also includes an intracellular domain. The intracellular domain of the CAR is responsible for activating at least one of the effector functions of cells expressing the CAR (e.g., immune cells). The intracellular domain transduces effector function signals and directs cells (e.g., immune cells) to perform their specialized functions, such as damaging and / or destroying target cells.

[0262] The intracellular domains of CARs, or additionally cytoplasmic domains, are responsible for the activation of cells expressing CARs. Examples of intracellular domains used in this invention include, but are not limited to, the cytoplasmic portion of surface receptors, co-stimulatory molecules, and any molecules that work together to initiate signal transduction in T cells, as well as any derivatives or variants of these elements and any synthetic sequences having the same functional capabilities.

[0263] In some embodiments, the intracellular domain includes a co-stimulatory signal transduction domain. In some embodiments, the intracellular domain includes an intracellular signal transduction domain. In some embodiments, the intracellular domain includes both a co-stimulatory signal transduction domain and an intracellular signal transduction domain. In some embodiments, the intracellular domain includes 4-1BB and CD3ζ. In some embodiments, the co-stimulatory signal transduction domain includes 4-1BB. In some embodiments, the intracellular signal transduction domain includes CD3ζ.

[0264] In one embodiment, the intracellular domain of the CAR includes a co-stimulatory signal transduction domain comprising any portion of one or more co-stimulatory molecules, such as at least one signal transduction domain derived from CD2, CD3, CD8, CD27, CD28, OX40, ICOS, 4-1BB, PD-1, any derivative or variant thereof, any synthetic sequence thereof having the same functional capability, and any combination thereof.

[0265] Examples of intracellular signal transduction domains include, but are not limited to, the ζ chain of the T cell receptor complex or any of its homologues, such as the η chain, FcsRIγ and β chains, MB1 (Iga) chain, B29 (Ig) chain, etc., the human CD3ζ chain, CD3 polypeptides (Δ, δ, and ε), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), and other molecules involved in T cell transduction, such as CD2, CD5, and CD28. In one embodiment, the intracellular signal transduction domain may be the human CD3ζ chain, FcyRIII, FcsRI, the cytoplasmic tail of the Fc receptor, a cytoplasmic receptor with an immune receptor tyrosine activation motif (ITAM), and combinations thereof.

[0266] Other examples of intracellular domains include fragments or domains from one or more of the following molecules or receptors, including but not limited to: TCR, CD3ζ, CD3γ, CD3δ, CD3ε, CD86, common FcRγ, FcRβ (FcεRib), CD79a, CD79b, FcγR1a, DAP10, DAP12, T cell receptor (TCR), CD8, CD27, CD28, 4-1BB (CD137), OX9, OX40, CD30, CD40, PD-1, ICOS, KIR family proteins, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligands that specifically bind to CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1Id, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD lib, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACA M1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, other costimulatory molecules described herein, any derivatives, variants or fragments thereof, any synthetic sequence of costimulatory molecules having the same functional capacity, and combinations thereof.

[0267] Other examples of intracellular domains include, but are not limited to, intracellular signaling domains of various other immune signaling receptors of several types, including, but not limited to, first, second, and third generation T cell signaling proteins, including CD3, B7 family co-stimulatory, and tumor necrosis factor receptor (TNFR) superfamily receptors (see, e.g., Park and Brentjens, J. Clin. Oncol. (2015) 33(6):651-653). Additionally, intracellular signal transduction domains may include signal transduction domains used by NK and NKT cells (see, e.g., Hermanson and Kaufman, Front. Immunol. (2015) 6:195), such as the signal transduction domains of NKp30 (B7-H6) (see, e.g., Zhang et al., J. Immunol. (2012) 189(5):2290-2299), and DAP 12 (see, e.g., Topfer et al., J. Immunol. (2015) 194(7):3201-3212), NKG2D, NKp44, NKp46, DAP10, and CD3z.

[0268] The intracellular signaling domains suitable for use in the subject matter CAR of this invention include any desired signaling domain that provides different and detectable signals in response to CAR activation (i.e., activation by antigen and dimerizing agent), such as increased production of one or more cytokines; changes in target gene transcription; changes in protein activity; changes in cell behavior (e.g., cell death); cell proliferation; cell differentiation; cell survival; modulation of cell signaling responses; etc.). In some embodiments, the intracellular signaling domain includes at least one (e.g., one, two, three, four, five, six, etc.) ITAM motifs described below. In some embodiments, the intracellular signaling domain includes a DAP10 / CD28 type signaling chain. In some embodiments, the intracellular signaling domain is not covalently attached to a membrane-bound CAR, but diffuses in the cytoplasm.

[0269] The intracellular signaling domains suitable for use in the subject CAR of this invention include intracellular signaling peptides containing an immune receptor tyrosine activation motif (ITAM). In some embodiments, the ITAM motif is repeated twice in the intracellular signaling domain, wherein the first and second cases of the ITAM motif are separated from each other by 6 to 8 amino acids. In one embodiment, the intracellular signaling domain of the subject CAR includes three ITAM motifs. In some embodiments, the intracellular signaling domain includes a signaling domain of a human immunoglobulin receptor containing an immune receptor tyrosine activation motif (ITAM), such as, but not limited to, FcγRI, FcγRIIA, FcγRIIC, FcγRIIIA, FcRL5 (see, e.g., Gillis et al., Front. (2014) Immunol. 5:254).

[0270] Suitable intracellular signal transduction domains can be the ITAM-motif-containing portion of a polypeptide. For example, a suitable intracellular signal transduction domain can be an ITAM-motif-containing domain from any protein containing an ITAM motif. Therefore, a suitable intracellular signal transduction domain does not need to contain the entire sequence of the protein from which it originates. Examples of suitable ITAM-motif-containing polypeptides include, but are not limited to: DAP12, FCER1G (Fcε receptor Iγ chain), CD3D (CD3δ), CD3E (CD3ε), CD3G (CD3γ), CD3Z (CD3ζ), and CD79A (antigen receptor complex-associated protein α chain).

[0271] In one embodiment, the intracellular signal transduction domain is derived from DAP12 (also known as TYROBP; TYRO protein tyrosine kinase-binding protein; KARAP; PLOSL; DNAX-activating protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; cytotoxic activating receptor-associated protein; cytotoxic activating receptor-associated protein; etc.). In one embodiment, the intracellular signal transduction domain is derived from FCER1G (also known as FCRG; Fcε receptor Iγ chain; Fc receptor γ chain; fc-εRI-γ; fcRγ; fceRlγ; high-affinity immunoglobulin E receptor subunit γ; immunoglobulin E receptor, high-affinity, γ chain; etc.). In one embodiment, the intracellular signal transduction domain is derived from the T-cell surface glycoprotein CD3δ chain (also known as CD3D; CD3-Δ; T3D; CD3 antigen, δ subunit; CD3δ; CD3d antigen, δ polypeptide (TiT3 complex); OKT3, δ chain; T-cell receptor T3δ chain; T-cell surface glycoprotein CD3δ chain; etc.). In one embodiment, the intracellular signal transduction domain is derived from the T-cell surface glycoprotein CD3ε chain (also known as CD3e, T-cell surface antigen T3 / Leu-4ε chain, T-cell surface glycoprotein CD3ε chain, AI504783, CD3, CD3ε, T3e, etc.). In one embodiment, the intracellular signal transduction domain is derived from the T-cell surface glycoprotein CD3γ chain (also known as CD3G, T-cell receptor T3γ chain, CD3-Γ, T3G, γ polypeptide (TiT3 complex), etc.). In one embodiment, the intracellular signal transduction domain is derived from the T-cell surface glycoprotein CD3ζ chain (also known as CD3Z, T-cell receptor T3ζ chain, CD247, CD3-Z, CD3H, CD3Q, T3Z, TCRZ, etc.). In one embodiment, the intracellular signal transduction domain is derived from CD79A (also known as the B-cell antigen receptor complex-associated protein α chain; CD79a antigen (immunoglobulin-associated α); MB-1 membrane glycoprotein; Ig-α; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein; etc.). In one embodiment, the intracellular signal transduction domain suitable for use in the subject CAR of this disclosure includes the DAP10 / CD28 signal transduction chain. In one embodiment, the intracellular signal transduction domain suitable for use in the subject CAR of this disclosure includes the ZAP70 polypeptide. In some embodiments, the intracellular signal transduction domain includes the cytoplasmic signal transduction domain of TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signal transduction domain in the CAR includes the cytoplasmic signal transduction domain of human CD3ζ.

[0272] While the entire intracellular signal transduction domain can generally be used, it is not always necessary to use the entire chain in many cases. Regarding the use of truncated portions of intracellular signal transduction domains, such truncated portions can be used in place of the full chain, provided they retain their transduction function. Intracellular signal transduction domains include any truncated portion of the intracellular signal transduction domain sufficient to transduce the functional signal.

[0273] The intracellular signaling domains described herein can be combined with any co-stimulatory signaling domains described herein, any antigen-binding domains described herein, any transmembrane structures described herein, or any other domains described herein that may be included in a CAR.

[0274] Furthermore, variant intracellular signaling domains suitable for the subject CAR are known in the art. The YMFM motif, found in ICOS, is an SH2-binding motif that simultaneously recruits the p85 and p50α subunits of PI3K, resulting in enhanced AKT signaling. See, for example, Simpson et al. (2010) Curr. Opin. Immunol., 22:326-332. In one embodiment, a variant of the CD28 intracellular domain can be generated to include the YMFM motif.

[0275] In one embodiment, the intracellular domain of the subject CAR includes a 4-1BB co-stimulatory domain comprising the amino acid sequence described in SEQ ID NO:9, encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:10. In one embodiment, the intracellular domain of the subject CAR includes a CD28 co-stimulatory domain comprising the amino acid sequence described in SEQ ID NO:17, encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:18. In one embodiment, the intracellular domain of the subject CAR includes an ICOS co-stimulatory domain comprising the amino acid sequence described in SEQ ID NO:25, encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:26 or 27. In one embodiment, the intracellular domain of the subject CAR includes a CD2 co-stimulatory domain comprising the amino acid sequence described in SEQ ID NO:28, encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:29. In one embodiment, the intracellular domain of the subject CAR includes a CD28 YMFM variant co-stimulatory domain comprising the amino acid sequence described in SEQ ID NO:32, encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:33. In one embodiment, the intracellular domain of the subject CAR includes a CD27 co-stimulatory domain comprising the amino acid sequence described in SEQ ID NO:34, encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:35. In one embodiment, the intracellular domain of the subject CAR includes an OX40 co-stimulatory domain comprising the amino acid sequence described in SEQ ID NO:36, encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:37.

[0276] In one embodiment, the intracellular domain of the subject CAR includes a CD3ζ intracellular signal transduction domain comprising the amino acid sequence described in SEQ ID NO: 11 or 30, which is encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO: 12 or 31.

[0277] Those skilled in the art will understand the permissible variations of intracellular domains while maintaining their specific activity. For example, in some embodiments, the intracellular domain includes an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any amino acid sequence described in SEQ ID NO: 9, 11, 17, 25, 28, 32, 34, or 36. For example, in some embodiments, the intracellular domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with any nucleotide sequence described in SEQ ID NO: 10, 12, 18, 26, 27, 29, 31, 33, 35, or 37.

[0278] In one embodiment, the intracellular domains of the topic CAR include an ICOS co-stimulatory domain and a CD3ζ intracellular signal transduction domain. In one embodiment, the intracellular domains of the topic CAR include a CD28 co-stimulatory domain and a CD3ζ intracellular signal transduction domain. In one embodiment, the intracellular domains of the topic CAR include a CD28 YMFM variant co-stimulatory domain and a CD3ζ intracellular signal transduction domain. In one embodiment, the intracellular domains of the topic CAR include a CD27 co-stimulatory domain and a CD3ζ intracellular signal transduction domain. In one embodiment, the intracellular domains of the topic CAR include an OX40 co-stimulatory domain and a CD3ζ intracellular signal transduction domain. In one exemplary embodiment, the intracellular domains of the topic CAR include a 4-1BB co-stimulatory domain and a CD3ζ intracellular signal transduction domain. In one exemplary embodiment, the intracellular domains of the topic CAR include a CD2 co-stimulatory domain and a CD3ζ intracellular signal transduction domain.

[0279] CAR sequence

[0280] The subject CAR of this invention can be a CAR with affinity for MUC1 (e.g., MUC1). In one embodiment, the Tn-MUC1 CAR of this invention comprises a 4-1BB co-stimulatory domain and a CD3ζ intracellular signaling domain structure, comprising the amino acid sequence described in SEQ ID NO:2, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:1. In one embodiment, the Tn-MUC1 CAR of this invention comprises a CD28 co-stimulatory domain and a CD3ζ intracellular signaling domain structure, comprising the amino acid sequence described in SEQ ID NO:39, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:38. In one embodiment, the Tn-MUC1 of this invention...

[0281] The CAR comprises a CD28 YMFM variant co-stimulatory domain and a CD3ζ intracellular signaling domain, comprising the amino acid sequence described in SEQ ID NO:41, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:40. In one embodiment, the Tn-MUC1 CAR of the present invention comprises a CD27 co-stimulatory domain and a CD3ζ intracellular signaling domain, comprising the amino acid sequence described in SEQ ID NO:43, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:42. In one embodiment, the Tn-MUC1 CAR of the present invention comprises an OX40 co-stimulatory domain and a CD3ζ intracellular signaling domain, comprising the amino acid sequence described in SEQ ID NO:45, which may be encoded by a nucleic acid sequence comprising the nucleotide sequence described in SEQ ID NO:44. In one embodiment, the Tn-MUC1 CAR of the present invention comprises a CD2 co-stimulatory domain and a CD3ζ intracellular signaling domain structure, which includes the amino acid sequence described in SEQ ID NO:47, which may be encoded by a nucleic acid sequence including the nucleotide sequence described in SEQ ID NO:46.

[0282] Those skilled in the art will understand the permissible variations of the CAR while maintaining its specific activity. For example, in some embodiments, the CAR comprises an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence described in SEQ ID NO: 2, 39, 41, 43, 45, or 47. For example, in some embodiments, the CAR is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence described in SEQ ID NO: 1, 38, 40, 42, 44, or 46.

[0283] In some embodiments, the subject matter CAR of the present invention includes a MUC1 binding structural domain and a transmembrane structural domain. In one embodiment, the CAR includes a MUC1 binding structural domain and a transmembrane structural domain, wherein the transmembrane structural domain includes a CD8 hinge region. In one embodiment, the CAR includes a MUC1 binding structural domain and a transmembrane structural domain, wherein the transmembrane structural domain includes a CD8α transmembrane structural domain. In one embodiment, the CAR includes a MUC1 binding structural domain and a transmembrane structural domain, wherein the transmembrane structural domain includes a CD8 hinge region and a CD8α transmembrane structural domain.

[0284] In some embodiments, the subject matter CAR of the present invention includes a MUC1 binding domain, a transmembrane domain, and an intracellular domain. In one embodiment, the CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain. In one embodiment, the CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a 4-1BB co-stimulatory domain and a CD3ζ domain. In one embodiment, the CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a CD28 co-stimulatory domain and a CD3ζ domain. In one embodiment, the CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a CD28 YMFM variant co-stimulatory domain and a CD3ζ domain. In one embodiment, the CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a CD27 domain and a CD3ζ domain. In one embodiment, the CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including an OX40 domain and a CD3ζ domain. In another embodiment, the CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a CD2 domain and a CD3ζ domain.

[0285] Therefore, the present invention provides modified immune cells or their precursor cells, such as modified T cells, modified NK cells, modified NKT cells, which contain a chimeric antigen receptor (CAR) with affinity for MUC1 as described herein.

[0286] Human antibodies

[0287] The antigen-binding domain of the CAR may preferably include a human antibody or a fragment thereof. Completely human antibodies are particularly desirable for therapeutic treatment of human subjects. Human antibodies can be prepared by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences, including improvements to these techniques. See also U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT disclosures WO 98 / 46645, WO 98 / 50433, WO 98 / 24893, WO98 / 16654, WO 96 / 34096, WO 96 / 33735, and WO 91 / 10741; each of which is incorporated herein by reference in its entirety.

[0288] Human antibodies can also be generated using transgenic mice that cannot express functional endogenous immunoglobulins but can express human immunoglobulin genes. For example, human heavy chain and light chain immunoglobulin gene complexes can be randomly or through homologous recombination introduced into mouse embryonic stem cells. Optionally, in addition to human heavy chain and light chain genes, human variable, constant, and polymorphic regions can be introduced into mouse embryonic stem cells. By introducing human immunoglobulin gene loci through homologous recombination, mouse heavy chain and light chain immunoglobulin genes may be rendered nonfunctional, individually or simultaneously. For example, homozygous deletion of the antibody heavy chain linker (JH) gene in chimeric and germline mutant mice has been described as resulting in complete suppression of endogenous antibody production. Modified embryonic stem cells are expanded and microinjected into blastocysts to generate chimeric mice. Chimeric mice are then cultured to produce homozygous offspring expressing human antibodies. Transgenic mice are immunized in a normal manner with all or part of a selected antigen, such as the polypeptide of the present invention. Antibodies against selected targets can be obtained from immunized, transgenic mice using conventional hybridoma techniques. The transgenic mice carry human immunoglobulin transgenes that rearrange during B cell differentiation, followed by class switching and somatic mutations. Therefore, using such a technique, it is possible to generate therapeutically useful IgG, IgA, IgM, and IgE antibodies, including but not limited to IgG1 (γ1) and IgG3. For an overview of this technique for generating human antibodies, see Lonberg and Huszar (Int. Rev. Immunol., 13:65-93 (1995)). For a detailed discussion of the techniques used to produce human antibodies and human monoclonal antibodies, and the protocols used to produce such antibodies, see, for example, PCT Publications WO 98 / 24893, WO 96 / 34096, and WO 96 / 33735; and U.S. Patents 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, each of which is incorporated herein by reference in its entirety. Furthermore, companies such as Abgenix, Inc. (Freemont, California) and Genpharm (San Jose, California) may engage in providing human antibodies against selected antigens using techniques similar to those described above.For a specific discussion of how transferring human germline immunoglobulin gene arrays into germline mutant mice will lead to the production of human antibodies upon antigen challenge, see, for example, Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993); and Duchosal et al., Nature, 355:258 (1992).

[0289] Human antibodies can also be derived from phage display libraries (Hoogenboom et al., J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581-597 (1991); Vaughan et al., Nature Biotech., 14:309 (1996)). Phage display technology (McCafferty et al., Nature, 348:552-553 (1990)) can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable (V) domain gene libraries from unimmunized donors. According to this technology, antibody V domain genes are in-frame cloned into the major or minor coat protein genes of filamentous phages (such as M13 or fd) and displayed as functional antibody fragments on the surface of phage particles. Because filamentous particles contain single-stranded DNA copies of the phage genome, selection based on antibody functional properties also leads to the selection of genes encoding antibodies exhibiting those properties. Therefore, phages mimic some properties of B cells. Phage display can take many forms; for a review of them, see, for example, Johnson, Kevin S and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 (1993). V gene fragments from several sources can be used for phage display. Clackson et al., Nature, 352:624-628 (1991) isolated multiple antibodies from a small randomized library of V genes derived from the spleen of unimmunized mice. Azoxystrobin antibodies. A V gene library derived from non-immunized human donors can be constructed, and antibodies against various antigens (including autoantigens) can be isolated substantially according to the techniques described in Marks et al., J. Mol. Biol., 222:581-597 (1991), or Griffith et al., EMBO J., 12:725-734 (1993). See also U.S. Patent Nos. 5,565,332 and 5,573,905, each of which is incorporated herein by reference in its entirety.

[0290] Human antibodies can also be generated from activated B cells in vitro (see U.S. Patent Nos. 5,567,610 and 5,229,275, each of which is incorporated herein by reference in its entirety). Human antibodies can also be generated in vitro using hybridoma techniques, such as, but not limited to, those described by Roder et al. (Methods Enzymol., 121:140-167 (1986)).

[0291] Dominant negative receptors and switching receptors

[0292] This invention provides compositions and methods for modified immune cells or their precursors, such as modified T cells, comprising dominant negative receptors and / or switching receptors. Thus, in some embodiments, the immune cells have been genetically modified to express dominant negative receptors and / or switching receptors. Sequences of the dominant negative receptors and switching receptors are shown in Table 1. As used herein, the term "dominant negative receptor" refers to a molecule designed to reduce the effect of negative signaling molecules (e.g., the effect of negative signaling molecules on the modified immune cells of this invention). The dominant negative receptors of this invention can bind negative signaling molecules, such as TGF-β or PD-1, using extracellular domains associated with negative signaling and reducing the effect of negative signaling molecules. Such dominant negative receptors are described herein. For example, modified immune cells comprising dominant negative receptors can bind negative signaling molecules in the microenvironment of the modified immune cells and reduce the effect of negative signaling molecules on the modified immune cells.

[0293] In addition to reducing the effects of negative signal transduction molecules, the conversion receptors of the present invention can also be designed to convert negative signals to positive signals using intracellular domains that are associated with positive signals. Conversion receptors designed to convert negative signals to positive signals are described herein. Therefore, conversion receptors include extracellular domains associated with negative signals and / or intracellular domains associated with positive signals.

[0294] Tumor cells generate an immunosuppressive microenvironment that protects them from immune recognition and elimination. This immunosuppressive microenvironment may limit the efficacy of immunosuppressive therapies, such as CAR-T cell therapy. The secreted cytokine transforming growth factor β (TGFβ) directly inhibits the function of cytotoxic T cells and additionally induces the formation of regulatory T cells, further suppressing the immune response. In the context of prostate cancer, T-cell immunosuppression due to TGFβ has been previously demonstrated (Donkor et al., 2011; Shalapour et al., 2015). To reduce the immunosuppressive effects of TGFβ, immune cells can be modified to express a dominant-negative receptor for TGF-β.

[0295] In some embodiments, the dominant negative receptor is a truncated variant of the wild-type protein associated with negative signaling. In some embodiments, the dominant negative receptor is a dominant negative receptor for TGF-β. Therefore, in some embodiments, the dominant negative receptor for TGF-β is a truncated variant of the wild-type TGF-β receptor. In some embodiments, the dominant negative receptor is a truncated dominant negative variant of the TGF-β type II receptor (TGFβRII-DN). In one embodiment, TGFβRII-DN comprises the amino acid sequence of SEQ ID NO:76, which may be encoded by the nucleic acid sequence of SEQ ID NO:77.

[0296] Those skilled in the art will recognize the permissible variations in the sequence of TGFβRII-DN while maintaining its intended function. For example, in some embodiments, the dominant negative acceptor of the present invention is a TGFβRII-DN comprising an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence described in SEQ ID NO:76. In one embodiment, the dominant negative acceptor is a TGFβRII-DN comprising the amino acid sequence described in SEQ ID NO:76.

[0297] In some embodiments, the dominant negative receptor of the present invention is a TGFβRII-DN encoded by a nucleic acid sequence having at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleic acid sequence described in SEQ ID NO:77. In one embodiment, the dominant negative receptor is a TGFβRII-DN encoded by the nucleic acid sequence described in SEQ ID NO:77.

[0298] In one embodiment, the switching receptor suitable for use in this invention is the PD1-CTM-CD28 receptor. When expressed in cells, the PD1-CTM-CD28 receptor converts negative PD1 signaling into positive CD28 signaling. The PD1-CTM-CD28 receptor includes variants of the PD1 extracellular domain, the CD28 transmembrane domain, and the CD28 cytoplasmic domain. In one embodiment, the PD1-CTM-CD28 receptor includes the amino acid sequence of SEQ ID NO:78, which may be encoded by the nucleic acid sequence of SEQ ID NO:79.

[0299] Those skilled in the art are aware of the permissible variations of the PD1-CTM-CD28 receptor while maintaining its intended biological activity (e.g., converting a negative PD1 signal to a positive CD28 signal when expressed in cells). Therefore, the PD1-CTM-CD28 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the PD1-CTM-CD28 receptor amino acid sequence described in SEQ ID NO:78. Therefore, the PD1-CTM-CD28 receptor of the present invention can be encoded by a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the PD1-CTM-CD28 receptor nucleic acid sequence described in SEQ ID NO:79.

[0300] In one embodiment, the switching receptor suitable for use in this invention is the PD1-PTM-CD28 receptor. When expressed in cells, the PD1-PTM-CD28 receptor converts a negative PD1 signal into a positive CD28 signal. The PD1-PTM-CD28 receptor includes variants of the PD1 extracellular domain, the PD1 transmembrane domain, and the CD28 cytoplasmic domain. In one embodiment, the PD1-PTM-CD28 receptor includes the amino acid sequence of SEQ ID NO:80, which may be encoded by the nucleic acid sequence of SEQ ID NO:81.

[0301] Those skilled in the art are aware of the permissible variations of the PD1-PTM-CD28 receptor while maintaining its intended biological activity (e.g., converting negative PD1 signaling to positive CD28 signaling when expressed in cells). Therefore, the PD1-PTM-CD28 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the PD1-PTM-CD28 receptor amino acid sequence described in SEQ ID NO:80. Therefore, the PD1-PTM-CD28 receptor of the present invention can be encoded by a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the PD1-PTM-CD28 receptor nucleic acid sequence described in SEQ ID NO:81.

[0302] In one embodiment, the conversion receptor suitable for use in this invention is PD1. A132L -PTM-CD28 receptor. When expressed in cells, PD1 A132L -PTM-CD28 receptors convert negative PD1 signaling to positive CD28 signaling. A point mutation at amino acid position 132 of PD1 (alanine replaced by leucine) (A132L) was found to double its affinity for PD-L1 (see, e.g., Zhang et al., Immunity (2004) 20(3), 337-347). PD1 A132L -PTM-CD28 receptors include variants of the PD1 extracellular domain, PD1 transmembrane domain, and CD28 cytoplasmic domain with an amino acid substitution at position 132 (A132L). In one embodiment, PD1 A132L The -PTM-CD28 receptor comprises the amino acid sequence of SEQ ID NO:82, which can be encoded by the nucleic acid sequence of SEQ ID NO:83.

[0303] Those skilled in the art know PD1 A132L- Tolerance for variation in the PTM-CD28 receptor while maintaining its intended biological activity (e.g., converting negative PD1 signaling to positive CD28 signaling when expressed in cells). Therefore, the PD1 of the present invention A132L The -PTM-CD28 receptor may include an amino acid sequence that corresponds to the PD1 described in SEQ ID NO:82. A132L The PTM-CD28 receptor amino acid sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity. Therefore, the PD1 of the present invention... A132L The -PTM-CD28 receptor can be encoded by a nucleic acid sequence including a sequence similar to that described in SEQ ID NO:83 for PD1. A132L -The PTM-CD28 receptor nucleic acid sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity.

[0304] In one embodiment, the switching receptor suitable for use in this invention is the PD1-4-1BB receptor. When expressed in cells, the PD1-4-1BB receptor (also referred to herein as PD1-BB) converts a negative PD1 signal into a positive 4-1BB signal. In one embodiment, the PD1-4-1BB receptor comprises the amino acid of SEQ ID NO:84, which may be encoded by the nucleic acid of SEQ ID NO:85.

[0305] Those skilled in the art are aware of the permissible variations of the PD1-4-1BB receptor while maintaining its intended biological activity (e.g., converting negative PD1 signaling to positive 4-1BB signaling when expressed in cells). Therefore, the receptor of the present invention may include an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the PD1-4-1BB receptor amino acid sequence described in SEQ ID NO:84. Therefore, the PD1-4-1BB receptor of the present invention can be encoded by a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the PD1-4-1BB receptor nucleic acid sequence described in SEQ ID NO:85.

[0306] In one embodiment, the conversion receptor suitable for use in this invention is PD1. A132L -4-1BB receptor. When expressed in cells, PD1 A132L The -4-1BB receptor (also referred to herein as PD1*BB) converts negative PD1 signals into positive 4-1BB signals. In one implementation, PD1 A132L The -4-1BB receptor includes the amino acid sequence of SEQ ID NO:86, which can be encoded by the nucleic acid sequence of SEQ ID NO:87.

[0307] Those skilled in the art know PD1 A132L -4-1BB receptor tolerance, while maintaining its intended biological activity (e.g., converting negative PD1 signaling to positive 4-1BB signaling when expressed in cells). Therefore, the PD1 of the present invention A132L The -4-1BB receptor may include an amino acid sequence that corresponds to the PD1 described in SEQ ID NO:86. A132LThe -4-1BB receptor amino acid sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity. Therefore, the PD1 of the present invention... A132L The -4-1BB receptor can be encoded by a nucleic acid sequence including a sequence similar to that described in SEQ ID NO:87 for PD1. A132L The -4-1BB receptor nucleic acid sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity.

[0308] In one embodiment, the switching receptor suitable for use in this invention is the TGFβR-IL12Rβ1 receptor. When expressed in cells, the TGFβR-IL12Rβ1 receptor converts negative TGF-β signaling into positive IL-12 signaling. In one embodiment, the TGFβR-IL12Rβ1 receptor comprises the amino acid sequence of SEQ ID NO:88, which may be encoded by the nucleic acid sequence of SEQ ID NO:89.

[0309] Those skilled in the art are aware of the permissible variations of the TGFβR-IL12Rβ1 receptor while maintaining its intended biological activity (e.g., converting negative TGF-β signaling to positive IL-12 signaling when expressed in cells). Therefore, the TGFβR-IL12Rβ1 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the TGFβR-IL12Rβ1 receptor amino acid sequence described in SEQ ID NO:88. Therefore, the TGFβR-IL12Rβ1 receptor of the present invention can be encoded by a nucleic acid sequence comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the TGFβR-IL12Rβ1 receptor nucleic acid sequence described in SEQ ID NO:89.

[0310] In one embodiment, the switching receptor suitable for use in this invention is the TGFβR-IL12Rβ2 receptor. When expressed in cells, the TGFβR-IL12Rβ2 receptor converts a negative TGF-β signal into a positive IL-12 signal. In one embodiment, the TGFβR-IL12Rβ2 receptor comprises the amino acid sequence of SEQ ID NO:90, which may be encoded by the nucleic acid sequence of SEQ ID NO:91.

[0311] Those skilled in the art are aware of the permissible variations of the TGFβR-IL12Rβ2 receptor while maintaining its intended biological activity (e.g., converting negative TGF-β signaling to positive IL-12 signaling when expressed in cells). Therefore, the TGFβR-IL12Rβ2 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the TGFβR-IL12Rβ2 receptor amino acid sequence described in SEQ ID NO:90. Therefore, the TGFβR-IL12Rβ2 receptor of the present invention can be encoded by a nucleic acid sequence comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the TGFβR-IL12Rβ2 receptor nucleic acid sequence described in SEQ ID NO:91.

[0312] In one embodiment, the switching receptor suitable for use in this invention is the TIM3-CD28 receptor. When expressed in cells, the TIM3-CD28 receptor converts a negative TIM-3 signal into a positive CD28 signal. In one embodiment, the TIM3-CD28 receptor comprises the amino acid sequence of SEQ ID NO:92, which may be encoded by the nucleic acid sequence of SEQ ID NO:93.

[0313] Those skilled in the art are aware of the permissible variations of the TIM3-CD28 receptor while maintaining its intended biological activity (e.g., converting negative TIM-3 signaling to positive CD28 signaling when expressed in cells). Therefore, the TIM3-CD28 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the TIM3-CD28 receptor amino acid sequence described in SEQ ID NO:92. Therefore, the TIM3-CD28 receptor of the present invention can be encoded by a nucleic acid sequence that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the TIM3-CD28 receptor nucleic acid sequence described in SEQ ID NO:93.

[0314] Other suitable dominant and negative receptors and switching receptors used in this invention are described in PCT Publication WO2013019615A2, the contents of which are incorporated herein by reference.

[0315] Modified immune cells

[0316] This invention provides modified immune cells or their precursor cells (e.g., modified T cells, modified NK cells, modified NKT cells) comprising the subject CAR. Therefore, such modified cells possess specificity guided by the CAR expressed therein. For example, modified cells of this invention comprising the TnMUC1 CAR are specific for MUC1 on target cells.

[0317] Any modified cell, including any antigen-binding domain, any hinge, any transmembrane domain, any intracellular membrane co-stimulatory domain, and any intracellular signal transduction domain described herein, is foreseeable and can be readily understood and manufactured by those skilled in the art based on this disclosure.

[0318] In some embodiments, the modified cells are immune cells or their precursor cells. In an exemplary embodiment, the modified cells are T cells. In an exemplary embodiment, the modified cells are autologous cells. In an exemplary embodiment, the modified cells are autologous immune cells or their precursor cells. In an exemplary embodiment, the modified cells are autologous T cells.

[0319] This invention provides modified immune cells or their precursor cells (e.g., T cells) that contain a CAR and / or a dominant / negative receptor and / or a switching receptor. Therefore, such modified cells possess specificity directed by the CAR expressed therein. For example, modified cells of this invention comprising a TnMUC1-CAR are specific for TnMUC1 on target cells.

[0320] In some embodiments, the modified cells of the present invention comprise a CAR. In one embodiment, the modified cells of the present invention comprise a CAR with affinity for TnMUC1 on target cells. In some embodiments, the modified cells of the present invention comprise a dominant negative receptor and / or a switching receptor. In one embodiment, the modified cells of the present invention comprise a dominant negative receptor capable of reducing the effect of negative signal transduction molecules in the microenvironment. In one embodiment, the modified cells of the present invention comprise a switching receptor capable of reducing the effect of negative signal transduction molecules in the microenvironment and converting negative signals to positive signals within the modified cells. In some embodiments, the modified cells of the present invention comprise a CAR and a dominant negative receptor and / or a switching receptor. In one embodiment, the modified cells of the present invention comprise a CAR with affinity for TnMUC1 on target cells, and a dominant negative receptor and / or a switching receptor. The modified cells of the present invention comprising a dominant negative receptor and / or a switching receptor are capable of binding negative signal transduction molecules (e.g., inhibitory ligands) in the microenvironment through their respective extracellular domains. In some embodiments, the modified cells of the present invention, including a dominant negative receptor, are capable of reducing the effect of negative signal transduction molecules in the microenvironment, wherein the dominant negative receptor includes an extracellular domain associated with negative signaling. In some embodiments, the modified cells of the present invention, including a conversion receptor, are capable of converting the effect of negative signal transduction molecules in the microenvironment into a positive signal, wherein the conversion receptor includes an extracellular domain associated with negative signaling and an intracellular domain associated with positive signaling.

[0321] In an exemplary embodiment, the modified cells of the present invention comprise dominant negative receptors capable of reducing the effects of negative signal transduction molecules. In one embodiment, the modified cells of the present invention comprise TGFβRII-DN.

[0322] In an exemplary embodiment, the modified cells of the present invention include a conversion receptor capable of converting the action of negative signal transduction molecules into a positive (e.g., activating) signal within the modified cells. In one embodiment, the modified cells of the present invention include PD1-CTM-CD28. In another embodiment, the modified cells of the present invention include PD1 A132L -PTM-CD28. In one embodiment, the modified cells of the present invention comprise TIM3-CD28.

[0323] In an exemplary embodiment, the modified cells of the present invention comprise a TnMUC1-CAR and a dominant negative receptor capable of reducing the effects of negative signal transduction molecules. In one embodiment, the modified cells of the present invention comprise a TnMUC1-CAR and a TGFβRII-DN. Such modified cells (e.g., modified T cells) not only have an affinity for TnMUC1 on target cells but are also able to reduce inhibitory TGF-β signaling from the microenvironment in which they are present.

[0324] In an exemplary embodiment, the modified cells of the present invention comprise MUC1-CAR and a conversion receptor capable of converting the inhibitory effects of negative signal transduction molecules into positive signals within the modified cells. In one embodiment, the modified cells of the present invention comprise MUC1-CAR and PD1-CTM-CD28. In another embodiment, the modified cells of the present invention comprise MUC1-CAR and PD1 A132L -PTM-CD28. In one embodiment, the modified cells of the present invention comprise MUC1-CAR and TIM3-CD28. In one embodiment, the modified cells of the present invention comprise MUC1 CAR and PD1-4-1BB. In one embodiment, the modified cells of the present invention comprise MUC1-CAR and PD1 A132L -4-1BB. In one embodiment, the modified cells of the present invention comprise MUC1-CAR and TGFβR-IL12Rβ1. These modified cells (e.g., modified T cells) not only have an affinity for MUC1 on target cells, but are also capable of converting inhibitory PD-1, TIMI1, or TGFβ signals from the microenvironment into positive (e.g., activating) signals within the modified cells. These modified cells (e.g., modified T cells) not only have an affinity for MUC1 on target cells, but are also capable of converting inhibitory PD-1 or TIM-3 signals from the microenvironment into positive (e.g., activating) CD28 signals within the modified cells.

[0325] In an exemplary embodiment, the modified cells of the present invention include MUC1-CAR, TGFβRII-DN, and PD1-CTM-CD28.

[0326] Nucleic acids and expression vectors

[0327] This invention provides nucleic acids encoding CARs with affinity for MUC1 (e.g., Tn-MUC1). As described herein, the subject CAR includes an antigen-binding domain (e.g., a MUC1-binding domain), a transmembrane domain, and an intracellular domain. Therefore, this invention provides nucleic acids encoding the antigen-binding domain (e.g., a MUC1-binding domain), transmembrane domain, and intracellular domain of the subject CAR.

[0328] In an exemplary embodiment, the nucleic acid encoding the MUC1 CAR of the present invention is encoded by a nucleic acid sequence comprising the nucleotide sequences described in SEQ ID NOs: 1, 38, 40, 42, 44 or 46.

[0329] In some embodiments, the present invention provides nucleic acids encoding CARs and / or dominant / negative receptors and / or switching receptors. In one embodiment, the nucleic acid of this disclosure includes a nucleic acid sequence encoding the subject CAR of the present invention (e.g., TnMUC1-CAR). In one embodiment, the nucleic acid of this disclosure includes a nucleic acid sequence encoding a dominant / negative receptor and / or switching receptor (e.g., PD1-PTM-CD28 receptor).

[0330] In some embodiments, the nucleic acids of this disclosure provide for the production of CARs and / or dominant / negative receptors and / or switching receptors as described herein in mammalian cells. In some embodiments, the nucleic acids of this disclosure provide for the amplification of nucleic acids encoding CARs and / or dominant / negative receptors and / or switching receptors.

[0331] As described herein, the subject CAR includes an antigen-binding domain, a transmembrane domain, and an intracellular domain. Therefore, this disclosure provides nucleic acids encoding the antigen-binding domain, transmembrane domain, and intracellular domain of the subject CAR. As described herein, various dominant negative receptors and switching receptors are provided. Therefore, this invention provides nucleic acids encoding dominant negative receptors and / or switching receptors.

[0332] In some embodiments, the nucleic acid encoding the CAR is isolated from the nucleic acid encoding the dominant negative receptor and / or the switching receptor. In an exemplary embodiment, the nucleic acid encoding the CAR and the nucleic acid encoding the dominant negative receptor and / or the switching receptor are present in the same nucleic acid.

[0333] In some embodiments, the nucleic acids of the present invention comprise nucleic acids containing a CAR-coding sequence and a dominant negative receptor and / or conversion receptor coding sequence. In some embodiments, the nucleic acids of the present invention comprise nucleic acids containing a CAR-coding sequence and a dominant negative receptor and / or conversion receptor coding sequence separated by a linker. The linkers used in the present invention (e.g., in the context of linking a CAR-coding sequence and a dominant negative receptor and / or conversion receptor coding sequence) allow multiple proteins (e.g., polycistronic or bicistronic sequences) to be encoded by the same nucleic acid sequence, which are translated into multiproteins that dissociate into individual protein components. For example, the linkers used in the nucleic acids of this disclosure containing a CAR-coding sequence and a dominant negative receptor and / or conversion receptor coding sequence allow the CAR and dominant negative receptor and / or conversion receptor to be translated into multiproteins that dissociate into individual CAR and dominant negative receptor and / or conversion receptor components.

[0334] In some embodiments, the adapter includes a nucleic acid sequence encoding an internal ribosome entry site (IRES). As used herein, "internal ribosome entry site" or "IRES" refers to an element that facilitates direct entry of an internal ribosome into a start codon (such as ATG) of a protein-coding region, thereby enabling cap-independent translation of the gene. Various internal ribosome entry sites are known to those skilled in the art, including but not limited to IRES obtained from viral or cellular mRNA sources such as immunoglobulin heavy chain binding protein (BiP); vascular endothelial growth factor (VEGF); fibroblast growth factor 2; insulin-like growth factor; translation initiation factor eIF4G; yeast transcription factors TFIID and HAP4; and IRES obtained from sources such as cardiac virus, rhinovirus, foot-and-mouth disease virus, HCV, Fried's murine leukemia virus (FrMLV), and Moroni's murine leukemia virus (MoMLV). Those skilled in the art will be able to select IRES suitable for use in this invention.

[0335] In some embodiments, the linker includes a nucleic acid sequence encoding a self-cleaving peptide. As used herein, a "self-cleaving peptide" or "2A peptide" refers to an oligopeptide that allows multiple proteins to be encoded into a multi-protein complex, which dissociates post-translationally into component proteins. The use of the term "self-cleaving" does not imply a hydrolytic cleavage reaction. Various self-cleaving peptides or 2A peptides are known to those skilled in the art, including but not limited to those found in members of the Picornaviridae family, such as foot-and-mouth disease virus (FMDV), equine rhinitis A virus (ERAVO), TaV, and swine tertisvirus-1 (PTV-1), and cardiogenic viruses such as Theilovirus and encephalomyocarditis virus. 2A peptides derived from FMDV, ERAV, PTV-1, and TaV are referred to herein as "F2A," "E2A," "P2A," and "T2A," respectively. Those skilled in the art will be able to select a self-cleaving peptide suitable for use in this invention.

[0336] In some embodiments, the nucleic acid of this disclosure comprises a nucleic acid sequence containing a CAR-coding sequence and a dominant / negative receptor and / or switching receptor-coding sequence separated by a linker, the linker comprising a T2A peptide sequence. In some embodiments, the T2A peptide sequence comprises the amino acid sequence ERGSLLTCGDVEENPGP (SEQ ID NO: 94), which may be encoded by the nucleic acid sequence GA GGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT (SEQ ID NO: 95). In some embodiments, the linker comprising the T2A peptide sequence may further comprise a spacer region sequence described herein. For example, the linker comprising the T2A peptide sequence may further comprise a spacer region containing the amino acid sequence SGRSGGG (SEQ ID NO: 96), which may be encoded by the nucleic acid sequence TCCGGAAGATCTGGCGGCGGA (SEQ ID NO: 97).

[0337] In some embodiments, the nucleic acid of this disclosure comprises a nucleic acid sequence containing a CAR-coding sequence and a dominant / negative receptor and / or switching receptor-coding sequence separated by a linker, the linker comprising an F2A peptide sequence. In some embodiments, the F2A peptide sequence comprises the amino acid sequence VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:98), which may be encoded by the nucleic acid sequence GTGAAACAGACTTTGAATTTTGACCTTCTCAAGTTGGCGGGAGACGTGGAGTCCAACCC AGGGCCG (SEQ ID NO:99).

[0338] In some embodiments, the adapter further includes a nucleic acid sequence encoding a furin cleavage site. Frin is a universally expressed protease present in trans-Gorgites and is used to process its precursors prior to protein secretion. Frin cleaves at the COOH-terminus of its common recognition sequence. Common recognition sequences (or “furin cleavage sites”) of various furin proteases are known to those skilled in the art, including but not limited to Arg-X-Lys-Arg (SEQ ID NO:100) or Arg-X-Arg-Arg (SEQ ID NO:101), and Arg-XX-Arg (SEQ ID NO:102), such as Arg-Gln-Lys-Arg (SEQ ID NO:103), where X is any naturally occurring amino acid. Another example of a furin cleavage site is X1-Arg-X2-X3-Arg (SEQ ID NO:104), where X1 is Lys or Arg, X2 is any naturally occurring amino acid, and X3 is Lys or Arg. Those skilled in the art will be able to select a suitable furin cleavage site for use in this invention.

[0339] In some embodiments, the adapter includes a nucleic acid sequence encoding a combination of a furin cleavage site and a 2A peptide. Examples include, but are not limited to, adapters including nucleic acid sequences encoding furin and F2A, adapters including nucleic acid sequences encoding furin and E2A, adapters including nucleic acid sequences encoding furin and P2A, and adapters including nucleic acid sequences encoding furin and T2A. Those skilled in the art will be able to select a suitable combination for use in this invention. In such embodiments, the adapter may further include a spacer region sequence between the furin and the 2A peptide. Various spacer region sequences are known in the art, including but not limited to glycine-serine (GS) spacers, such as (GS)n, (GSGGS)n (SEQ ID NO: 52), and (GGGS)n (SEQ ID NO: 53), where n represents an integer of at least 1. Exemplary spacer sequences may include, but are not limited to, amino acid sequences such as GGSG (SEQ ID NO:55), GGSGG (SEQ ID NO:56), GGSSG (SEQ ID NO:57), GGSGG (SEQ ID NO:58), GGGSG (SEQ ID NO:59), GSSSG (SEQ ID NO:60), etc. Those skilled in the art will be able to select suitable spacer sequences for use in this invention.

[0340] In some embodiments, the nucleic acid of this disclosure comprises a nucleic acid sequence containing a CAR-coding sequence and a dominant / negative receptor and / or switching receptor-coding sequence separated by a furin-(G4S)2-T2A (F-GS2-T2A) linker. The F-GS2-T2A linker may be encoded by the nucleic acid sequence CGTGCGAAGAGGGGCGGCGGGGGCTCCGGCGGGGGAGGCAGTGAG GGCCGCGGCTCCCTGCTGACCTGCGGAGATGTAGAAGAGAACCCAGGCCCC (SEQ ID NO: 105) and may include the amino acid sequence RAKRGGGGSGGGGSEGRGSLLTCGDVEENPGP (SEQ ID NO: 106). Those skilled in the art will recognize that the linker of the present invention may include permissible sequence variations.

[0341] In some embodiments, the present invention provides a nucleic acid comprising a nucleic acid sequence encoding the dominant negative receptor and / or conversion receptor described herein. In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding the dominant negative receptor and / or conversion receptor and a nucleic acid sequence encoding a CAR (e.g., TnMUC1-CAR) as described herein. In one embodiment, the nucleic acid sequence encoding the dominant negative receptor and / or conversion receptor and the nucleic acid sequence encoding the CAR are present on separate nucleic acids. In one embodiment, the nucleic acid sequence encoding the dominant negative receptor and / or conversion receptor and the nucleic acid sequence encoding the CAR are present within the same nucleic acid. In such embodiments, the nucleic acid sequence encoding the dominant negative receptor and / or conversion receptor and the nucleic acid sequence encoding the CAR are separated by a linker described herein.

[0342] For example, the nucleic acid of this disclosure may include a nucleic acid sequence encoding a dominant receptor, a linker, and a nucleic acid sequence encoding a CAR. In one embodiment, the linker includes a nucleic acid sequence encoding a 2A peptide (e.g., T2A). In an exemplary embodiment, the nucleic acid of this disclosure may include a nucleic acid sequence encoding a dominant negative receptor and / or a switching receptor and a nucleic acid sequence encoding a CAR, separated by a linker sequence including a nucleic acid sequence encoding T2A.

[0343] Therefore, in one embodiment, the nucleic acid from 5' to 3' of this disclosure includes: a nucleic acid sequence encoding a dominant negative receptor and / or a switching receptor, a nucleic acid sequence encoding an adapter, and a nucleic acid sequence encoding a CAR. In one embodiment, the nucleic acid from 5' to 3' of this disclosure includes a nucleic acid sequence encoding a CAR, a CAR encoding an adapter, and a nucleic acid sequence encoding a dominant negative receptor and / or a switching receptor.

[0344] Therefore, in exemplary embodiments, the nucleic acids of the present invention from 5' to 3' include: a nucleic acid sequence encoding TGFβRII-DN, a nucleic acid sequence encoding a linker including a 2A peptide (e.g., T2A), and a nucleic acid sequence encoding MUC1-CAR (e.g., SEQ ID NO: 1, 38, 40, 42, 44, or 46). In one embodiment, the nucleic acids of the present disclosure from 5' to 3' include: a nucleic acid encoding MUC1-CAR, a nucleic acid encoding a linker including a 2A peptide (e.g., T2A), and a nucleic acid encoding a dominant negative receptor and / or a switching receptor.

[0345] In some embodiments, the nucleic acids of this disclosure can be operatively linked to transcriptional control elements, such as promoters and enhancers. Those skilled in the art will recognize suitable promoter and enhancer elements.

[0346] For expression in bacterial cells, suitable promoters include, but are not limited to, lacI, lacZ, T3, T7, gpt, λP, and trc. For expression in eukaryotic cells, suitable promoters include, but are not limited to, light chain and / or heavy chain immunoglobulin gene promoters and enhancer elements; cytomegalovirus immediate early promoters; herpes simplex virus thymidine kinase promoters; early and late SV40 promoters; promoters in long terminal repeats of retroviruses; mouse metallothionein-I promoters; and various tissue-specific promoters known in the art. Suitable reversible promoters (including reversibly inducible promoters) are known in the art. Such reversible promoters can be isolated and derived from many organisms, such as eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism (e.g., a first prokaryote and a second eukaryote, or a first eukaryote and a second prokaryote, etc.) is known in the art. Such reversible promoters, and systems based on such reversible promoters but also including other control proteins, include, but are not limited to, alcohol-regulated promoters (e.g., the alcohol dehydrogenase I (alcA) gene promoter, promoters that respond to alcohol transactivator protein (A1cR), etc.), tetracycline-regulated promoters (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), and steroid-regulated promoters (e.g., the rat glucocorticoid receptor promoter system, the human estrogen receptor promoter system, retinoids, etc.). Promoter systems include: thyroid promoter system, ecdysone promoter system, mifepristone promoter system, etc.; metal-regulated promoters (such as metallothionein promoter system, etc.); pathogen-regulated promoters (such as salicylic acid-regulated promoters, ethylene-regulated promoters, benzothiadiazole-regulated promoters, etc.); temperature-regulated promoters (such as heat shock-inducible promoters (such as HSP-70, HSP-90, soybean heat shock promoter, etc.); light-regulated promoters; and synthesis-inducible promoters, etc.

[0347] In some implementations, the promoter is a CD8 cell-specific promoter, a CD4 cell-specific promoter, a neutrophil-specific promoter, or an NK cell-specific promoter. For example, the CD4 gene promoter can be used; see, e.g., Salmon et al., Proc. Natl. Acad. Sci. USA (1993) 90:7739; and Marodon et al. (2003) Blood 101:3416. As another example, the CD8 gene promoter can be used. NK cell-specific expression can be achieved by using the NcrI(p46) promoter; see, e.g., Eckelhart et al., Blood (2011) 117:1565.

[0348] For expression in yeast cells, suitable promoters are constitutive promoters, such as the ADH1 promoter, PGK1 promoter, ENO promoter, and PYK1 promoter; or regulated promoters, such as the GAL1 promoter, GAL10 promoter, ADH2 promoter, PHOS promoter, CUP1 promoter, GALT promoter, MET25 promoter, MET3 promoter, CYC1 promoter, HIS3 promoter, ADH1 promoter, PGK promoter, GAPDH promoter, ADC1 promoter, TRP1 promoter, URA3 promoter, LEU2 promoter, ENO promoter, TP1 promoter, and AOX1 (e.g., for Pichia pastoris). The selection of a suitable vector and promoter is entirely within the scope of a person skilled in the art.Suitable promoters for prokaryotic host cells include, but are not limited to, phage T7 RNA polymerase promoters; trp promoters; lac operon promoters; heterozygous promoters, such as lac / tac heterozygous promoters, tac / trc heterozygous promoters, trp / lac promoters, T7 / lac promoters; trc promoters; tac promoters, etc.; araBAD promoters; in vivo regulatory promoters, such as ssaG promoters or related promoters (see, e.g., US Patent Publication No. 20040131637), pagC promoters (Pulkkinen and Miller, J. Bacter). iol. (1991) 173(1): 86-93; Alpuche-Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89(21): 10079-83), nirB promoter (Harborne et al., Mol. Micro. (1992) 6: 2805-2813), etc. (see, e.g., Dunstan et al., Infect. Immun. (1999) 67: 5133-5141; McKelvie et al.) Vaccine (2004) 22:3243-3255; and Chatfield et al., Biotechnol. (1992) 10:888-892); Σ70 promoters, such as the co-occurring σ70 promoters (see, e.g., GenBank accession numbers AX79898, AX798961, and AX798183); stationary phase promoters, such as the dps promoter, the spv promoter, etc.; promoters derived from the pathogenic island SPI-2 (see, e.g., WO96 / 17951); actA Promoters (see, e.g., Shetron-Rama et al., Infect. Immun. (2002) 70:1087-1096); rpsM promoter (see, e.g., Valdivia and Falkow Mol. Microbiol. (1996). 22:367); tet promoter (see, e.g., Hillen, W. and Wissmann, A. (1989) In Saenger, W. and Heinemann, U. (eds), Topics in Molecular and Structural Biology, protein--Nucleic Acid Interaction. Macmillan, London, UK, Vol. 10, pp. 143-162); SP6 promoter (see, e.g., Melton et al., Nucl. Acids Res. (1984) 12:7035); etc. Suitable strong promoters for prokaryotes (such as Escherichia coli) include, but are not limited to, Trc, Tac, T5, T7, and P Lambda.Non-limiting examples of operator genes used in bacterial host cells include lactose promoter operator genes (where the LacI repressor protein changes conformation upon contact with lactose, thereby preventing the Lad repressor protein from binding to the operator gene), tryptophan promoter operator genes (where the TrpR repressor protein has a conformation that binds to the operator gene when complexed with tryptophan; and a conformation that does not bind to the operator gene in the absence of tryptophan), and tac promoter operator genes (see, e.g., deBoer et al., Proc. Natl. Acad. Sci. USA (1983) 80:21-25).

[0349] Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter capable of driving high-level expression of any polynucleotide sequence operably linked to it. However, other constitutive promoter sequences may also be used, including but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, ELISA virus immediate early promoter, Rous sarcoma virus promoter, EF-1α promoter, and human gene promoters such as, but not limited to, actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. Furthermore, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also considered as part of the invention. Using inducible promoters provides a molecular switch that can turn on the expression of the polynucleotide sequence operably linked to it when expression is needed, or turn off the expression when expression is not needed. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0350] In some embodiments, a locus or construct or transgene containing a suitable promoter is irreversibly converted by induction using an induction system. Suitable systems for inducing irreversible conversion are well known in the art; for example, the induction of irreversible conversion can utilize Cre-lox-mediated recombination (see, e.g., Fuhrmann-Benzakein, et al., Proc. Natl. Acad. Sci. USA (2000) 28:e99, the disclosure of which is incorporated herein by reference). Any suitable combination of recombinases, endonucleases, ligases, recombination sites, etc., known in the art can be used to generate promoters for irreversible conversion. Methods, mechanisms, and requirements for site-specific recombination described elsewhere herein can be used to generate promoters for irreversible conversion and are well known in the art; see, e.g., Grindley et al., Annual Review of Biochemistry (2006) 567-605; and Tropp, Molecular Biology (2012) (Jones & Bartlett Publishers, Sudbury, MA), the disclosure of which is incorporated herein by reference.

[0351] In some embodiments, the nucleic acid of this disclosure further includes a nucleic acid sequence encoding a CAR-inducible expression cassette. In one embodiment, the CAR-inducible expression cassette is used to produce a transgenic polypeptide product based on CAR signaling release. See, for example, Chmielewski and Abken, Expert Opin. Biol. Ther. (2015) 15(8):1145-1154; and Abken, Immunotherapy (2015) 7(5):535-544.

[0352] The nucleic acids disclosed herein can be present in expression vectors and / or cloning vectors. Expression vectors may include selectable markers, origins of replication, and other features that provide for vector replication and / or maintenance. Suitable expression vectors include, for example, plasmids, viral vectors, etc. A large number of suitable vectors and promoters are known to those skilled in the art; many are commercially available for generating the subject recombinant constructs. The following vectors are provided by way of example, but should not be construed as limiting: Bacteria: pBs, bacteriophages, PsiX174, pBluescriptSK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden). Eukaryotes: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

[0353] Expression vectors typically have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins. Alternative markers that operate within the expression host may also be present. Suitable expression vectors include, but are not limited to, viral vectors (e.g., poxvirus-based viral vectors; poliovirus; adenoviruses (see, e.g., Li et al., Invest. Opthalmol. Vis. Sci. (1994) 35:2543-2549; Borras et al., Gene Ther. (1999) 6:515-524; Li and Davidson, Proc. Natl. Acad. Sci. USA (1995) 92:7700-7704; Sakamoto et al., H. Gene Ther. (1999) 5:1088-1097; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655); adeno-associated viruses (see, e.g., Ali et al., Hum. Gene Ther.). Ther. (1998) 9:81-86, Flannery et al., Proc. Natl. Acad. Sci. USA (1997) 94:6916-6921; Bennett et al., Invest. Opthalmol. Vis. Sci. (1997) 38:2857-2863; Jomary et al., Gene Ther. (1997) 4:683-690, Rolling et al., Hum. Gene Ther. (1999) 10:641-648; Ali et al., Hum. Mol. Genet. (1996) 5:591-594; Srivastava in WO 93 / 09239, Samulski et al., J. Vir. (1989) 63:3822-3828; Mendelson et al., Virol. (1988) 166:154-165; and Flotte et al., Proc. Natl. Acad. Sci. USA (1993) 90:10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., P roc.Natl.Acad.Sci.USA(1997)94:10319-23; Takahashi et al., J.Virol.(1999)73:7812-7816); retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, familial leukemia virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and breast tumor virus); etc.

[0354] Other suitable expression vectors include, but are not limited to, lentiviral vectors, gamma retroviral vectors, foamy virus vectors, adeno-associated virus vectors, adenovirus vectors, poxvirus vectors, herpesvirus vectors, engineered hybrid viral vectors, transposon-mediated vectors, etc. Viral vector technology is well known in the art and described, for example, in Sambrook et al., 2012, *Molecular Cloning: A Laboratory Manual*, volumes 1-4, Cold Spring Harbor Press, NY, and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses.

[0355] Typically, a suitable vector contains a replication origin that functions in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more optional markers (e.g., WO01 / 96584, WO01 / 29058, and U.S. Patent No. 6,326,193).

[0356] In some embodiments, the expression vector (e.g., a lentiviral vector) can be used to introduce CAR into immune cells or their precursors (e.g., T cells). Therefore, the expression vector (e.g., a lentiviral vector) of the present invention can include nucleic acid encoding CAR. In some embodiments, the expression vector (e.g., a lentiviral vector) will include additional elements that assist in the functional expression of the CAR encoded therein. In some embodiments, the expression vector including nucleic acid encoding CAR further includes a mammalian promoter. In one embodiment, the vector further includes an elongation factor-1-α promoter (EF-1α promoter). Using an EF-1α promoter can increase the efficiency of downstream transgene expression (e.g., the nucleic acid sequence encoding CAR). Physiological promoters (e.g., EF-1α promoters) can reduce the likelihood of inducing integration-mediated genotoxicity and can disable the ability of retroviral vectors to transform stem cells. Other physiological promoters suitable for vectors (e.g., lentiviral vectors) are known to those skilled in the art and can be incorporated into the vectors of the present invention. In some embodiments, the vector (e.g., a lentiviral vector) further includes a non-essential cis-acting sequence that can enhance titer and gene expression. A non-limiting example of a non-essential cis-acting sequence is the central polypurine bundle (cPPT / CTS), which is important for efficient reverse transcription and nuclear delivery. Other non-essential cis-acting sequences are known to those skilled in the art and can be incorporated into the vectors of the present invention (e.g., lentiviral vectors). In some embodiments, the vector further includes a post-transcriptional regulatory element. Post-transcriptional regulatory elements can enhance RNA translation, enhance transgene expression, and stabilize RNA transcripts. An example of a post-transcriptional regulatory element is the marmot hepatitis virus post-transcriptional regulatory element (WPRE). Therefore, in some embodiments, the vectors of the present invention further include a WPRE sequence. Various post-transcriptional regulatory elements are known to those skilled in the art and can be incorporated into the vectors of the present invention (e.g., lentiviral vectors). The vectors of the present invention may further include additional elements, such as rev response elements (RRE) for RNA transport, packaging sequences, and 5' and 3' long terminal repeats (LTRs). The term "long terminal repeat" or "LTR" refers to a base pair domain located at the end of the retroviral DNA, comprising the U3, R, and U5 regions. LTRs typically provide the functions required for the expression of retroviral genes (e.g., promotion, initiation, and polyadenylation of gene transcripts) and for viral replication. In one embodiment, the vector of the present invention (e.g., a lentiviral vector) comprises a 3'U3-deleted LTR. Therefore, the vector of the present invention (e.g., a lentiviral vector) may include any combination of elements described herein that enhance the functional expression efficiency of transgenes.For example, in addition to the nucleic acid encoding CAR, the vector of the present invention (e.g., lentiviral vector) may also include WPRE sequence, cPPT sequence, RRE sequence, 5'LTR, and 3'U3-deleted LTR'.

[0357] The vector of this invention can be a self-inactivating vector. As used herein, the term "self-inactivating vector" refers to a vector in which the 3'LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution). Self-inactivating vectors can prevent viral transcription beyond the first round of viral replication. Therefore, self-inactivating vectors may be able to infect and then integrate into the host genome (e.g., mammalian genome) only once, and cannot be further transmitted. Thus, self-inactivating vectors can significantly reduce the risk of generating replicating viruses.

[0358] In some embodiments, the nucleic acid of the present invention may be RNA, such as in vitro synthesized RNA. Methods for in vitro RNA synthesis are known to those skilled in the art; RNA comprising a sequence encoding the CAR disclosed herein may be synthesized using any known method. Methods for introducing RNA into host cells are known to those skilled in the art. See, for example, Zhao et al., Cancer Res. (2010) 15:9053. Methods for introducing RNA comprising a nucleotide sequence encoding the CAR disclosed herein into host cells may be performed in vitro, ex vivo, or in vivo. For example, host cells (e.g., NK cells, cytotoxic T lymphocytes, etc.) may be electroporated in vitro or ex vivo using RNA comprising a nucleotide sequence encoding the CAR disclosed herein.

[0359] To assess the expression of the peptide or its fraction, the expression vector to be introduced into cells may also contain an optional marker gene or reporter gene, or both, to facilitate the identification and selection of expressing cells from a population of cells transfected or infected by a viral vector. In some embodiments, the optional marker may be carried on a separate DNA fragment and used in a co-transfection procedure. The optional marker and reporter gene may be side-linked with appropriate regulatory sequences to enable their expression in host cells. Useful optional markers include, but are not limited to, antibiotic resistance genes.

[0360] Reporter genes are used to identify potentially transfected cells and assess the function of regulatory sequences. Generally, reporter genes are absent or not expressed in the recipient organism or tissue and encode polypeptides whose expression can be detected by easily detectable properties (e.g., enzymatic activity). Reporter gene expression is assessed at an appropriate time after DNA is introduced into recipient cells. Suitable reporter genes may include, but are not limited to, genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein (e.g., Ui-Tei et al., 2000 FEBS Letters 479:79-82).

[0361] Methods for generating modified immune cells

[0362] This invention provides a method for generating / creating modified immune cells or their precursor cells (e.g., T cells / NK cells / NKT cells). Typically, this is achieved by introducing nucleic acids encoding a topic CAR (e.g., MUC1 CAR) to modify the cells.

[0363] Methods for introducing nucleic acids into cells include physical, biological, and chemical approaches. Physical methods for introducing polynucleotides such as RNA into host cells include calcium phosphate precipitation, lipid transfection, particle bombardment, microinjection, and electroporation. Commercially available methods, including electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Massachusetts)), or Gene Pulser II (BioRad, Denver, Colorado), and Multiporator (Eppendorf, Hamburg, Germany), can be used to introduce RNA into target cells. Transfection mediated by cationic liposomes—using lipid transfection, using polymer encapsulation, using peptide-mediated transfection, or using biolistic particle delivery systems (e.g., “gene guns”)—can also be used to introduce RNA into cells. (See, for example, Nishikawa et al., Hum Gene Ther., 12(8):861-70 (2001))

[0364] Biological approaches to introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian cells, such as human cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, among others. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.

[0365] In some embodiments, the nucleic acid encoding the subject CAR of the present invention is introduced into cells via an expression vector. Expression vectors encoding the subject CAR (e.g., MUC1 CAR) are provided herein. Suitable expression vectors include lentiviral vectors, gamma retroviral vectors, foam virus vectors, adeno-associated virus (AAV) vectors, adenovirus vectors, engineered hybrid viruses, naked DNA, including but not limited to transposon-mediated vectors such as Sleeping Beauty, Piggybak, and Integrases (such as Phi31). Some other suitable expression vectors include herpes simplex virus (HSV) and retroviral expression vectors.

[0366] Adenoviral expression vectors are based on adenoviruses, which have low capacity for integration into genomic DNA but high efficiency for transfecting host cells. Adenoviral expression vectors contain packaging sufficient to (a) support the expression vector and (b) ultimately express the subject CAR in host cells. In some embodiments, the adenoviral genome is a 36kb linear, double-stranded DNA in which a foreign DNA sequence (e.g., nucleic acid encoding the subject CAR) can be inserted to replace large sections of adenoviral DNA, thereby preparing the expression vector of the present invention (see, e.g., Danthinne and Imperiale, Gene Therapy (2000) 7(20):1707-1714).

[0367] Another expression vector is based on adeno-associated virus (AAV), which utilizes an adenovirus coupling system. This AAV expression vector has a high frequency of integration into the host genome. It can infect non-dividing cells, thereby making it suitable for delivering genes into mammalian cells, for example, in tissue cultures or in vivo. AAV vectors have a wide host range for infectivity. Details relating to the production and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.

[0368] Retroviral expression vectors can integrate into the host genome, deliver large amounts of foreign genetic material, infect a wide range of species and cell types, and be packaged in specialized cell lines. Retroviral vectors are constructed by inserting nucleic acids (e.g., those encoding a theme CAR) into the viral genome at certain locations to create replication-defective viruses. Although retroviral vectors can infect multiple cell types, integration and stable expression of a theme CAR require the division of the host cell.

[0369] Lentiviral vectors are derived from lentiviruses, which are complex retroviruses containing, in addition to the common retroviral genes gag, pol, and env, other genes with regulatory or structural functions (see, for example, U.S. Patent Nos. 6,013,516 and 5,994,136). Some examples of lentiviruses include human immunodeficiency virus (HIV-1, HIV-2) and simian immunodeficiency virus (SIV). Lentiviral vectors have been produced by repeatedly attenuating HIV virulence genes, for example, by deleting genes env, vif, vpr, vpu, and nef, making the vectors biologically safe. Lentiviral vectors can infect non-dividing cells and can be used for in vivo and in vitro gene transfer and expression, such as in vivo and in vitro gene transfer and expression of nucleic acids encoding the subject CAR (see, for example, U.S. Patent No. 5,994,136).

[0370] Expression vectors comprising the nucleic acids of this disclosure can be introduced into host cells by any method known to those skilled in the art. If desired, the expression vector may include a viral sequence for transfection. Optionally, the expression vector can be introduced by fusion, electroporation, bio-projectiles, transfection, lipid transfection, etc. Host cells can be grown and amplified in a culture prior to the introduction of the expression vector, followed by appropriate treatment to introduce and integrate the vector. The host cells can then be amplified and screened using markers present in the vector. Various markers known in the art can be used and may include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc. As used herein, the terms “cell,” “cell line,” and “cell culture” may be used interchangeably. In some embodiments, the host cell is an immune cell or its precursor, such as a T cell, NK cell, or NKT cell.

[0371] The present invention also provides genetically engineered cells that include and stably express the subject matter CAR of this disclosure. In some embodiments, the genetically engineered cells are genetically engineered T lymphocytes (T cells), regulatory T cells (Tregs), immature T cells (TN), memory T cells (e.g., central memory T cells (TCM), effector memory cells (TEM)), natural killer cells (NK cells), natural killer T cells (NKT cells), and macrophages capable of producing treatment-related progeny. In one embodiment, the genetically engineered cells are autologous cells.

[0372] Modified cells (e.g., including the subject CAR) can be generated by stable transfection of host cells using expression vectors comprising nucleic acids of this disclosure. Other methods for generating modified cells of this disclosure include, but are not limited to, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes, and / or cationic polymers), non-chemical transformation methods (e.g., electroporation, phototransformation, gene electrotransfer, and / or hydrodynamic delivery), and / or particle-based methods (e.g., impalefection, gene gun, and / or magnetofection). Transfected cells expressing the subject CAR of this disclosure can be expanded in vitro.

[0373] Physical methods for introducing expression vectors into host cells include calcium phosphate precipitation, lipid transfection, particle bombardment, microinjection, and electroporation. Methods for generating cells comprising the vector and / or exogenous nucleic acids are known in the art. See, for example, Sambrook et al. (2001), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.

[0374] Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems (e.g., macromolecular complexes, nanocapsules, microspheres, beads) and lipid-based systems (e.g., oil-in-water emulsions, micelles, mixed micelles, and liposomes). An exemplary colloidal system used as a delivery carrier in vitro and in vivo is the liposome (e.g., artificial membrane vesicle).

[0375] Suitable lipids are available from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) is available from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) is available from K&K Laboratories (Plainview, NY); cholesterol (“Choi”) is available from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, AL). Lipids in stock solutions in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform is used as the sole solvent because it evaporates more readily than methanol. “Liposome” is a general term encompassing various monolayer and multilayer lipid carriers formed by the production of closed lipid bilayers or aggregates. Liposomes may be characterized by a vesicular structure with a phospholipid bilayer membrane and an internal aqueous culture medium. Multilayer liposomes have multiple lipid layers separated by an aqueous culture medium. Phospholipids spontaneously form when suspended in excess aqueous solution. Before forming a closed structure, the lipid components undergo rearrangement, trapping water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions exhibiting structures in solution different from normal vesicle structures are also included. For example, lipids may present as micelle structures or simply as heterogeneous aggregates of lipid molecules. Lipid-transfected amine-nucleic acid complexes have also been considered.

[0376] Whether used to introduce exogenous nucleic acids into host cells or otherwise expose cells to the inhibitors of this invention, a variety of assays can be performed to confirm the presence of nucleic acids in host cells. Such assays include, for example, "molecular biology" assays known to those skilled in the art (e.g., DNA blotting and RNA blotting, RT-PCR and PCR); "biochemical" assays, such as detecting the presence or absence of specific peptides, such as by immunological methods (ELISA and Western blotting), or by the assays described herein, to identify reagents falling within the scope of this invention.

[0377] Furthermore, nucleic acids can be introduced into T cells by any means, such as transduced, transfected, and electroporated T cells. One nucleic acid can be introduced using one method, while another nucleic acid can be introduced into T cells using different methods.

[0378] RNA

[0379] In one embodiment, the nucleic acid introduced into the host cell is RNA. In another embodiment, the RNA is mRNA, which comprises in vitro transcribed RNA or synthetic RNA. RNA is produced by in vitro transcription using a template generated by polymerase chain reaction (PCR). Target DNA from any source can be directly converted into a template by PCR for in vitro mRNA synthesis using suitable primers and RNA polymerase. The DNA source can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequences, or any other suitable DNA source.

[0380] PCR can be used to generate templates for in vitro transcription of mRNA, which are then introduced into cells. Methods for performing PCR are known in the art. Primers used for PCR are designed to have regions substantially complementary to a DNA region that can serve as a PCR template. As used herein, “substantially complementary” means a nucleotide sequence in which most or all of the bases are complementary, or one or more bases are not complementary or mismatched. Substantially complementary sequences are capable of annealing or hybridizing with the intended DNA target under annealing conditions used for PCR. Primers can be designed to be substantially complementary to any portion of the DNA template. For example, primers can be designed to amplify portions of a gene that are normally transcribed in cells (open reading frames), which include the 5' and 3' UTRs. Primers can also be designed to amplify a portion of a gene that encodes a specific target domain. In one embodiment, primers are designed to amplify the coding region of human cDNA, including all or part of the 5' and 3' UTRs. Primers that can be used for PCR can be produced by synthetic methods known in the art. A “forward primer” is a primer containing a nucleotide region substantially complementary to nucleotides on a DNA template upstream of the DNA sequence to be amplified. "Upstream" in this document refers to the 5' position relative to the DNA sequence to be amplified in the coding strand. "Reverse primer" refers to a primer containing a nucleotide region that is substantially complementary to the double-stranded DNA template downstream of the DNA sequence to be amplified. "Downstream" in this document refers to the 3' position relative to the DNA sequence to be amplified in the coding strand.

[0381] Chemical structures capable of promoting RNA stability and / or translation efficiency can also be used. The RNA preferably has 5' and 3' UTRs. In one embodiment, the 5' UTR is 0 to 3000 nucleotides in length. The lengths of the 5' and 3' UTR sequences to be added to the coding region can be altered by various methods, including, but not limited to, designing PCR primers that anneal to different regions of the UTR. Using this method, those skilled in the art can modify the lengths of the 5' and 3' UTRs required to achieve optimal translation efficiency of the transcribed RNA after transfection.

[0382] The 5' and 3' UTRs can be naturally occurring endogenous 5' and 3' UTRs of the target gene. Alternatively, UTR sequences that are not endogenous to the target gene can be added by incorporating UTR sequences into the forward and reverse primers, or by any other modification to the template. Using UTR sequences that are not endogenous to the target gene can be used to modify RNA stability and / or translation efficiency. For example, AU-rich elements in the 3' UTR sequence are known to reduce mRNA stability. Therefore, 3' UTRs are selected or designed based on UTR characteristics well known in the art to increase the stability of transcribed RNA.

[0383] In one embodiment, the 5'UTR may contain the Kozak sequence of an endogenous gene. Alternatively, when adding a 5'UTR that is not endogenous to the target gene via PCR as described above, a shared Kozak sequence can be redesigned by adding the 5'UTR sequence. Kozak sequences can improve the translation efficiency of certain RNA transcripts, but it appears that not all RNAs require such sequences for efficient translation. Many mRNAs are known in the art to require Kozak sequences. In other embodiments, the 5'UTR may be derived from an RNA virus whose RNA genome is stable in cells. In other embodiments, various nucleotide analogs may be used in the 3' or 5'UTR to prevent exonuclease degradation of the mRNA.

[0384] To enable RNA synthesis from a DNA template without gene cloning, a transcription promoter is attached to the DNA template upstream of the sequence to be transcribed. When the sequence acting as the promoter of RNA polymerase is added to the 5' end of the forward primer, the RNA polymerase promoter is incorporated into the PCR product upstream of the open reading frame to be transcribed. In one embodiment, the promoter is the T7 polymerase promoter, as described elsewhere herein. Other useful promoters include, but are not limited to, the T3 and SP6 RNA polymerase promoters. The common nucleotide sequences of the T7, T3, and SP6 promoters are known in the art.

[0385] In one implementation, the mRNA has a 5' cap and a 3' poly(A) tail, which determine ribosome binding, translation initiation, and mRNA stability in the cell. On circular DNA templates, such as plasmid DNA, RNA polymerase produces long multiplying products that are unsuitable for expression in eukaryotic cells. Linearization of the 3' UTR end of plasmid DNA transcripts results in normal-sized mRNA, which is ineffective in eukaryotic cell transfection even after post-transcriptional polyadenylation.

[0386] On a linear DNA template, phage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).

[0387] The conventional method for integrating polyA / T fragments (stretches) into DNA templates is molecular cloning. However, the polyA / T sequence integrated into plasmid DNA leads to plasmid instability, which is why plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other aberrations. This makes the cloning process not only laborious and time-consuming but also often unreliable. Therefore, there is a strong need for methods that allow the construction of DNA templates using polyA / T 3' fragments without cloning.

[0388] Poly(A) tails can be generated from transcribed DNA templates using reverse primers containing poly(T) tails (e.g., 100T tails (sizes can range from 50 to 5000T)) during PCR, or by any other method after PCR (including, but not limited to, DNA ligation or in vitro recombination). Poly(A) tails also provide stability to RNA and reduce its degradation. Generally, the length of the poly(A) tail is positively correlated with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is 100 to 5000 adenosine.

[0389] Following in vitro transcription using a poly(A) polymerase (e.g., E. coli poly(A) polymerase (E-PAP)), the poly(A) tail of RNA can be further elongated. In one embodiment, increasing the length of the poly(A) tail from 100 nucleotides to 300-400 nucleotides results in an approximately 2-fold increase in RNA translation efficiency. Additionally, attaching different chemical groups to the 3' end increases mRNA stability. This attachment can contain modified / artificial nucleotides, aptamers, and other compounds. For example, an ATP analog can be incorporated into the poly(A) tail using a poly(A) polymerase. ATP analogs can further increase RNA stability.

[0390] The 5' cap also provides stability to the RNA molecule. In some exemplary embodiments, the RNA produced by the methods disclosed herein includes a 5' cap. 5' caps are provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).

[0391] RNA generated by the methods disclosed herein may also contain an internal ribosome entry site (IRES) sequence. The IRES sequence can be any viral, chromosomal, or artificially designed sequence that initiates cap-independent ribosome binding to mRNA and promotes translation initiation. Any solute suitable for cell electroporation may be included; these solutes may contain factors that promote cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants, and surfactants.

[0392] In some implementations, RNA is electroporated into cells, for example, RNA transcribed in vitro.

[0393] The methods disclosed herein can be applied to basic research and therapies in the fields of cancer, stem cells, acute and chronic infections, and autoimmune diseases to modulate host cell activity, including assessing the ability of genetically modified host cells to kill target cancer cells.

[0394] The method also provides the ability to control expression levels over a wide range by varying, for example, the amount of promoter or input RNA, allowing for independent regulation of expression levels. Furthermore, PCR-based mRNA generation technology greatly facilitates the design of mRNAs with different structures and combinations of their domains.

[0395] One advantage of the RNA transfection method of this invention is that RNA transfection is essentially temporary and vector-free. RNA transgenes can be delivered to lymphocytes and expressed therein after a brief in vitro cell activation, acting as a minimal expression cassette without requiring any additional viral sequences. Under these conditions, integration of transgenes into the host cell genome is not possible. Due to the efficiency of RNA transfection and its ability to uniformly modify the entire lymphocyte population, cell cloning is unnecessary.

[0396] Genetic modification of host cells using in vitro transcribed RNA (IVT-RNA) employs two distinct strategies, both successfully tested in various animal models. Cells are transfected with IVT-RNA via lipid transfection or electroporation. The aim is to stabilize the IVT-RNA using various modifications to achieve prolonged expression of the transferred IVT-RNA.

[0397] Certain IVT vectors are known in the literature to be used as templates for in vitro transcription in a standardized manner and to be genetically modified in a way that produces stable RNA transcripts. Currently, the approach used in this field is based on plasmid vectors with the following structure: a 5' RNA polymerase promoter that enables RNA transcription, followed by a target gene with an untranslated region (UTR) on the 3' and / or 5' side, and a 3' polyadenine cassette containing 50 to 70 A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenine cassette by a type II restriction enzyme (the recognition sequence corresponds to the cleavage site). Thus, the polyadenine cassette corresponds to the subsequent poly(A) sequence in the transcript. Due to this procedure, some nucleotides remain as part of the cleavage site after linearization and extend or mask the poly(A) sequence at the 3' end. It is unclear whether this non-physiological protrusion affects the amount of protein produced intracellularly by this construct.

[0398] Compared to more traditional plasmid or viral methods, RNA offers several advantages. Gene expression from RNA sources does not require transcription and rapidly produces protein products after transfection. Furthermore, because RNA can only enter the cytoplasm, not the nucleus, typical transfection methods result in extremely high transfection rates. Additionally, plasmid-based methods require that the promoter driving the expression of the gene of interest be active in the cells under study.

[0399] On the other hand, RNA constructs are delivered into cells via electroporation. See, for example, formulations and methods for electroporating nucleic acid constructs into mammalian cells taught in US2004 / 0014645, US2005 / 0052630A1, US2005 / 0070841A1, US2004 / 0059285A1, and US2004 / 0092907A1. Various parameters of the electric field strength required for electroporation of any known cell type are generally known in relevant research literature in the art and in numerous patents and applications. See, for example, US Patent Nos. 6,678,556, 7,171,264, and 7,173,116. Commercially available devices for the therapeutic application of electroporation include, for example, MedPulser. TMDNA Electroporation Therapy Systems (Inovio / Genetronics, San Diego, CA) have been described in numerous patents, such as U.S. Patent Nos. 6,567,694, 6,516,223, 5,993,434, 6,181,964, 6,241,701, and 6,233,482. Electroporation can also be used for in vitro cell transfection, as described in US20070128708A1. Electroporation can also be used for in vitro delivery of nucleic acids into cells. Therefore, the use of any of the many available devices and electroporation systems known to those skilled in the art for electroporation-mediated administration of nucleic acid (including expression constructs) into cells provides exciting new means of delivering target RNA to target cells.

[0400] Therefore, the present invention provides a method for generating modified immune cells or their precursor cells, comprising introducing an isolated nucleic acid (e.g., an expression construct) encoding a subject CAR as described herein into a cell using any delivery method described herein or known to those skilled in the art.

[0401] Source of immune cells

[0402] Prior to amplification, a source of immune cells is obtained from the subject for in vitro manipulation. The source of target cells for in vitro manipulation may also include, for example, autologous or allogeneic donor blood, cord blood, or bone marrow. For example, the source of immune cells may be a subject to be treated with the modified immune cells of the present invention, such as the subject's blood, cord blood, or bone marrow. Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and their transgenic species. In some exemplary embodiments, the subject is a human.

[0403] Immune cells can be obtained from many sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph nodes, or lymphoid organs. Immune cells are cells of the immune system, such as cells of innate or adaptive immunity, such as myeloid cells or lymphoid cells (including lymphocytes, typically T cells and / or NK cells and / or NKT cells). Other exemplary cells include stem cells, such as multipotent stem cells and pluripotent stem cells, including induced pluripotent stem cells (iPSCs). In some respects, the cells are human cells. Regarding the subject to be treated, the cells can be allogeneic and / or autologous. The cells are typically primary cells, such as cells isolated directly from the subject and / or cells isolated from the subject and frozen.

[0404] In some embodiments, the immune cells are T cells, such as CD8+ T cells (e.g., CD8+ immature T cells, central memory T cells, or effector memory T cells), CD4+ T cells, natural killer T cells (NKT cells), regulatory T cells (Tregs), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells), natural killer T cells (NK cells), or dendritic cells. In some embodiments, the cells are monocytes or granulocytes, such as myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and / or basophils. In this implementation, the target cell is an induced pluripotent stem cell (iPS) or a cell derived from an iPS, such as one generated by the subject, manipulated to alter (e.g., induce mutations) or manipulate the expression of one or more target genes and differentiate into an iPS cell such as a T cell (e.g., a CD8+ T cell (e.g., a CD8+ immature T cell, a central memory T cell, or an effector memory T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell, or a hematopoietic stem cell).

[0405] In some implementations, the cells include one or more subsets of T cells or other cell types, such as the entire T cell population, CD4+ cells, CD8+ cells, and their subpopulations, such as those defined by function, activated state, maturity, differentiation capacity, expansion, circulation, localization, and / or persistence, antigen specificity, antigen receptor type (present in a particular organ or compartment), marker or cytokine secretion profile, and / or degree of differentiation. Among these subtypes and subsets of T cells and / or CD4+ and / or CD8+ T cells are immature T (TN) cells, effector T cells (TEFF), memory T cells and their subtypes, such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM) or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa-associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, and helper T cells (such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, α / β T cells, and δ / γ T cells). In some embodiments, any number of T cell lines available in the art may be used.

[0406] In some embodiments, the method includes isolating immune cells from a subject, preparing, processing, culturing, and / or engineering them. In some embodiments, the preparation of engineered cells includes one or more culturing and / or preparation steps. The engineered cells used in the described process can be isolated from a sample, such as a biological sample, such as a sample obtained from or derived from the subject. In some embodiments, the subject from whom the cells are isolated is a subject suffering from a disease or condition, requiring cell therapy, or to receive cell therapy. In some embodiments, the subject is a person requiring a specific therapeutic intervention, such as adoptive cell therapy, in which cells are isolated, processed, and / or engineered. Thus, in some embodiments, the cells are primary cells, such as primary human cells. Samples include tissues, fluids, and other samples taken directly from the subject, as well as samples from one or more processing steps, such as isolation, centrifugation, genetic engineering (e.g., transduction with a viral vector), washing, and / or incubation. Biological samples can be samples obtained directly from a biological source or processed samples. Biological samples include, but are not limited to, bodily fluids such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, and sweat, tissue and organ samples, including processed samples derived therefrom.

[0407] In some respects, the sample from which cells are derived or isolated is blood or a blood-derived sample, or a product of leukapheresis or apheresis. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumors, leukemia, lymphoma, lymph nodes, intestinal-associated lymphoid tissue, mucosa-associated lymphoid tissue, spleen, other lymphoid tissues, liver, lungs, stomach, small intestine, large intestine, kidneys, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsils, or other organs, and / or cells derived therefrom. In the case of cell therapy (such as adoptive cell therapy), samples include those from autologous and allogeneic sources.

[0408] In some embodiments, the cells are derived from cell lines, such as T cell lines. In some embodiments, the cells are obtained from xenogeneic sources, such as mice, rats, non-human primates, and pigs. In some embodiments, cell isolation includes one or more preparative and / or cell affinity-based isolation steps. In some instances, for example, cells are washed, centrifuged, and / or cultured in the presence of one or more reagents to remove unwanted components, enrich desired components, lyse, or remove cells sensitive to a specific reagent. In some instances, cells are isolated based on one or more properties, such as density, adhesion properties, size, sensitivity, and / or resistance to a specific component.

[0409] In some instances, cells are obtained from the circulating blood of a subject, such as through apheresis or leukocyte apheresis. In some aspects, the sample contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and / or platelets, and in some aspects, the sample contains cells other than erythrocytes and platelets. In some embodiments, the blood cells collected from the subject are washed to remove the plasma fraction and the cells are placed in a suitable buffer or culture medium for subsequent processing steps. In some embodiments, the cells are washed with phosphate-buffered saline (PBS). In some embodiments, the washing step is performed by tangential flow filtration (TFF) according to the manufacturer's instructions. In some embodiments, after washing, the cells are resuspended in a variety of biocompatible buffers. In some embodiments, the components of the blood cell sample are removed and the cells are directly resuspended in a culture medium. In some embodiments, the method includes density-based cell separation methods, such as preparing leukocytes from peripheral blood by lysing erythrocytes and centrifuging via Percoll or Ficoll gradient.

[0410] In one implementation, immune cells obtained from an individual's circulating blood are obtained via apheresis or leukoablation. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. Cells collected via apheresis can be washed to remove the plasma fraction and placed in a suitable buffer or culture medium, such as phosphate-buffered saline (PBS), or a wash solution that is deficient in calcium and may be deficient in magnesium, or may be deficient in many (if not all) divalent cations, for subsequent processing steps. Those skilled in the art will readily understand that the washing step can be performed by methods known to those skilled in the art, such as using a semi-automatic "flow-through" centrifuge (e.g., the Cobe 2991 cell processor, Baxter CytoMate, or Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells can be resuspended in a variety of biocompatible buffers, such as calcium-free buffers. 2+ Mg-free 2+ PBS, PlasmaLyte A, or another saline solution with or without buffer may be used. In some embodiments, unwanted components can be removed from the apheresis sample, and the cells can be directly resuspended in the culture medium.

[0411] In some embodiments, the separation method includes separating different cell types based on the expression or presence of one or more specific molecules in the cells, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acids. In some embodiments, any known separation method based on such markers can be used. In some embodiments, separation is based on affinity or immunoaffinity. For example, in some aspects, separation includes the separation of cells and cell populations based on the expression levels of cell expression or one or more markers (typically cell surface markers), for example, by incubation with antibodies or binding couplers that specifically bind to such markers, followed typically by a washing step and separation of cells that have bound the antibody or binding coupler from those that have not. Such separation steps can be based on positive and / or negative selection, in which positive selection retains cells that bind to the reagent for further use, and negative selection retains cells that do not bind to the antibody or binding coupler. In some instances, both portions are retained for further use. In some aspects, negative selection is particularly useful when antibodies that specifically identify cell types in a heterologous population are unavailable, allowing for optimal separation based on markers expressed by cells other than the desired population. Isolation does not need to result in 100% enrichment or removal of a specific cell population or cells expressing a specific marker. For example, positive selection or enrichment of a specific type of cell (such as those expressing a marker) means increasing the number or percentage of such cells, but does not need to result in the complete absence of cells that do not express that marker. Similarly, negative selection, removal, or elimination of a specific type of cell (such as those expressing a marker) means reducing the number or percentage of such cells, but does not need to result in the complete removal of all such cells.

[0412] In some exemplary embodiments, multiple separation steps are performed, wherein portions of the positively or negatively selected cells in one step undergo another separation step, such as subsequent positive or negative selection. In some exemplary embodiments, a single separation step can simultaneously eliminate cells expressing multiple markers, such as by incubating cells with multiple antibodies or conjugate couples, each antibody or conjugate couple being specific for targeting the marker of negative selection. Similarly, multiple cell types can be positively selected simultaneously by incubating cells with antibodies or conjugate couples expressed on various cell types.

[0413] In some implementations, enrichment or elimination is performed on one or more T cell populations that are positive for one or more specific markers (e.g., surface markers) (marker+) or express them at high levels (marker-). 高 Cells that are negative for one or more specific markers (marker-) or express relatively low levels of them (marker-). 低Cells. For example, in some respects, specific subsets of T cells (such as those expressing one or more surface markers (e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and / or CD45RO+ T cells) are isolated using positive or negative selection techniques. In some cases, such markers are those that are absent or expressed at relatively low levels in some T cell populations (e.g., non-memory cells) but present or expressed at relatively high levels in some other T cell populations (e.g., memory cells). In one implementation, cells (such as CD8+ cells, or T cells, such as CD3+ cells) that are positive for or express high levels of CD45RO, CCR7, CD28, CD27, CD44, CD127, and / or CD62L are enriched (i.e., positively selected), and / or cells that are positive for or express high levels of CD45RA are eliminated (i.e., negatively selected). In some implementations, cells that are positive for or express high levels of CD122, CD95, CD25, CD27, and / or IL7-Ra (CD127) are enriched or eliminated. In some exemplary implementations, CD8+ T cells that are negative for CD45RO (or negative for CD45RA) and positive for CD62L are enriched. For example, CD3+, CD28+ T cells can be positively selected using CD3 / CD28 conjugated magnetic beads (e.g., ...). M-450CD3 / CD28T cell expander).

[0414] In some embodiments, T cells are separated from PBMC samples by negative selection of markers expressed on non-T cells (such as B cells, monocytes, or other leukocytes such as CD14). In some aspects, a CD4+ or CD8+ selection step is used to separate CD4+ helper T cells and CD8+ cytotoxic T cells. Such CD4+ and CD8+ populations can be further sorted into subpopulations by positive or negative selection of markers expressed or expressed at relatively high levels on one or more immature memory and / or effector T cell populations. In some embodiments, immature, central memory, effector memory, and / or central memory stem cells in CD8+ cells are further enriched or eliminated, such as by positive or negative selection based on surface antigens associated with their respective subpopulations. In some embodiments, central memory T (TCM) cells are enriched to increase efficacy, such as providing long-term survival, expansion, and / or transplantation after administration, which in some aspects are particularly robust in such subpopulations. In some embodiments, a combination of TCM-enriched CD8+ T cells and CD4+ T cells further enhances efficacy.

[0415] In some embodiments, memory T cells are present in both CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes. The CD62L-CD8+ and / or CD62L+CD8+ portions of PBMCs can be enriched or depleted, for example, using anti-CD8 and anti-CD62L antibodies. In some embodiments, central memory (TCM) cells from CD4+ T cell populations and / or CD8+ T cell populations are enriched. In some embodiments, enrichment of central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CD3, and / or CD127; in some aspects, it is based on negative selection of cells expressing or highly expressing CD45RA and / or granzyme B. In some aspects, the CD8+ population of enriched TCM cells is isolated by depleting cells expressing CD4, CD14, and CD45RA and positively selecting for or enriching cells expressing CD62L. In one aspect, enrichment of central memory T (TCM) cells begins with the negative fraction of cells selected based on CD4 expression, which undergoes negative selection based on CD14 and CD45RA expression, and positive selection based on CD62L. In some aspects, such selection occurs simultaneously, and in others, sequentially in either order. In some aspects, the same CD4 expression-based selection step used in preparing a CD8+ cell population or subset can also be used to generate a CD4+ cell population or subset, such that both the positive and negative fractions from CD4-based separation are preserved and used in subsequent steps of the method, optionally after one or more positive or negative selection steps.

[0416] CD4+ T helper cells are sorted into immature, central memory, and effector cells by identifying cell populations with cell surface antigens. CD4+ lymphocytes can be obtained using standard methods. In some embodiments, immature CD4+ T lymphocytes are CD45RO-, CD45RA+, CD62L+, and CD4+ T cells. In some embodiments, central memory CD4+ cells are CD62L+ and CD45RO+. In some embodiments, effector CD4+ cells are CD62L- and CD45RO. In one example, to enrich CD4+ cells by negative selection, a mixture of monoclonal antibodies typically includes antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD8. In some embodiments, the antibody or binding partner is bound to a solid support or matrix, such as magnetic beads or paramagnetic beads, thereby allowing for positive and / or negative selection of the cells.

[0417] In some embodiments, cells are incubated and / or cultured prior to or in conjunction with genetic engineering. The incubation step includes culturing, cultivating, stimulating, activating, and / or proliferating. In some embodiments, the composition or cells are incubated in the presence of stimulating conditions or stimulating agents. Such conditions include those designed to induce cell proliferation, expansion, activation, and / or survival in a population, mimic antigen exposure, and / or genetic engineering of naïve cells, such as to introduce recombinant antigen receptors. Conditions may include one or more of specific culture media, temperatures, oxygen levels, carbon dioxide levels, time, and reagents (such as nutrients, amino acids, antibiotics, ions, and / or stimulating factors, such as cytokines, chemokines, antigens, binding couplers, fusion proteins, recombinant soluble receptors, and any other reagents designed to activate cells). In some embodiments, the stimulating conditions or reagents include one or more reagents, such as ligands capable of activating the intracellular signaling domains of the TCR complex. In some aspects, the reagents open or initiate the TCR / CD3 intracellular signaling cascade in T cells. Such reagents may include antibodies, such as those specific to TCR components and / or co-stimulatory receptors (e.g., anti-CD3, anti-CD28), for example, binding to a solid support (such as beads), and / or one or more cytokines. Optionally, the amplification method may further include the step of adding anti-CD3 and / or anti-CD28 antibodies to the culture medium (e.g., at a concentration of at least about 0.5 ng / mL). In some embodiments, the stimulatory reagent includes IL-2 and / or IL-15, for example, an IL-2 concentration of at least about 10 units / mL.

[0418] In another embodiment, T cells are isolated from peripheral blood by lysing red blood cells and removing monocytes, for example, by PERCOLL. TM Gradient centrifugation is performed. Optionally, T cells can be isolated from the umbilical cord. In any case, specific subsets of T cells can be further isolated using positive or negative selection techniques.

[0419] Cells expressing certain antigens, including but not limited to CD34, CD8, CD14, CD19, and CD56, can be removed from such isolated umbilical cord blood mononuclear cells. This removal can be accomplished using isolated antibodies, biological samples containing antibodies (such as ascites), antibodies bound to a physical support, and cells bound to the antibodies.

[0420] Enrichment of T cell populations via negative selection can be accomplished using a combination of antibodies that are uniquely directed to surface markers on negatively selected cells. Exemplary methods include cell sorting and / or cell selection via negative magnetic immunoadhesion or flow cytometry, which uses a mixture of monoclonal antibodies directed to cell surface markers presented on negatively selected cells. For example, to enrich CD4 cells via negative selection... +Cellular monoclonal antibody mixtures typically include antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD8.

[0421] For the separation of a desired cell population through positive or negative selection, the cell concentration and surface area (e.g., particles such as beads) can be varied. In some embodiments, the volume of bead and cell mixture is significantly reduced (i.e., the cell concentration is increased) to ensure that maximum contact between the cells and beads is desired. For example, in one embodiment, a concentration of 2 billion cells / ml is used. In another embodiment, a concentration of 1 billion cells / ml is used. In a further embodiment, a concentration greater than 100 million cells / ml is used. In a further embodiment, cell concentrations of 10 million, 15 million, 20 million, 25 million, 30 million, 35 million, 40 million, 45 million, or 50 million cells / ml are used. In yet another embodiment, cell concentrations of 75 million, 80 million, 85 million, 90 million, 95 million, or 100 million cells / ml are used. In a further embodiment, concentrations of 125 million or 150 million cells / ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion.

[0422] Following the washing step, T cells can also be frozen, which does not require a monocyte removal step. While not wishing to be bound by theory, freezing and subsequent thawing steps provide a more homogeneous product by removing granulocytes and a certain degree of monocytes from the cell population. After a washing step to remove plasma and platelets, the cells can be suspended in a cryogenic solution. While many cryogenic solutions and parameters are known in the art and may be useful in this context, in a non-limiting example, one method involves using PBS containing 20% ​​DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the gas phase of a liquid nitrogen tank. Other methods of controlled freezing, as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen, can be used.

[0423] In one embodiment, the T cell population is comprised of cells such as peripheral blood mononuclear cells, umbilical cord blood cells, purified T cell populations, and T cell lines. In another embodiment, peripheral blood mononuclear cells comprise a T cell population. In yet another embodiment, purified T cells comprise a T cell population.

[0424] Expansion of immune cells

[0425] Whether before or after cells are modified to express the subject CAR, cell activation and proliferation can be achieved using methods described in the following literature, such as U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application No. 20060121005. For example, the immune cells of the present invention can be expanded by contact with a surface to which a reagent stimulating CD3 / TCR complex-related signals and a ligand stimulating co-stimulatory molecules on the immune cell surface are attached. Specifically, immune cell populations can be stimulated by contact with anti-CD3 antibodies or their antigen-binding fragments, or with anti-CD2 antibodies immobilized on the surface, or by contact with a protein kinase C activator (e.g., bryophytein) bound to a calcium ionocarp. Ligands binding to helper molecules on the immune cell surface are used to co-stimulate them. For example, immune cells can be contacted with anti-CD3 antibodies and anti-CD28 antibodies under conditions suitable for stimulating immune cell proliferation. Examples of anti-CD28 antibodies include 9.3, B-T3, and XR-CD28 (Diaclone, Besancon, France), and these can all be used in this invention, as can other methods and reagents known in the art (see, for example, ten Berge et al., Transplant Proc. (1998) 30(8):3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9):1319-1328; and Garland et al., J. Immunol. Methods (1999) 227(1-2):53-63).

[0426] The methods disclosed herein can amplify immune cells by approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 100,000, 10,000,000, or more times, and any and all whole or part of such integers. In one embodiment, the amplification range of immune cells is from approximately 20 to approximately 50 times.

[0427] After culturing, immune cells can be incubated in cell culture medium in a culture device for a period of time or until the cells reach a high cell concentration for confluence or optimal passage, and then transferred to another culture device. The culture device can be any culture device commonly used for in vitro cell culture. In some exemplary embodiments, the confluence level is 70% or greater before transferring the cells to another culture device. In a particularly exemplary embodiment, the confluence level is 90% or greater. The confluence period can be any time suitable for in vitro cell culture. The immune cell culture medium can be replaced at any time during the culture of immune cells. In some exemplary embodiments, the immune cell culture medium is replaced approximately every 2 to 3 days. The immune cells are then harvested from the culture device and can be used immediately or refrigerated for later use. In one embodiment, the invention includes cryopreservation of expanded immune cells. The refrigerated immune cells are thawed before nucleic acids are introduced into the immune cells.

[0428] In another embodiment, the method includes isolating and amplifying immune cells. In another embodiment, the invention further includes cryopreserving the immune cells prior to amplification. In yet another embodiment, the cryopreserved immune cells are thawed for electroporation using RNA encoding chimeric membrane proteins.

[0429] Another process for in vitro cell expansion is described in U.S. Patent No. 5,199,942 (incorporated herein by reference). Expansion as described in U.S. Patent No. 5,199,942 may be an alternative approach or an adjunct to other expansion methods described herein. In short, in vitro culture and expansion of immune cells involves the addition of cell growth factors, such as those described in U.S. Patent No. 5,199,942, or other factors, such as flt3-L, IL-1, IL-3, and c-kit ligands. In one embodiment, expanding immune cells includes culturing immune cells with a factor selected from flt3-L, IL-1, IL-3, and c-kit ligands.

[0430] The culture steps described herein (in contact with the reagents described herein or after electroporation) can be very short, for example, less than 24 hours, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours. Further culture steps described herein (in contact with the reagents described herein) can be longer, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days.

[0431] Various terms are used to describe cells in a culture. A cell culture generally refers to cells taken from a living organism and grown under controlled conditions. A primary cell culture is a culture taken directly from cells, tissues, or organs of an organism and prior to the first passage culture. When cells are placed in a growth medium under conditions that promote cell growth and / or division, the cells in the culture are expanded, resulting in a larger cell population. When cells are expanded in a culture, the cell proliferation rate is usually measured by the amount of time required for the cell number to double, also known as the doubling time.

[0432] Each round of passage culture is called a passage. When cells are passaged, they are said to have been passaged. A particular cell population or cell line is sometimes referred to or characterized by the number of times it has been passaged. For example, a cell population that has been passaged ten times may be called a P10 culture. The primary culture, i.e., the first culture after cells are isolated from a tissue, is designated as P0. After the first passage culture, the cells are described as a secondary culture (P1 or passage 1). After the second culture, the cells become a tertiary culture (P2 or passage 2), and so on. Those skilled in the art will understand that there are many population doublings during the passage cycle. Therefore, the number of population doublings in a culture is greater than the number of passages. The expansion of cells (i.e., the number of population doublings) in the cycle between passages depends on many factors, including but not limited to seeding density, substrate, culture medium, and time between passages.

[0433] In one embodiment, cells can be cultured for several hours (about 3 hours) to about 14 days or any integer in hours. Suitable conditions for immune cell culture include suitable culture media (e.g., Minimal Essential Media or RPMI Media 1640 or X-vivo 15, (Lonza)) that may contain factors essential for proliferation and survival, including serum (e.g., fetal bovine serum or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-β, and TNF-α, or any other cell growth additives known to those skilled in the art. Other cell growth additives include, but are not limited to, surfactants, plasma products, and reducing agents such as N-acetylcysteine ​​and 2-mercaptoethanol. Culture media may include RPMI 1640, AIM-V, DMEM, MEM, α-MEM, F-12, X-Vivo15, and X-Vivo 20, an Optimizer, and added amino acids, sodium pyruvate, and vitamins; serum-free or supplemented hormones in appropriate amounts of serum (or plasma) or a defined group; and / or cytokines (one or more) in sufficient amounts to promote immune cell growth and expansion. Antibiotics, such as penicillin and streptomycin, are included only in experimental cultures and not in cell cultures to be injected into the subject. Target cells are maintained under conditions necessary to support growth, such as appropriate temperature (e.g., 37°C) and atmospheric conditions (e.g., air plus 5% CO2).

[0434] Culture media used for culturing immune cells may include reagents that can co-stimulate immune cells. For example, a reagent that can stimulate CD3 is an antibody against CD3, and a reagent that can stimulate CD28 is an antibody against CD28. This is because, as demonstrated by the data disclosed herein, cells isolated by the methods disclosed herein can be expanded by approximately 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000-fold, 100,000-fold, 10,000,000-fold, or more. In one embodiment, the expansion of population immune cells by culturing electroporated cells is approximately 2-fold to approximately 50-fold or more. In one embodiment, human T regulatory cells are expanded via KT64.86 artificial antigen-presenting cells (aAPCs) coated with anti-CD3 antibodies. Methods for expanding and activating immune cells can be found in U.S. Patent Nos. 7,754,482, 8,722,400, and 9,555,105, the entire contents of which are incorporated herein by reference.

[0435] In one embodiment, the method for amplifying immune cells may further include isolating the amplified immune cells for further application. In another embodiment, the amplification method may further include subsequently electroporating the amplified immune cells and then culturing them. Subsequent electroporation may include introducing a nucleic acid encoding a reagent (such as amplified immune cells transduced with nucleic acid, amplified immune cells transfected, or electroporated immune cells) into the amplified immune cell population, wherein the reagent further stimulates the immune cells. The reagent may stimulate the immune cells, such as by stimulating further amplification, effector function, or another immune cell function.

[0436] Treatment

[0437] Mucin is a high-molecular-weight glycosylated protein that functions in normal, healthy cells as a physicochemical protectant against toxins and mutagens when overexpressed in epithelial cells. Expression has been noted in other healthy cell types, where mucin may act as an adhesion regulator or play a role in signal transduction and cell growth regulation (Winterford et al. (1999) J Histochem Cytochem, 47(8): 1063-1074). Tumorigenesis and metastasis have been shown to increase with changes in cell surface glycosylation (protein modification following the addition of a sugar moiety to specific amino acids) of various mucin proteins (Ren et al. (2014) Tumour Biol, 35(10): 9603-9612; Tarp et al. (2008) Glycobiology, 17(2): 197-209; Taylor-Papadimitriou et al. (1999) 1455(2-3): 301-313). At least nine of the 20 amino acids can be modified by a variety of carbohydrates (Stowell et al. (2015) Annu Rev Pathol, 10:473-510). Tn(GalNAca1-O-Ser / Thr) and sialic acid-Tn(STn) (NeuAca2-6-GalNAca1-O-Ser / Thr) are the most common abnormal glycoforms found in cancer (Springer (1984) Science, 224(4654):1198-1206). This aberrant glycosylation also leads to a tumor-specific form of the full-length Mucin1 glycoprotein, called TnMUC1, which is thought to play a key role in carcinogenesis (Ju et al. (2005) Nature, 437(7063):1252; Ju et al. (2008) Cancer Res, 68(6):1636-1646; Ju et al. (2014) Cancer Biomark, 14(1):63-81; Varki et al. (2017) Essentials of Glycobiology [Internet]. 3rd edition. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 2015-2017). Specifically, abnormal expression of the Tn / sTn glycoform was found on cell membrane-associated mucin (MUC1). MUC1 is a large protein with tandem repeat sequences that carries O-glycans that are overexpressed in most adenocarcinomas (Cascio et al. (2017) Oncotarget, 8(62): 105284-98; Finn et al. (2011) Immunol Research, 50(2-3): 261-268).Some healthy tissues of epithelial origin express MUC1 on the cell surface (Winterford et al. (1999) J Histochem Cytochem, 47(8): 1063-1074); the aberrant glycosylated version (TnMUC1) is expressed in the Golgi apparatus and is a precursor of full-length MUC1 observed on the cell surface (Posey et al. (2016) Immunity, 44(6): 1444-1454). Tumor-associated TnMUC1 is overexpressed in a certain proportion of multiple myeloma cases (Andrulis et al. (2014) Histopathology, 64:799-806; Cloosen et al. (2006) British Journal of Haematology, 135:513-516) and in a variety of solid tumors, including breast, colon, lung, stomach, ovary and pancreas. Loss of membrane polarity and aberrant O-glycosylation lead to the expression of Tn and STn glycoforms on the surface of tumor cells (Lavrsen et al. (2013) Glycoconjugates, 30(3):227-236; Pinto et al. (2012) J Cellular Mol Medicine, 16:1474-1484). (Et. (2006) Glycobiology, 16:96-107).

[0438] In one aspect, the present invention includes a method of treating MUC1-related cancer in a subject with need. In another aspect, the present invention includes a method of treating MUC1-related cancer in a subject, the method comprising administering to a subject with a therapeutically effective modified immune cell population of the present invention. In some embodiments, MUC1-related cancer is selected from multiple myeloma, breast cancer, colon cancer, lung cancer, gastric cancer, ovarian cancer, and pancreatic cancer. In some embodiments, MUC1-related cancer is selected from MUC1-related breast cancer, MUC1-related multiple myeloma, MUC1-related non-small cell lung cancer, MUC1-related pancreatic cancer, MUC1-related ovarian cancer, and fallopian tube cancer.

[0439] The method includes administering the modified immune cells of the present invention (e.g., MUC1 CAR T cells) to a subject.

[0440] As used herein, the terms “subject” and “patient” refer to an organism to be treated by the methods of the present invention. The terms “subject” and “patient” are used interchangeably herein. Such organisms include, but are not limited to, mammals (e.g., rodents, apes, equines, bovines, suidae, canines, felines, etc.), and in exemplary embodiments include humans. As used herein, the terms “treatment,” “therapeutic,” and “under treatment” include any effect that results in improvement of a symptom, disease, disorder, etc., such as relief, reduction, regulation, improvement, or elimination, or improvement of its symptoms, such as a reduction in the number of cancer cells, a reduction in tumor size, a reduction in tumor burden, a decrease in the rate at which cancer cells infiltrate peripheral organs, or a decrease in the rate of tumor metastasis or tumor growth.

[0441] The effectiveness of treatment in cancer can be measured in a variety of ways (see W.W. Weber, J. Null. Med. 50: 1S-10S (2009); Eisenhauer et al., Eur. J. Cancer 45: 228-247 (2009)). In some implementations, the response to a subject CAR T-cell therapy (e.g., TN-MUC1 CAR T-cell therapy) is assessed using RECIST 1.1 criteria (see Eisenhauer et al., ibid.). In some implementations, treatment achieved by an effective dose (e.g., an effective dose of TN-MUC1 CAR T-cell therapy) is any one of partial response (PR), complete response (CR), progression-free survival (PFS), disease-free survival (DFS), objective response (OR), change in response duration (e.g., an increase in response duration), change in response time (e.g., a decrease in response time), or overall survival (OS). The effective dose of treatment for breast cancer described in this article can vary depending on a variety of factors, such as the patient’s disease status, age and weight, and the ability of the therapy to elicit an anticancer response in the subject.

[0442] The “RECIST 1.1 response criteria” used in this article refers to the definition described by Eisenhauer et al. in Eur J Cancer, 45(2):228-247, for target lesions or non-target lesions, depending on the context of the measured response.

[0443] When used in a subject diagnosed with or suspected of having cancer (e.g., MUC1-associated breast cancer, MUC1-associated multiple myeloma, MUC1-associated non-small cell lung cancer, MUC1-associated pancreatic cancer, MUC1-associated ovarian cancer, and fallopian tube cancer), “tumor” refers to any size malignant or potentially malignant tumor or mass of tissue.

[0444] "Tumor burden," also known as "tumor load," refers to the total amount of tumor material distributed throughout the body. Tumor burden refers to the total number of cancer cells or the total size of tumors (one or more) throughout the body, including lymph nodes and bone marrow. Tumor burden can be determined by a variety of methods known in the art, such as measuring the size of tumors (one or more) after removal from the subject, for example, using calipers, or in vivo using imaging techniques, such as bone scans, computed tomography (CT) scans, or magnetic resonance imaging (MRI) scans.

[0445] The term "tumor size" refers to the total size of a tumor, which can be measured by the length and width of the tumor. Tumor size can be determined by a variety of methods known in the art, such as measuring the size of one or more tumors after removal from the subject, for example, by using calipers, or in vivo using imaging techniques such as bone scans, ultrasound, CT, or MRI scans.

[0446] In one aspect, the present invention includes a method of treating MUC1-related breast cancer in a subject of need, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise a chimeric antigen receptor (CAR). In some embodiments, the CAR comprises a MUC1-specific antigen-binding domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain.

[0447] In one aspect, the present invention includes a method of treating MUC1-associated multiple myeloma in a subject of need, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein said modified immune cells comprise chimeric antigen receptors (CARs). In some embodiments, the CAR comprises a MUC1-specific antigen-binding domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain. In other embodiments, the modified cells further comprise dominant negative receptors and / or switching receptors.

[0448] In one aspect, the present invention includes a method of treating MUC1-associated non-small cell lung cancer in a subject of need, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise chimeric antigen receptors (CARs). In some embodiments, the CAR comprises a MUC1-specific antigen-binding domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain. In other embodiments, the modified cells further comprise dominant negative receptors and / or switching receptors.

[0449] In one aspect, the present invention includes a method of treating MUC1-related pancreatic cancer in a subject of need, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise chimeric antigen receptors (CARs). In some embodiments, the CAR comprises a MUC1-specific antigen-binding domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain. In other embodiments, the modified cells further comprise dominant negative receptors and / or switching receptors.

[0450] In one aspect, the present invention includes a method of treating MUC1-related ovarian cancer and / or fallopian tube cancer in a subject of need, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise chimeric antigen receptors (CARs). In some embodiments, the CAR comprises a MUC1-specific antigen-binding domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain. In other embodiments, the modified cells further comprise dominant negative receptors and / or switching receptors.

[0451] In some embodiments, the MUC1-specific antigen-binding domain binds to the glycosylated form of MUC1, i.e., it is specific to the sugar epitopes of MUC1. In some embodiments, the MUC1-specific antigen-binding domain is specific to truncated sugar epitopes of MUC1. In some embodiments, the MUC1-specific antigen-binding domain is specific to TnMUC1. In some embodiments, the MUC1-specific antigen-binding domain may include the heavy chain complementarity-determining region (CDR) sequences of SEQ ID NO:22, 23, and 24 and / or the light chain complementarity-determining region (CDR) sequences of SEQ ID NO:19, 20, and 21. In some embodiments, the MUC1-specific antigen-binding domain may include all six complementarity-determining region (CDR) sequences of SEQ ID NO:19-24. In some embodiments, the MUC1-specific antigen-binding domain may include the heavy chain variable domain (VH) sequence of SEQ ID NO:5 and / or the light chain variable domain (VL) sequence of SEQ ID NO:6. In some embodiments, the MUC1-specific antigen-binding domain includes the amino acid sequence of SEQ ID NO:2.

[0452] The CAR used in the method of the present invention may include transmembrane domains selected from artificial hydrophobic sequences, transmembrane domains of type I transmembrane proteins, α, β or ζ chains of T cell receptors, and transmembrane domains of CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137), and CD154. In some exemplary embodiments, the transmembrane domain includes the CD8a transmembrane domain.

[0453] CAR may include a costimulatory signaling domain comprising a costimulatory domain selected from members of the TNFR superfamily, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD5, CD7, LIGHT, NKG2C, B7-H3, ligands that specifically bind to CD83, DAP10, DAP12, Lck, Fas, and any combination thereof. In some exemplary embodiments, the costimulatory signaling domain includes a 41BB costimulatory domain.

[0454] Intracellular signal transduction domains may include signal transduction domains of proteins selected from CD3ζ, FcyRIII, FcsRI, the cytoplasmic tail of the Fc receptor, cytoplasmic receptors with an immune receptor tyrosine activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In some exemplary embodiments, the intracellular signal transduction domain includes the CD3ζ signal transduction domain.

[0455] The CAR may further include a CD8a leader sequence and / or an extracellular hinge domain selected from the Fc fragment of an antibody, the hinge region of an antibody, the CH2 region of an antibody, the CH3 region of an antibody, an artificial spacer sequence, a hinge comprising an amino acid sequence of CD8, and any combination thereof. In some exemplary embodiments, the extracellular hinge domain includes a CD8a extracellular hinge domain.

[0456] In some embodiments, the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NO:1, 38, 40, 42, 44, or 46. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO:2, 39, 41, 43, 45, or 47.

[0457] In some exemplary embodiments, the CAR is encoded by a nucleic acid sequence including the nucleotide sequence of SEQ ID NO:46. In some exemplary embodiments, the CAR includes the amino acid sequence of SEQ ID NO:47.

[0458] The CAR disclosed herein, when present on T lymphocytes or NK cells, can mediate cytotoxicity against target cells. The CAR of this disclosure binds to antigens present on target cells, thereby enabling T lymphocytes or NK cells genetically modified to produce the CAR to mediate the killing of target cells. The antigen-binding domain of the CAR (e.g., anti-TN-MUC1 scFv) binds to antigens (e.g., TN-MUC1 antigen) present on the surface of target cells. Target cells include, but are not limited to, cancer cells, such as breast cancer cells. Therefore, this disclosure provides a method for killing target cancer cells or inhibiting their growth, the method comprising contacting cytotoxic immune effector cells (e.g., cytotoxic T cells or NK cells)—which are genetically modified to produce the subject CAR—such that T lymphocytes or NK cells recognize antigens present on the surface of target cancer cells and mediate the killing of target cells.

[0459] This disclosure provides a method for treating cancer in a subject with cancer, the method comprising: i) introducing a chimeric antigen receptor of this disclosure or an expression vector of this disclosure into cells to produce modified cells; and ii) administering the modified cells to the subject. In some embodiments, the cells are obtained from the subject (i.e., the cells are autologous), engineered in vitro, and administered to the same subject. In some embodiments, the cells are obtained from one subject, engineered in vitro, and administered to a second suitable subject (i.e., the cells are allogeneic).

[0460] In some embodiments, a method is provided that includes recovering cytotoxic cells from a subject, genetically modifying the cytotoxic cells by introducing the CAR gene of the present invention into the cytotoxic cells, and administering the modified cytotoxic cells to the subject. In some embodiments, the cytotoxic cells are selected from T cells, immature T cells, memory T cells, effector T cells, natural killer cells, and macrophages. In one embodiment, the cytotoxic cells are T cells.

[0461] In one embodiment, the T cells are obtained from the subject. T cells can be obtained from a variety of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments of the invention, any number of T cell lines available in the art can be used. In some embodiments of the invention, T cells can be obtained using any number of techniques known to those skilled in the art, such as Ficoll. TMSeparation, obtained from blood collected from the subject.

[0462] For example, in one implementation, T cells are isolated by means of beads conjugated with anti-CD3 / anti-CD28 (i.e., 3x28), for example M-450CD3 / CD28 T cells are incubated together for a sufficient time to positively select the desired T cells. In one embodiment, the time period is approximately 30 minutes. In another embodiment, the time period ranges from 30 minutes to 36 hours or longer, and all integer values ​​in between. In one embodiment, the time period is at least 1, 2, 3, 4, 5, or 6 hours. In one embodiment, the time period is 10 to 24 hours. In one embodiment, the incubation time is 24 hours. Using a longer incubation time, such as 24 hours, can increase cell yield in order to isolate T cells from leukemia patients. A longer incubation time can be used to isolate T cells in any case where T cells are scarce compared to other cell types, such as in the isolation of tumor-infiltrating lymphocytes (TILs) from tumor tissue or individuals without an immune response. Furthermore, using a longer incubation time can improve the efficiency of capturing CD8+ T cells. Therefore, by simply shortening or lengthening the time allowed for T cells to bind to CD3 / CD28 beads and / or by increasing or decreasing the bead-to-T-cell ratio (as further described herein), preferential selection of T-cell subsets can be supported or opposed at the start of culture or at other points during the process. Furthermore, by increasing or decreasing the proportion of anti-CD3 and / or anti-CD28 antibodies on beads or other surfaces, preferential selection of T-cell subsets can be supported or opposed at the start of culture or at other desired points. Those skilled in the art will recognize that multi-round selection can also be used in the context of this invention. In some embodiments, it may be desirable to perform a selection procedure and use “unselected” cells in the activation and expansion methods. “Unselected” cells may also be subject to further rounds of selection.

[0463] The cells are then modified as described herein. A polynucleotide encoding a subject CAR (e.g., TN-MUC1 CAR), typically located in an expression vector, is introduced into the cytotoxic cells, causing the cytotoxic cells to express, preferably stably express, the CAR. In some embodiments, the polynucleotide encoding the CAR also encodes a CAR-inducible expression cassette for the production and release of a transgenic polypeptide product following CAR signaling. In some embodiments, the polynucleotide encoding the CAR also encodes a cytokine (e.g., IL-12) operably linked to a T cell activation response promoter. In some embodiments, the expression vector comprises a polynucleotide encoding the CAR and a polynucleotide encoding a cytokine operably linked to a T cell activation response promoter. See, for example, Chmielewski and Abken, Expert Opin. Biol. Ther. (2015) 15(8):1145-1154; and Abken, Immunotherapy (2015) 7(5):535-544. In some embodiments, cells are genetically engineered using expression vectors comprising polynucleotides encoding CARs and polynucleotides encoding cytokines (e.g., IL-12) operatively linked to T-cell activation response promoters. In some embodiments, the introduction of polynucleotides does not need to lead to integration; merely the transient maintenance of the introduced polynucleotides may suffice. In this way, short-term effects can be achieved, where cytotoxic cells can be introduced into the host and then activated after a predetermined time, for example, after the cells are able to migrate to a specific site for treatment.

[0464] Depending on the nature of the cytotoxic cells and the disease to be treated, modified cytotoxic cells (e.g., modified T cells) can be introduced into subjects, such as mammals, in a variety of ways. Genetically engineered cytotoxic cells can be introduced at tumor sites. In one embodiment, the genetically engineered cytotoxic cells are directed to or modified to target cancer. The number of modified cytotoxic cells used depends on many factors, such as the environment, the purpose of introduction, cell lifespan, and the protocol to be used. For example, the number of modified cytotoxic cells used may depend on the number administered, the cell proliferation capacity, and the stability of the recombinant construct. Modified cytotoxic cells can be applied as a dispersion injected at or near the site of interest. In one embodiment, the cells can be in a physiologically acceptable culture medium.

[0465] It should be understood that treatment methods are influenced by many variables, such as cellular response to CARs (e.g., TN-MUC1 CARs), the efficiency of CAR expression in cytotoxic cells and, if appropriate, the level of secretion, the activity of the expressed CAR, the specific needs of the subject (which may vary over time and circumstances), and the rate of loss of cell activity due to the loss of expression activity in modified cytotoxic cells or individual cells. Therefore, it is anticipated that, even with the availability of universal cells that can be administered to the entire population, individualized doses will be monitored for each individual patient, and such patient monitoring is a routine practice in the field.

[0466] Therefore, in an exemplary embodiment, a method of treating MUC1-related cancer in a subject of need is provided, comprising administering to the subject a therapeutically effective composition comprising modified T cells, the modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0467] In an exemplary embodiment, a method of treating MUC1-related cancer in a subject in need is provided, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 co-stimulatory signaling domain; and a CD3ζ intracellular signaling domain.

[0468] Exemplary cancer types to be treated with the modified cytotoxic cells (e.g., modified T cells comprising TN-MUC1 CARs) or pharmaceutical compositions of the present invention include breast cancer. In some embodiments, breast cancer treated by any method of the present invention is characterized by aberrant glycosylation of MUC1.

[0469] Breast cancer that is histologically diagnosed as hormone receptor (HR, estrogen receptor (ER), or progesterone receptor (PR)) negative and human epidermal growth factor receptor 2 (HER2) negative is called triple-negative breast cancer (TNBC), accounting for approximately 15% of all breast cancers. Due to the invasive nature of the disease, which is associated with a high proliferative index, TNBC generally has poorer outcomes; the standard of care for this subset of breast cancers often differs from other subsets (Gradishar et al. (2018) NCCN Guidelines v. 2018 Breast Cancer. Website: www.nccn.org / professionals / physician_gls / pdf / breast.pdf (accessed Feb. 2019)). As with all breast cancers, local therapy involves both surgery and radiation therapy; however, despite adequate local treatment, many TNBC patients continue to develop remote metastatic disease. Most of these patients do not respond well to conventional chemotherapy, and to date, there are few well-defined drug targets identified as effective treatments for TNBC (Gerratana et al. (2018) Cancer Treat Rev, 68:102-110).

[0470] Metastatic TNBC represents a high unmet need, with a median overall survival (OS) of 6 months from initial diagnosis of metastatic disease, compared to 20 months for patients with hormone receptor-positive and / or HER2-positive metastatic breast cancer. While outcomes for metastatic HER2-positive and hormone receptor-positive breast cancer have improved with varying biology and targets, TNBC remains an unmet need (Ganesan et al. (2014) Mol Cancer Ther, 12:3175-3184). In clinical studies, immunotherapy using PD-1 / PD-L1 inhibitors has shown promising results in advanced TNBC. In advanced TNBC, the combination of atezolizumab with standard chemotherapy (nab-paclitaxel) has shown significant improvements in progression-free survival (PFS) (all patients) and OS (PD-L1 positive, Schmid et al. (2018) New England J Med, 379(22):2108-2121).

[0471] In some embodiments, the breast cancer is hormone receptor-positive (HR-positive). In some embodiments, the breast cancer is hormone receptor-negative. In some embodiments, the breast cancer is estrogen receptor-negative. In some embodiments, the breast cancer is progesterone receptor-negative. In some embodiments, the breast cancer is HER2 receptor-negative. In some embodiments, the breast cancer is metastatic breast cancer. In some embodiments, the breast cancer is triple-negative breast cancer (ER-negative, PR-negative, and HER2-negative). In some embodiments, the breast cancer is triple-positive breast cancer (ER-positive, PR-positive, and HER2-positive). In some embodiments, the breast cancer is triple-negative, metastatic breast cancer. In some embodiments, the breast cancer is incurable, unresectable locally advanced or metastatic breast cancer (LA / MBC). In some embodiments, the breast cancer is ER-negative and / or PR-positive and HER2-negative breast cancer. In some embodiments, the breast cancer is HER2-positive and LA / MBC. In some embodiments, the breast cancer is triple-negative breast cancer and LA / MBC.

[0472] Exemplary breast cancers are those cells that express abnormally glycosylated MUC1 (e.g., TnMUC1) in cancer-expressing cells (i.e., cancers expressing TnMUC1). In some exemplary embodiments, breast cancer is selected from carcinoma, sarcoma, phyllode carcinoma, Paget's disease, and angiosarcoma. In some exemplary embodiments, breast cancer is selected from ductal carcinoma in situ, invasive ductal carcinoma or its subtypes (e.g., tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous carcinoma of the breast, papillary carcinoma of the breast, cribriform carcinoma of the breast, etc.), invasive lobular carcinoma, inflammatory breast cancer, lobular carcinoma in situ, male breast cancer, nipple Paget's disease, phyllode tumor of the breast, metastatic breast cancer, and certain molecular subtypes (e.g., luminal A breast cancer, luminal B breast cancer, triple-negative / basal-like breast cancer, HER2-enriched breast cancer, normal-like breast cancer).

[0473] Breast cancer is characterized by the expression of several biomarkers. For example, breast cancer can be estrogen receptor-positive (ER+) breast cancer, progesterone receptor-positive (PR+) breast cancer, hormone receptor-negative (HR-) breast cancer, HER2 gene overexpression (HER2+) breast cancer, or HER2 gene wild-type or low expression (HER2-) breast cancer. Breast cancer can be group 1 (luminal A) breast cancer (i.e., ER+ / PR+ / HER2-), group 2 (luminal B) breast cancer (i.e., ER+ / PR- / HER2+), group 3 (HER2+) breast cancer (i.e., ER- / PR- / HER2+), or group 4 (basal-like or triple-negative (TN)) breast cancer (i.e., ER- / PR- / HER2-).

[0474] Breast cancer is classified into grades 1, 2, or 3. Grade 1 or well-differentiated (score 3, 4, or 5) breast cancer includes cells that grow slowly and look more like normal breast tissue than higher-grade breast cancer. Grade 2 or moderately differentiated (score 6, 7) breast cancer includes cells that grow at a rate between grade 1 and 3 and look somewhat like cells. Grade 3 or poorly differentiated (score 8, 9) breast cancer includes cells that look very different from normal cells and typically grow and spread faster than grade 1 or 2 cells.

[0475] Therefore, in an exemplary embodiment, the present invention provides a method for treating MUC1-associated triple-negative breast cancer in a subject of need, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23 and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20 and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0476] In an exemplary embodiment, the present invention provides a method for treating MUC1-associated triple-negative breast cancer in a subject of need, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a 4-1BB co-stimulatory signaling domain; and a CD3ζ intracellular signaling domain.

[0477] In an exemplary embodiment, the present invention provides a method for treating MUC1-associated triple-negative breast cancer in a subject of need, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 co-stimulatory signaling domain; and a CD3ζ intracellular signaling domain.

[0478] Exemplary cancer types to be treated with the modified cytotoxic cells (e.g., modified T cells including TN-MUC1 CARs) or pharmaceutical compositions of the present invention include multiple myeloma. Multiple myeloma (MM) is a disease defined by the accumulation of clonal bone marrow plasma cells and the development of clinical complications, including hypercalcemia, renal insufficiency, symptomatic anemia, destructive osteolytic lesions, and susceptibility to infection. According to the National Cancer Institute Surveillance, Epidemiology, and End Results (NCI SEER) database, an estimated more than 30,000 patients have been diagnosed with multiple myeloma in the United States (US), and more than 12,000 have died (Siegel (2016) CA Cancer J Clin, 66:7-30). Over the past decade, significant progress has been made in the treatment of multiple myeloma. A growing number of drugs targeting plasma cells in multiple myeloma, including proteasome inhibitors, immunomodulatory drugs (IMiDs), steroids, and alkylating agents, are now clinically available, enabling the vast majority of newly diagnosed patients to respond to initial therapy. When high-dose chemotherapy and autologous stem cell transplantation (ASCT) follow induction therapy, approximately one-third of patients achieve complete remission, and even more experience clinically meaningful responses (SanMiguel et al. (2013) Lancet Oncol, 14:1055-1066). Despite these advances, even among patients achieving deep remission as detected by sensitive molecular or flow cytometry methods, almost all relapse into the disease, which becomes increasingly refractory to continuous lines of treatment (Martinez-Sanchez et al. (2008) Br J Haematology, 142:766-774; Paiva et al. (2012) Blood, 119:687-691).

[0479] In patients with disease resistant to both bortezomib and IMiD, median progression-free survival and overall survival (OS) are typically reported as 6 to 9 months (Kumar et al., Leukemia, 26:149-157). Second-generation proteasome inhibitors (such as carfilzomib), IMiDs (such as pomalidomide), and monoclonal antibodies (such as daratumumab) are useful additions, but only incrementally improve outcomes (median progression-free survival [PFS] of 3 to 4 months) (Siegel (2016) CA Cancer J Clin, 66:7-30; SanMiguel et al. (2013) Lancet Oncol, 14:1055-1066; Lonial et al. (2016) Lancet, 387(10027):1551-1560). Immunotherapy using PD-1 / PD-L1 checkpoint inhibitors has been evaluated in numerous myeloma trials. The combination of PD-1 targeted agents with IMiD has led to promising clinical activity, and ongoing studies are evaluating potential safety signals for the IMiD-PD1 combination (Costa et al. (2018) Frontiers Immunol, 9:2204). Trials of CAR-T therapy are underway, with promising initial activity. The primary antigen targeted in ongoing studies is B-cell maturation antigen or BCMA (Costa et al. (2018) Frontiers Immunol, 9:2204). Despite recent advances, relapsed / refractory multiple myeloma remains a disease setting with a high degree of unmet need.

[0480] Multiple myeloma (MM) can be characterized using a variety of methods, including laboratory tests, imaging, and biopsy. Laboratory tests include: complete blood counts to measure the levels of red blood cells, white blood cells, and platelets in the blood; blood chemistry tests to measure the levels of serum creatinine, albumin, calcium, lactate dehydrogenase, and other electrolytes; urine tests to measure the presence of myeloma proteins, such as Bence Jones protein (e.g., urine protein electrophoresis, urine immunofixation); quantitative immunoglobulin tests to measure the blood levels of different antibodies, where in subjects with MM, the level of one type of antibody may be higher than that of others; blood tests to assess the presence and levels of abnormal proteins produced by bone marrow cells, such as monoclonal immunoglobulins, monoclonal proteins (M proteins), M spikes, and paraproteins; blood tests to measure the levels of light chains in the blood; and blood tests to assess the presence and levels of β-2 microglobulins.

[0481] The diagnosis of multiple myeloma usually requires: (1) a plasma cell tumor in the bone marrow (confirmed by biopsy) or at least 10% plasma cells; and (2) high blood calcium levels, poor renal function, low red blood cell count (anemia), pores in the bone from the tumor found in imaging studies (CT, MRI, PET scans), an increase in one type of light chain in the blood that makes one type 100 times more common than another, and at least one of 60% or more plasma cells in the bone marrow.

[0482] Multiple myeloma can be staged according to the Revised International Staging System (RISS) based on four factors: serum albumin levels, serum β-2-microglobulin levels, serum lactate dehydrogenase (LDH) levels, and cancer-specific gene abnormalities (cytogenetics). RISS stage I is characterized by serum β-2-microglobulin levels below 3.5 mg / L, albumin levels of 3.5 g / dL or higher, a low-risk cytogenetic profile, and normal LDH levels. RISS stage II is characterized by not belonging to stage I or stage III. RISS stage III is characterized by serum β-2-microglobulin levels of 5.5 mg / L or higher, a high-risk cytogenetic profile, and / or high LDH levels.

[0483] Therefore, in an exemplary embodiment, a method of treating MUC1-associated multiple myeloma in a subject of need is provided, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0484] In an exemplary embodiment, a method of treating MUC1-associated multiple myeloma in a subject of need is provided, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 co-stimulatory signaling domain; and a CD3ζ intracellular signaling domain.

[0485] Exemplary cancer types to be treated with the modified cytotoxic cells (e.g., modified T cells containing TN-MUC1 CAR) or pharmaceutical compositions of the present invention include non-small cell lung cancer (NSCLC). Lung cancer is a leading cause of cancer-related death worldwide, and despite advances in treatment, a significant unmet need remains. NSCLC accounts for 85% of all lung cancer cases in the United States, with a large proportion of the remaining 15% being small cell lung cancer (SCLC) (Zappa et al. (2016) Transl Lung Cancer Res, 5(3):288-300; Alvarado-Luna et al. (2016) Transl Lung Cancer Res, 5(1):26-38). Surgical resection remains the single most consistent and successful option for localized NSCLC; however, nearly 70% of lung cancer patients have locally advanced or metastatic disease at diagnosis (Molina et al. (2008) Mayo Clin Proc, 83(5):584-594). Overall, the prognosis for lung cancer patients is poor, with a 5-year relative survival rate of less than 18%. The median overall survival (OS) for patients with stage IV NSCLC was 4 months, while the 1-year and 5-year survival rates were less than 16% and 2%, respectively (Cetin et al. (2011) Clin Epidemiol, 3:139-148).

[0486] Aside from radiotherapy for stage III or IV lung cancer, platinum-based regimens (doublet chemotherapy; e.g., cisplatin plus gemcitabine or carboplatin plus paclitaxel / gemcitabine) remain one of the main treatment options for unresectable NSCLC (Ettinger et al. (2019) website: nccn.org / professionals / physician_gls / pdf / nscl.pdf (accessed Feb. 2019)). For patients with anaplastic lymphoma kinase (ALK) or sensitized epidermal growth factor receptor (EGFR) mutations or other driver mutations / alterations, single-agent targeted therapy is added to the doublet (Ettinger et al., ibid.; Yoon et al. (2017) World J Clin Oncol, 8(1):1-20). These targeted therapies have had a significant impact on the treatment of NSCLC in patients with genetic alterations and have led to greatly improved outcomes (Ettinger et al., ibid.). However, resistance to TKIs has become a significant unmet medical need, and recent evidence has hypothesized a unique mechanism of TKI resistance (Lin et al. (2014) J Cancer Res, 4(5):411-435). Inhibition of the immune checkpoint PD-1 / PD-L1 pathway is used in first-line and second-line settings for patients with locally advanced or metastatic NSCLC. Compared with chemotherapy alone, PD-1 / PD-L1 pathway inhibition has been shown to improve overall survival, longer duration of response, and fewer adverse events. Currently, the NCCN guidelines recommend PD-1 inhibition in both first-line settings (associated with strong PD-L1 expression in tumors) and second-line settings (regardless of PD-L1 expression; Ettinger et al., ibid.). Despite recent advances in targeted agents and checkpoint inhibition, NSCLC remains an area of ​​significant unmet need.

[0487] NSCLC includes adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. NSCLC can be characterized by a variety of methods, including laboratory tests, imaging, and biopsy. For example, the diagnosis of NSCLC may require bone scans, imaging tests (MRI, CT scans, PET scans), microscopic examination of sputum to examine for cancer cells, and lung biopsy tests.

[0488] NSCLC is staged according to the American Joint Committee on Cancer (AJCC) Tumor, Lymph Node, Metastasis (TNM) system, which is based on three main factors: (1) the size and extent of the primary tumor; (2) spread to nearby lymph nodes; and (3) spread to distant sites. The earliest stage of NSCLC is stage 0 (also known as carcinoma in situ). Other stages range from stage I to stage IV, with higher stage numbers indicating more extensive spread of the cancer.

[0489] Therefore, in an exemplary embodiment, a method of treating MUC1-associated non-small cell lung cancer in a subject of need is provided, comprising administering to the subject a therapeutically effective composition comprising modified T cells, the modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0490] In an exemplary embodiment, a method of treating MUC1-associated non-small cell lung cancer in a subject of need is provided, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 co-stimulatory signaling domain; and a CD3ζ intracellular signaling domain.

[0491] Exemplary cancer types to be treated with the modified cytotoxic cells (e.g., modified T cells including TN-MUC1 CARs) or pharmaceutical compositions of the present invention include pancreatic cancer. Pancreatic ductal adenocarcinoma is a highly lethal malignancy. It is the fourth leading cause of cancer-related death in the United States, with approximately 45,000 new cases each year. Surgical resection is the only potentially curative treatment, but for most patients with advanced disease, only 15–20% are candidates for surgical intervention (Fogel et al. (2017) Am J Gastroenterology, 112(4):537–555). Overall, even with surgical intervention, the prognosis is poor: the five-year survival rate for surgery is approximately 25% for lymph node-negative disease and approximately 10% for lymph node-positive disease. Chemotherapy is the primary treatment because most patients present with unresectable disease. Moderate improvements in efficacy have been observed prior to the recently developed combination chemotherapy. FOLFIRINOX treatment showed increased median OS and PFS compared to gemcitabine alone, although increased toxicity was observed with combination therapy. Optional combination therapies include gemcitabine and nab-paclitaxel, which, despite a poorer median overall survival, are more widely used than FOLFIRINOX due to their favorable toxicity profile.

[0492] Despite the success of targeted therapies and immunotherapies in other solid tumors, similar improvements in efficacy have not been evident in pancreatic cancer (Amanam et al. (2018) Cancers, 10(2). pii: E36). Interestingly, immune checkpoint inhibitors have shown greater success in pancreatic cancer. Overall, pancreatic cancer remains an area of ​​high unmet need, and clinical trials are considered part of the standard of care in the disease setting (Tempero et al. (2019) website: nccn.org / professionals / physician_gls / pdf / pancreatic.pdf. (accessed Feb 2019)).

[0493] Pancreatic cancer can be characterized using imaging tests (CT scan, MRI, ultrasound, cholangiopancreatography, PET scan, angiography), blood tests, and biopsy. Blood tests for detecting pancreatic cancer include liver function tests and assessment of the presence of tumor markers such as CA 19-9 and carcinoembryonic antigen (CEA).

[0494] Pancreatic cancer can be staged according to the American Joint Committee on Cancer (AJCC) Tumor, Lymph Node, Metastasis (TNM) system, which is based on three main factors: (1) the size and extent of the primary tumor; (2) spread to nearby lymph nodes; and (3) spread to distant sites. The earliest stage of pancreatic cancer is stage 0 (also known as carcinoma in situ). Other stages range from stage I to stage IV, with higher stage numbers indicating more extensive spread of the cancer.

[0495] Therefore, in an exemplary embodiment, a method of treating MUC1-associated pancreatic cancer in a subject of need is provided, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a co-stimulatory signal transduction domain; and an intracellular signal transduction domain.

[0496] In an exemplary embodiment, a method of treating MUC1-associated pancreatic cancer in a subject of need is provided, comprising administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises a heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 22, 23, and 24, and wherein the VL domain comprises a light chain complementarity-determining region (CDR) sequence described in SEQ ID NO: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 co-stimulatory signaling domain; and a CD3ζ intracellular signaling domain.

[0497] Exemplary cancer types to be treated with the modified cytotoxic cells (e.g., modified T...

Claims

1. A modified immune cell or its precursor cell, comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR comprises: The MUC1-specific antigen-binding domain includes a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementarity-determining region (CDR) sequence described in SEQ ID NO:22, 23 and 24, and wherein the VL domain includes the light chain complementarity-determining region (CDR) sequence described in SEQ ID NO:19, 20 and 21; Transmembrane domain; Co-stimulatory signal transduction domains; and Intracellular signal transduction domain.

2. The modified immune cell according to claim 1, wherein the MUC1-specific antigen-binding domain is specific to the glycotopes of MUC1.

3. The modified immune cell according to claim 1 or 2, wherein the MUC1-specific antigen-binding domain is specific to the truncated glycotopes of MUC1.

4. The modified immune cell according to any one of the preceding claims, wherein the VH domain comprises the amino acid sequence described in SEQ ID NO:

5.

5. The modified immune cell according to any one of the preceding claims, wherein the VL domain comprises the amino acid sequence described in SEQ ID NO:

6.

6. The modified immune cell according to any one of the preceding claims, wherein the VH domain comprises the amino acid sequence described in SEQ ID NO:5, and the VL domain comprises the amino acid sequence described in SEQ ID NO:

6.

7. The modified immune cell according to any one of the preceding claims, wherein the MUC1-specific antigen-binding domain comprises the amino acid sequence described in SEQ ID NO:

4.

8. The modified immune cell according to any one of the preceding claims, wherein the transmembrane domain comprises a transmembrane region selected from the group consisting of: type I transmembrane proteins, the α chain of the T cell receptor, the β chain of the T cell receptor, the ζ chain of the T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

9. The modified immune cell according to any one of the preceding claims, wherein the transmembrane domain comprises the CD8 transmembrane region.

10. The modified immune cell according to any one of the preceding claims, wherein the transmembrane domain comprises the amino acid sequence described in SEQ ID NO:7.

Images