ADRB2 gene methylation detection kit for assisting in diagnosing or detecting acute ischemic stroke
The ADRB2 gene methylation detection kit has solved the detection challenge in the diagnosis of acute ischemic stroke, achieving efficient and accurate molecular-level detection, improving diagnostic efficiency and specificity, and supporting early detection and treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2026-03-24
AI Technical Summary
Current technology lacks a convenient, targeted, and highly accurate method for assisting in the diagnosis or detection of ADRB2 gene methylation in acute ischemic stroke.
An ADRB2 gene methylation detection kit is provided, comprising the ADRB2 gene promoter region target sequence, methylation-specific amplification primers and sequencing primers, and RT-qPCR quantitative amplification primers for ADRB2 transcriptome, for detecting the degree of ADRB2 gene methylation.
This technology enables rapid and accurate detection of ADRB2 gene methylation at the molecular level, improving the diagnostic efficiency and specificity of acute ischemic stroke and offering advantages for early detection and timely treatment.
Smart Images

Figure CN120945046B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of auxiliary diagnostic technology for acute ischemic stroke, and in particular to an ADRB2 gene methylation detection kit for auxiliary diagnosis or detection of acute ischemic stroke. Background Technology
[0002] Acute ischemic stroke (AIS), commonly known as acute cerebral infarction, acute cerebral infarction, or stroke, is a disease caused by various factors leading to impaired blood supply to brain tissue, resulting in ischemic and hypoxic necrosis and ultimately, brain dysfunction. Stroke is one of the leading causes of death and disability in humans, and ischemic stroke is the most common type, accounting for 69.6%-70.8% of strokes in my country.
[0003] Current treatments for acute ischemic stroke include intravenous recombinant tissue plasminogen activator (rt-PA), antiplatelet and anticoagulation therapy, and reperfusion therapy. However, rt-PA has a narrow therapeutic window, applicable only to 5-7% of patients. Antiplatelet and anticoagulation therapy have not adequately reduced the risk of recurrent ischemic stroke. Reperfusion itself may induce additional damage, namely ischemia-reperfusion (I / R) injury. I / R activates resident microglia and promotes the infiltration of peripheral immune cells into the infarct foci and penumbra. Pro-inflammatory mediators such as tumor necrosis factor (TNF), interleukin-1β (IL-1β), and interleukin-6 (IL-6) are expressed at increased levels in the infarct area, and both infiltrating and resident cells participate in the post-stroke inflammatory response. Simultaneously, oxidative stress, as an independent damaging factor, promotes lipid peroxidation through excessive accumulation of reactive oxygen species (ROS), exacerbating the inflammatory response.
[0004] β2-adrenergic receptors (ADRB2) are a crucial component of sympathetic nerve signaling in mammals, widely known for their close association with inflammation, oxidative stress, and even angiogenesis. For example, Zahalka et al. demonstrated that β2-adrenergic receptors in endothelial cells... ADRB2 The absence of ADRB2 enhances oxidative phosphorylation, thereby inhibiting angiogenesis. Similarly, Jahn et al. reported that activation of ADRB2 signaling promotes neovascularization during callus formation in mice, thus improving fracture healing. These findings collectively highlight the important role of ADRB2 in angiogenesis. However, currently, no information on ADRB2 angiogenesis has been publicly available, either domestically or internationally. ADRB2 Research reports on the association between gene DNA methylation and acute ischemic stroke. Summary of the Invention
[0005] The technical problem to be solved by this invention is to provide a convenient, highly targeted, and highly accurate method for assisting in the diagnosis or detection of acute ischemic stroke. ADRB2 Gene methylation detection kit.
[0006] The technical solution adopted by this invention to solve the above-mentioned technical problems is: a tool for assisting in the diagnosis or detection of acute ischemic stroke. ADRB2 Gene methylation detection kit, including ADRB2 The target sequence of the gene promoter region, whose nucleotide sequence is shown in SEQ ID NO. 2: CGCCCCTTCGCGGCTGCCGGCGTGCCATTGGCCGAAAGTTCCCGTACGTCACGGCG.
[0007] Furthermore, the aforementioned ADRB2 The specific locations of the 10 CpG sites within the gene promoter region are as follows:
[0008]
[0009] Furthermore, it also includes a pair ADRB2 Gene methylation-specific amplification primers and one ADRB2 Gene methylation-specific sequencing primers.
[0010] Furthermore, the aforementioned ADRB2 The nucleotide sequence of the upstream primer for gene methylation-specific amplification is shown in SEQ ID NO.3: 5'-GAGGGAAAGGGGAGGAGAGT-3';
[0011] The aforementioned ADRB2 The nucleotide sequence of the downstream primer for gene methylation-specific amplification is shown in SEQ ID NO.4: 5'-Biotin-ACCTACCAATTCCAACCC-3';
[0012] The aforementioned ADRB2 The nucleotide sequence of the gene methylation-specific sequencing primer is shown in SEQ ID NO.5: 5'-GAAAGGGGAGGAGTG-3'.
[0013] Furthermore, it also includes ADRB2 Primers for RT-qPCR quantitative amplification of the transcriptome, as described above ADRB2 The nucleotide sequence of the forward amplification primer for the transcriptome is shown in SEQ ID NO.6: 5'-TTGCCTCTTCCATCGTGTCC-3', and the nucleotide sequence of the reverse amplification primer for the ADRB2 transcriptome is shown in SEQ ID NO.7: 5'-CCACCTGGCTAAGGTTCTGG-3'.
[0014] Compared with the prior art, the advantages of the present invention are: the present invention discloses for the first time a method for assisting in the diagnosis or detection of acute ischemic stroke. ADRB2 Gene methylation detection kit ADRB2 The degree of methylation in gene promoter regions is positively correlated with the prevalence of acute ischemic stroke. This can be detected by... ADRB2 Gene methylation level-based detection kits can conveniently and rapidly detect acute ischemic stroke at the molecular level, offering high detection efficiency and strong specificity. ADRB2 Gene average methylation combination ADRB2 Transcriptome mRNA expression levels further enhance the diagnostic value for acute ischemic stroke.
[0015] In summary, this invention is based on the detection ADRB2 Gene methylation-based detection kits can conveniently and rapidly detect acute ischemic stroke at the molecular level. These kits are highly efficient and specific, facilitating early detection and timely treatment of acute ischemic stroke. ADRB2 Drugs targeting gene methylation levels represent an innovative application for the auxiliary diagnosis, detection, and screening of acute ischemic stroke. Attached Figure Description
[0016] Figure 1 To show the distribution of different types of methylation on each chromosome through genome-wide methylation alignment analysis;
[0017] Figure 2 Volcano plot of differentially methylated genes in the whole genome of samples from the case group and the control group. Green represents low methylated genes and red represents high methylated genes.
[0018] Figure 3 To screen the case group and control group ADRB2 Differences in the amount of methylated CpG in genes, * indicates P value < 0.05;
[0019] Figure 4 To screen the case group and control group ADRB2 Differences in methylation levels within genes, ** indicates P < 0.01;
[0020] Figure 5 For the selected sub-region of the starter ADRB2 The target sequence and the distribution of 10 CpG sites;
[0021] Figure 6 The DNA methylation sequencing profile shows that the methylation levels of CpG1 to CpG10 are 36%, 49%, 8%, 13%, 10%, 23%, 39%, 19%, 18%, and 18%, respectively.
[0022] Figure 7 To verify the difference between the case group and the control group ADRB2Differences in DNA methylation were compared, n=90, ****P<0.0001;
[0023] Figure 8 for ADRB2 ROC curve analysis of 10 CpG sites in the gene for the diagnosis of acute ischemic stroke;
[0024] Figure 9 Plasma in the case group and the control group ADRB2 Transcriptome mRNA expression level analysis;
[0025] Figure 10 This study compares the plasma ADRB2 protein expression levels in the case group and the control group. In this paper, A represents the results of Western blot analysis of ADRB2 protein, and B represents... ADRB2 Statistical graph of relative expression levels of plasma proteins, ****P<0.0001;
[0026] Figure 11 for ADRB2 ROC curve analysis of the combined diagnosis of acute ischemic stroke using average methylation and transcriptome expression levels. Detailed Implementation
[0027] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.
[0028] Specific Example 1: Whole-genome methylation sequencing revealed... ADRB2 Significant differences in methylation were observed.
[0029] 1. Clinical data of volunteers:
[0030] This study collected data from 5 patients (3 males, 2 females) hospitalized in the Department of Neurology at a hospital in 2018 with acute ischemic stroke, and 5 age- and sex-matched controls (3 males, 2 females). The control group was carefully matched for sex and age, and excluded individuals with acute cerebrovascular disease, trigeminal neuralgia, Parkinson's disease, traumatic brain injury, or other related neurological disorders. All patients with acute ischemic stroke met the diagnostic criteria outlined in the *Chinese Guidelines for the Diagnosis and Treatment of Acute Ischemic Stroke (2023)*. Patients with severe comorbidities, including other major cardiovascular and cerebrovascular diseases, advanced liver and kidney dysfunction, malignant tumors, or multiple organ failure, were excluded. Initial diagnoses were made by the attending physician and subsequently confirmed by a senior physician. Written informed consent was obtained from all participants, and the study protocol was approved by the hospital's ethics review committee. After obtaining informed consent from all participants, 4 mL of peripheral venous blood was collected from patients within 6 hours of admission and placed in an anticoagulant tube. The blood was then carefully extracted from the middle layer of leukocytes after centrifugation at 3000 rpm for 15 minutes at 4°C.
[0031] 2. DNA extraction and quality testing
[0032] Genomic DNA was extracted from peripheral blood leukocytes using the Qiagen Genomic DNA Extraction Kit (Qiagen, Germany). DNA sample quality was determined using Nanodrop, and samples typically met the following requirements: OD260 / OD280 ≥ 1.8, OD260 / OD230 ≥ 1.5.
[0033] 3. Whole-genome DNA methylation sequencing
[0034] (1) Genomic DNA fragmentation: Genomic DNA was fragmented into small fragments using The AIR™ DNA Fragmentation Kit (BiooScientific Corporation).
[0035] (2) DNA Fragment End Repair and Screening: The synergistic action of T4 DNA polymerase and Klenow enzyme repairs the overhanging structures at the ends of fragmented DNA, forming blunt ends. During this process, Klenow enzyme's 3′→5′ exonuclease activity removes the 3′ overhangs, while its DNA polymerase activity fills in the 5′ recesses. Simultaneously, T4 polynucleotide kinase (T4 PNK) is added to phosphorylate the 5′ end of the DNA fragment, providing the necessary conditions for subsequent ligation. After end repair and phosphorylation, Agencourt AMPure XP magnetic beads are used for specific screening and purification of target fragments (300-400 bp).
[0036] (3) Ligation of methylated sequencing adapters: Add an A base sequence to the 3′ end and add an A to the end to make it a sticky end, which reduces the interconnection between fragments when ligating adapter sequences. At the same time, since there is an independent T base at the 3′ end of the adapter sequence, the DNA fragment is specifically ligated to the adapter sequence. The adapter sequence corresponds to the amplification primers on the flow cell. The ligation product is recovered and purified.
[0037] (4) Sulfite conversion: DNA is treated with bisulfite to convert unmethylated cytosine into uracil, while methylated cytosine remains unchanged.
[0038] (5) Amplification, purification and quantification: After the sequencing library is constructed, the library is first initially quantified using Qubit2.0 and diluted to 1ng / ul. Then, the insert size of the sequencing library is detected using Agilent 2100 Bioanalyzer. After the insert size meets the expectations, the effective concentration of the library is accurately quantified using qPCR (effective concentration of library >2nM) to ensure the quality of the library.
[0039] (6) Hiseq 4000 sequencing: After the sequencing libraries pass the quality inspection, different sequencing libraries are pooled according to the different requirements of effective concentration and the amount of data to be sequenced, and then the HiSeq sequencer is used for sequencing.
[0040] 4. Whole-genome methylation sequencing results
[0041] Genome alignment analysis results show the distribution of different types of methylation on chromosomes as follows: Figure 1 As shown, CpG methylation was the most abundant and showed the most significant differences across different chromosomes. Meanwhile, as... Figure 2 As shown, we also discovered a large number of differentially expressed DNA methylation genes through whole-genome methylation sequencing. For example... Figure 3 As shown, we identified cases in the case group through screening. ADRB2 The amount of CpG methylation in the DNA sequence was significantly higher than that in the control group. And as... Figure 4 As shown, ADRB2DNA methylation levels were also significantly increased, with the nucleotide sequence of the methylated region shown in SEQ ID NO.1: chr5:148826001-148827000; the specific sequence is: tgtcaccatgtctttgtgcttctgggtgcttctgtgtttgtttctggccgcgtttctgtgttggacaggggtgactttgtgccggatggcttctgtgtgagagcgcgcgcgagtgtgcatgtcggtgagctgggagggtgtgtctcagtgtctatggctgtggttcggtataagtctgagcatgtctgccagggtgtatttgtgcctgtatgtgcgtgcctcggtgggcactctcgtttccttccgaatgtggggcagtgccggtgtgctgccctctgccttgagacctcaagccgcgcaggcgcccagggcaggcaggtagcggccacagaagagccaaaagctcccgggttggctggtaaggacaccacctccagctttagccctctggggccagccagggtagccgggaagcagtggtggcccgccctccagggagcagttgggccccgcccgggccagccccaggagaaggagggcgaggggaggggagggaaaggggaggagtgcctcgccccttcgcggctgccggcgtgccattggccgaaagttcccgtacgtcacggcgagggcagttcccctaaagtcctgtgcacataacgggcagaacgcactgcgaagcggcttcttcagagcacgggctggaactggcaggcaccgcgagcccctagcacccgacaagctgagtgtgcaggacgagtccccaccacacccacaccacagccgctgaatgaggcttccaggcgtccgctcgcggcccgcagagccccgccgtgggtccgcccgctgaggcgcccccagccagtgcgctcacctgccagactgcgcgccatggggcaacccgggaacggcagcgccttcttgctggcacccaatggaagccatgcgccggaccacgacgtcacgcaggaaagggacgaggtgtgggtggtgggcatgggcatcgtcatgtctctcatcgtcctggccatcgtgtttggcaatgtgctggtcatcacag。
[0042] Previous research has shown that hypermethylation in gene promoter regions may participate in the pathological process of diseases by regulating gene expression. To investigate... ADRB2 The association between gene epigenetic modifications and acute ischemic stroke. Figure 5 As shown, we selected ADRB2 The gene promoter region fragment was methylated and sequenced using the PyroMark Q24 Pyrosequencing System (Qiagen). After evaluation using the PyroMark Assay Design software's scoring system, we ultimately selected... ADRB2 The promoter region fragment chr5:148826513-148826568, with the nucleotide sequence shown in SEQ ID NO.2: CGCCCCTTCGCGGCTGCCGGCGTGCCATTGGCCGAAAGTTCCCGTACGTCACGGCG, was used for further research. PyroMark Assay Design software identified 10 CpG sites within this region for quantitative methylation analysis.
[0043] Specific Implementation Example 2: Expanding Clinical Sample Validation ADRB2 Significant differences in methylation were observed.
[0044] 1. Clinical data of volunteers:
[0045] This study included 90 patients with acute ischemic stroke (45 males, 45 females, mean age 65.81 ± 0.86 years) and 90 age- and sex-matched controls (45 males, 45 females, mean age 64.27 ± 0.84 years, p>0.05, Table 1) who were hospitalized in the neurology department of a hospital from January to August 2024. The control group was carefully matched for sex and age, and patients with acute cerebrovascular disease, trigeminal neuralgia, Parkinson's disease, traumatic brain injury, or other related neurological diseases were excluded. All patients with acute ischemic stroke met the diagnostic criteria outlined in the "Chinese Guidelines for the Diagnosis and Treatment of Acute Ischemic Stroke (2023)". Patients with severe comorbidities, including other major cardiovascular and cerebrovascular diseases, advanced liver and kidney dysfunction, malignant tumors, or multiple organ failure, were excluded. The initial diagnosis was made by the attending physician and subsequently confirmed by a senior physician. Written informed consent was obtained from all participants, and the research protocol was approved by the ethics review committee of a hospital. After obtaining informed consent from all participants, 4 mL of peripheral venous blood was collected from patients within 6 hours of admission and placed in an anticoagulant tube. The blood was then carefully extracted after centrifugation at 3000 rpm for 15 minutes at 4°C, followed by the removal of the upper plasma layer and the middle leukocyte layer. Routine biochemical indicators, including homocysteine (HCY), total cholesterol (TC), triglycerides (TG), low-density lipoprotein (LDL), high-density lipoprotein (HDL), lipoprotein a (Lp(a)), apolipoprotein A (ApoA), apolipoprotein B (ApoB), and apolipoprotein E (ApoE), were examined using an automated biochemical analyzer (Olympus AU2700, Japan). The results are shown in Table 1.
[0046] Table 1. Comparison of clinical data between the clinical acute ischemic stroke case group and the control group.
[0047]
[0048] Table 1 shows that patients in the acute ischemic stroke group had a higher proportion of smoking, diabetes, and hypertension history. Although there were no significant differences in BMI, HCY, TG, and ApoE levels among the groups, systolic blood pressure, HCY, and Lp(a) levels were higher in the acute ischemic stroke group than in the control group at admission. Conversely, LDL, HDL, ApoA1, ApoB, and ApoE levels were lower in the acute ischemic stroke group.
[0049] 2. Genomic DNA methylation level determination:
[0050] For quantitative DNA methylation analysis, genomic DNA was extracted from peripheral blood leukocytes using the Qiagen Genomic DNA Extraction Kit (Qiagen, Germany). After DNA concentration was measured using a nucleic acid protein analyzer, DNA was converted to bisulfite using the QIAGEN EpiTect® Bisulfite Treatment Kit (Qiagen, Germany). Primer design was performed using PyroMark Assay Design 2.0 software. ADRB2 The specific primer sequences for pyrosequencing were designed, and the PCR amplification primers and sequencing primers used in the experiment are as follows:
[0051] ADRB2 The nucleotide sequence of the gene DNA methylation-specific forward primer is shown in SEQ ID NO.3: 5'-GAGGGAAAGGGGAGGAGAGT-3';
[0052] ADRB2 The nucleotide sequence of the gene DNA methylation-specific downstream primer is as follows (SEQ ID NO.4): 5'-Biotin-ACCTACCAATTCCAACCC-3';
[0053] ADRB2 The nucleotide sequence of the DNA methylation-specific sequencing primer is SEQ ID NO.5 as follows: 5'-GAAAGGGGAGGAGTG-3'.
[0054] Figure 6 Showing ADRB2 Example of gene methylation level detection results. Figure 6 The percentages shown represent the methylation degree of the corresponding CpG sites. The methylation degrees of CpG1 to CpG10 are 36%, 49%, 8%, 13%, 10%, 23%, 39%, 19%, 18%, and 18%, respectively.
[0055] Figure 7 shows that, compared with the control group, the methylation levels and mean methylation levels of all 10 CpG sites were significantly increased in patients with acute ischemic stroke (P<0.0001). Figure 8 The results of receiver operating characteristic (ROC) curve analysis showed that ADRB2Methylation showed good predictive efficacy for acute ischemic stroke, specifically as follows: CpG1, AUC=0.8504, sensitivity 74.4%, specificity 98.9%; CpG2, AUC=0.8333, sensitivity 73.3%, specificity 98.9%; CpG3, AUC=0.8652, sensitivity 73.3%, specificity 98.9%; CpG4, AUC=0.8951, sensitivity 74.4%, specificity 98.9%; CpG5, AUC=9157, sensitivity 75.5%, specificity 98.9%; CpG6, AUC=0.8375, sensitivity 73.3%, specificity 100%; CpG7, AUC=0.7777, sensitivity 74.4%, specificity 98.9%; CpG8, AUC=0.8994, sensitivity 74.4%, specificity 100%; CpG9, AUC=0.9120, sensitivity 81.1%, specificity 96.7%; CpG10, AUC=0.9184, sensitivity 82.2%, specificity 95.6%.
[0056] 3. The clinical relevance of ADRB2 to patients with acute ischemic stroke:
[0057] Subsequently, we further clarified ADRB2 The expression of transcriptomes in the blood of clinical patients. In a control group of 90 patients, we selected 24 age- and sex-matched patients with acute ischemic stroke and control groups. Total RNA was extracted from blood using the phenol-chloroform method. The simplified steps are as follows: 1) Take 200 μL of the white membrane layer from centrifuged blood, add 800 μL of RNA extraction buffer, and vortex to mix; 2) Add 250 μL of chloroform, mix thoroughly, and let stand for 3 min; 3) Centrifuge at 12000 rpm for 10 min at 4℃; 4) Transfer 400 μL of supernatant to a new centrifuge tube, add 0.8 times the volume of isopropanol, and invert to mix; 5) Incubate at -20℃ for 15 min; 6) Centrifuge at 12000 rpm for 10 min at 4℃; the white precipitate at the bottom of the tube is RNA; 7) Aspirate the liquid, add 1.5 ml of 75% ethanol to wash the precipitate; 8) Centrifuge at 12000 rpm for 5 min at 4℃; 9) Aspirate the liquid completely, place the centrifuge tube on a clean bench and blow-dry for 3 min; 10) Add 15 μL of water-nuclease-free... Dissolve the RNA. After passing the RNA quality test with Nanodrop2000, use a commercially available RNA reverse transcription kit [Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA)] to perform cDNA synthesis according to the instructions.
[0058] Primer Primer 6 software was used to analyze... ADRB2 Primers were designed for RT-qPCR amplification of the transcriptome. The nucleotide sequence of the forward amplification primer for the ADRB2 transcriptome is shown in SEQ ID NO.6: 5'-TTGCCTCTTCCATCGTGTCC-3', and the nucleotide sequence of the reverse amplification primer for the ADRB2 transcriptome is shown in SEQ ID NO.7: 5'-CCACCTGGCTAAGGTTCTGG-3'.
[0059] Commercially available quantitative RT-qPCR kits [SYBR Green PCR Master Mix (Roche, USA)] were used, and qRT-PCR amplification was performed on a LightCycler® 480 real-time PCR instrument according to the manufacturer's instructions. PCR results were analyzed using 2... ΔΔCT The comparison was performed as follows: A = CT(target gene, test sample) - CT(internal control gene, test sample); B = CT(target gene, control sample) - CT(internal control gene, control sample); K = AB; fold change = 2 -K As shown in Figure 9, RT-qPCR analysis revealed that ADRB2 transcriptome expression was significantly reduced in patients with acute ischemic stroke compared to the control group (P<0.05).
[0060] To further elucidate the changes in ADRB2 protein levels in patient blood, Western blot analysis was performed on plasma protein concentrations. The plasma protein detection procedure was simple as follows: blood samples were centrifuged at 3000 rpm for 10 minutes at 4°C to collect the supernatant plasma, followed by BCA assay. Based on the plasma protein concentration, RIPA and 5× protein loading buffer were used to unify the concentrations of each group. After 8 minutes in a 100°C water bath, proteins were loaded onto SDS-PAGE gels for electrophoresis. The separated proteins were then transferred to a PVDF membrane and incubated with rabbit anti-ADRB2 antibody (1:2000, ABclonal, Cat. A2048) and mouse anti-Transferrin antibody (1:5000, Affinity, Cat. BF0720) as internal control antibodies. The results are shown in Figure 10, A and B. Figure 10 As shown in Figure B, compared with the control group, the ADRB2 protein level was significantly reduced in patients with acute ischemic stroke (P<0.0001). Figure 11 The results of the ROC curve analysis show that, ADRB2Average gene methylation (AUC = 0.843, p < 0.001, sensitivity 80%, specificity 100%) has high diagnostic value for acute ischemic stroke. ADRB2 The diagnostic value is higher when methylation is combined with mRNA expression level (AUC=0.982, sensitivity 90%, specificity 100%).
[0061] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.
Claims
1. A kit for assisting in the diagnosis or detection of ADRB2 gene methylation in acute ischemic stroke, characterized in that: Including detection ADRB2 Reagents for gene promoter region target sequences, the aforementioned ADRB2 The target sequence of the gene promoter region is shown in SEQ ID NO.2: CGCCCCTTCGCGGCTGCCGGCGTGCCATTGGCCGAAAGTTCCCGTACGTCACGGCG, and the reagent includes... ADRB2 upstream primers for gene methylation-specific amplification ADRB2 Gene methylation-specific amplification downstream primers and ADRB2 Gene methylation-specific sequencing primers, as described ADRB2 The nucleotide sequence of the upstream primer for gene methylation-specific amplification is shown in SEQ ID NO.3: 5'-GAGGGAAAGGGGAGGAGAGT-3'; ADRB2 The nucleotide sequence of the downstream primer for gene methylation-specific amplification is shown in SEQ ID NO.4: 5'-Biotin-ACCTACCAATTCCAACCC-3'; ADRB2 The nucleotide sequence of the gene methylation-specific sequencing primer is shown in SEQ ID NO.5: 5'-GAAAGGGGAGGAGTG-3'.
2. The ADRB2 gene methylation detection kit for assisting in the diagnosis or detection of acute ischemic stroke according to claim 1, characterized in that: Also includes ADRB2 Primers for RT-qPCR quantitative amplification of the transcriptome.
3. The method for assisting in the diagnosis or detection of acute ischemic stroke as described in claim 2. ADRB2 Gene methylation detection kit, characterized in that The aforementioned ADRB2 The nucleotide sequence of the forward amplification primers for the transcriptome is shown in SEQ ID NO.6: 5'-TTGCCTCTTCCATCGTGTCC-3'. ADRB2 The nucleotide sequence of the reverse amplification primer for the transcriptome is shown in SEQ ID NO.7: 5'-CCACCTGGCTAAGGTTCTGG-3'.