Application of ZmPMT1 gene in identification of excellent haplotype with high content of polyunsaturated fatty acid omega-6 and / or omega-3 in corn kernels

Abstract

The invention relates to the technical field of genetic breeding, and particularly discloses application of a ZmPMT1 gene in identification of excellent haplotypes with high content of polyunsaturated fatty acids omega-6 and / or omega-3 in corn kernels. The ZmPMT1 gene has four mutation sites, and the mutation sites are A / G mutation at the 283bp site, G / A mutation at the 1151bp site, C / A mutation at the 1367bp site and C / G mutation at the 1387bp site of the ZmPMT1 gene respectively; when the haplotype is HapAGCC, the haplotype is identified as an excellent haplotype with high content of polyunsaturated fatty acid omega-6 and / or omega-3 in the corn kernels. It is found that mutation of ZmPMT1 can cause significant reduction of omega-6 and omega-3, the dominant haplotype HapAGCC enhances the activity of methyltransferase of ZmPMT1 and accelerates synthesis of a fatty acid desaturation reaction substrate phosphatidylcholine, and then the content of omega-6 and omega-3 in corn kernels is increased, so that the ZmPMT1 gene can be used for regulating and controlling the content of omega-6 and omega-3 in corn kernels.

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology, specifically to ZmPMT1 Application of genes in identifying superior haplotypes with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels. Background Technology

[0003] Modern cultivated maize varieties generally have a total oil content of less than 4% in the kernels, with total PUFAs accounting for less than 3%, of which ω-6 accounts for 51% and ω-3 only 1.4%. Therefore, researching strategies to regulate the content of ω-6 and ω-3 fatty acids in maize has significant scientific value and application prospects for improving the nutritional quality of maize. Summary of the Invention

[0004] This invention provides a strategy for studying the regulation of ω-6 and ω-3 fatty acid content in maize. ZmPMT1 Application of genes in identifying superior haplotypes with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels. The haplotype identified in this invention is Hap. AGCC It exhibits superior haplotypes with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in corn kernels. ZmPMT1 Genes can significantly increase the content of polyunsaturated fatty acids in corn kernels.

[0005] This invention provides ZmPMT1 Application of genes in identifying superior haplotypes with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels, refer to the fourth edition of the Maize B73 reference genome. ZmPMT1 The gene is located on chromosome Chr03, and the stated ZmPMT1 The nucleotide sequence of the gene is shown in SEQ ID NO.1. ZmPMT1 There are four mutation sites on the gene, which are located at... ZmPMT1 Mutations at positions 283bp (A / G), 1151bp (G / A), 1367bp (C / A), and 1387bp (C / G); when the haplotype is Hap AGCC At that time, it was identified as an excellent haplotype with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels.

[0006] Detecting maize genome ZmPMT1 The coding region SNP combination is: chr3.S_206152928+chr3.S_206151330+chr3.S_206150884+chr3.S_206150864, ​​where the base type is AGCC, indicating a variety with high ω-3 and ω-6 fatty acids.

[0007] The haplotype identified by this invention is Hap. AGCC It exhibits superior haplotypes with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in corn kernels. ZmPMT1 Genes are used to regulate the content of polyunsaturated fatty acids in corn kernels.

[0008] Furthermore, the nucleotide sequence of the high-content haplotype of the maize kernel with polyunsaturated fatty acids ω-6 and / or ω-3 is shown in SEQ ID NO.2.

[0009] The present invention also provides ZmPMT1 Application of the gene in regulating the content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels, referring to the fourth edition of the maize B73 reference genome, activating the aforementioned ZmPMT1 Genes are used to increase the content of ω-3 and ω-6 fatty acids in the corn kernels; ZmPMT1 Loss-of-function mutations in genes are used to reduce the content of ω-6 and ω-3 in maize kernels.

[0010] Furthermore, ZmPMT1 Loss-of-function mutations of genes ZmPMT1 The gene coding sequence at position 1452 is mutated from C to T, or... ZmPMT1 The gene coding sequence at position 1482 is mutated from C to T.

[0011] Furthermore, detection ZmPMT1 The primers for detecting the mutation site at position 1452 of the gene coding sequence, where C is mutated to T, include the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.4.

[0012] Furthermore, detection ZmPMT1 The primers for detecting the mutation site at position 1482 of the gene coding sequence, where C is changed to T, include the upstream primer shown in SEQ ID NO.5 and the downstream primer shown in SEQ ID NO.4.

[0013] Furthermore, detection ZmPMT1 The PCR reaction conditions for the mutation site at position 1482 of the gene coding sequence, where C is mutated to T, are: denaturation at 95℃ for 30 s, annealing for 30 s, and extension at 72℃ for 30 s.

[0014] This invention provides ZmPMT1 The application of genes in maize breeding: selecting superior haplotypes of Hap with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels. AGCC They bred corn varieties.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention regulates genes ZmPMT1 It can effectively increase the content of polyunsaturated fatty acids ω-3 and ω-6 in maize kernels, laying the foundation for cultivating high-yield maize and showing very high application prospects. Furthermore, an excellent haplotype, Hap, has already been identified. AGCC It can increase the content of polyunsaturated fatty acids in corn kernels.

[0016] This invention obtained ZmPMT1 premature termination mutant materials through an EMS mutagenesis mutant library. The results showed that the content of polyunsaturated fatty acids in maize kernels was significantly reduced in the mutant materials, indicating... ZmPMT1 Genes play a positive regulatory role in the regulation of polyunsaturated fatty acids in maize kernels. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 For the determination and statistical analysis of fatty acid content in corn kernels; In the figure, A is the total ion current (TIC) plot of fatty acids in maize kernels detected by GC-MS.

[0019] B represents the percentage of different types of fatty acids in corn kernels.

[0020] C represents the ω-3 content and the best linear unbiased estimate of the maize inbred line populations in Beijing and Yuanyang.

[0021] D represents the ω-6 content and the best linear unbiased estimate of the maize inbred line populations in Beijing and Yuanyang.

[0022] E represents the descriptive statistical analysis values ​​of ω-3 and ω-6 content in maize inbred line populations in Beijing and Yuanyang.

[0023] Figure 2 Genome-wide association analysis and haplotype classification of ω-3 and ω-6 content in maize inbred line populations; In the figure, A is the Manhattan plot, the X-axis represents the 10 chromosomes of maize, the scale represents the length of the corresponding chromosome, and the vertical axis represents the logarithm of the association analysis significance value (P-value). The blue dashed line represents the statistical significance level threshold. The points in the figure represent an independent SNP.

[0024] B represents the linkage disequilibrium analysis of the chromosomal region where ZmPMT1 is located. The upper part is a magnified Manhattan plot. The gene structure of ZmPMT1 and its physical location on the chromosome are marked on the x-axis. Blue represents exons. The four SNP sites connected by dashed lines are used for subsequent haplotype division.

[0025] C is a predicted high-order structure diagram of the protein formed by the translation of two haplotypes. The magnified part shows the pattern of amino acid changes caused by missense mutations induced by 4 SNPs.

[0026] Statistical analysis of the differences in ω-3 and ω-6 content between two haplotype materials in a maize inbred line population.

[0027] Figure 3 Detection of seed morphology and fatty acid content in ZmPMT1 mutant materials; In the figure, A represents the morphology of the EMS-induced mutant and the wild-type grain. B represents the statistical results of grain length, grain width, grain thickness, and weight per 100 grains for EMS-induced mutants and wild-type mutants.

[0028] C represents the statistical analysis of the differences in fatty acid content between EMS-induced mutants and wild-type maize kernels. Detailed Implementation

[0029] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0030] This invention provides a molecular marker related to the relative content of unsaturated fatty acids in maize kernels and its application.

[0031] Example 1: Analysis of the accumulation pattern of polyunsaturated fatty acids in maize inbred lines To analyze the accumulation pattern of polyunsaturated fatty acids in maize, this embodiment used 516 maize inbred lines provided by Professor Yan Jianbing of Huazhong Agricultural University as materials. They were planted in Yuanyang City, Henan Province in 2019 and in Beijing in 2020. All materials were planted in the experimental field in sequence, and the maize ears were dried and threshed after harvest.

[0032] 1. Targeted metabolomics assay For each maize inbred line, 20 g of seeds with normal growth and uniform kernel plumpness were selected from 5 different maize ears. The seeds were ground into powder using a milling machine (Leich MM400 frozen mixing ball mill) to obtain maize flour material. The content of polyunsaturated fatty acids was detected by gas chromatography-mass spectrometry.

[0033] (1) Sample preparation: Accurately weigh 300 mg of corn flour material, add 1.5 mL of n-hexane (solvent) containing C19:0 (100 μg / mL) internal standard, shake for 2 min to mix the corn flour material and solvent evenly, and then place in a 4°C refrigerator for 12 h. After standing, centrifuge at 12000 rpm for 10 min, collect the supernatant after centrifugation into a new EP tube, add 350 μL of sodium methoxide, and shake with a shaker for 1 h. After shaking, centrifuge at 12000 rpm for 10 min, collect the supernatant, and filter it using a 0.22 μm filter membrane and a disposable syringe to obtain the sample.

[0034] (2) On-machine detection: This invention uses the EI ion source of a gas chromatograph-mass spectrometer to compare the retention time (RT / s) of the detected polyunsaturated fatty acid ions with the retention time of the standard for qualitative analysis of the detected ions. If the retention times are the same, they can be identified as the same compound. The peak area is integrated and the concentration of the detected ions is absolutely quantified based on the standard curve. Qualitative analysis is performed by comparing the peak areas of 37 fatty acid mixed standards, internal standard peaks, and database (NIST) searches to determine the accurate elution times of 10 fatty acid components. The area of ​​fatty acid components in the samples is extracted, and the 10 major fatty acid components in the samples are homogenized using C19:0 fatty acid methyl ester internal standard. Subsequently, the content of each fatty acid component and the total fatty acid in each sample is further analyzed.

[0035] The results are as follows Figure 1As shown, taking the classic maize inbred line B73 as an example, a total of 11 fatty acids were detected in maize kernels. They are: myristic acid (C14:0), hexadecanoic acid (C16:0), palmitic acid (C16:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), arachienoic acid (C20:1), behenic acid (C22:0), and lignotaric acid (C24:0). Statistical analysis of the content of these 11 fatty acids revealed that myristic acid (C14:0) accounted for approximately 0.1%, hexadecanoic acid (C16:0) approximately 11.9%, palmitic acid (C16:1) approximately 0.3%, stearic acid (C18:0) approximately 3.4%, oleic acid (C18:1) approximately 29.7%, linoleic acid (C18:2) approximately 52.3%, linolenic acid (C18:3) approximately 1.3%, arachidic acid (C20:0) approximately 0.6%, arachidonic acid (C20:1) approximately 0.1%, behenic acid (C22:0) approximately 0.2%, and lignotaric acid (C24:0) approximately 0.04%. The total amount of hexadecanoic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3) accounted for more than 95% of the oil concentration.

[0036] Example 2: Discovering key genes that regulate the content of polyunsaturated fatty acids in maize.

[0037] Descriptive statistical analysis: By sorting out the data distribution characteristics of all detected ω-6 (LA) and ω-3 (ALA) in the population and performing logarithmic transformation on their absolute content data, it was found that the content of polyunsaturated fatty acids in maize kernels conforms to a normal or approximately normal distribution, which is suitable for subsequent genome-wide association analysis (GWAS).

[0038] Genome-wide association analysis based on metabolites: A metabolome-based genome-wide association analysis (mGWAS) was performed targeting ω-6 and ω-3 content in maize kernels. Using 1,076,652 high-quality SNPs, ensuring minor allele frequencies >0.05 and deletion rates <0.2%, a mixed linear model was employed for mGWAS, identifying 510 SNP loci above the intermediate significance threshold that were highly associated with ω-6 and ω-3 content. Linkage disequilibrium analysis and haplotype analysis were also performed.

[0039] Genome-wide association analysis showed that the ω-6 and ω-3 content in maize kernels had continuous and significant signals at chromosome Chr03, and a gene encoding phosphatidylethanolamine N-methyltransferase, as shown in SEQ ID NO.1, existed within this region. ZmPMT1 (GRMZM2G122296) Figure 2 In this gene (A), a total of 11 SNPs reached a significant level, of which four SNPs could induce missense mutations. Linkage disequilibrium analysis showed that these four missense mutations were closely linked. Figure 2 The following mutations occur: (B) A to G occurs at position 283 of SEQ ID NO.1, causing valine at position 95 to be replaced by leucine; (G) to A occurs at position 1151 of SEQ ID NO.1, causing lysine at position 384 to be replaced by arginine; (C) to A occurs at position 1367 of SEQ ID NO.1, causing lysine at position 456 to be replaced by threonine; (C) to G occurs at position 1387 of SEQ ID NO.1, causing aspartic acid at position 463 to be replaced by histidine.

[0040] The results are as follows Figure 2 As shown in the results of protein high-order structure simulation, the amino acid changes at positions 463 and 456 are located in the methyltransferase active region. Changes in the charge of these amino acid residues may lead to changes in the electrostatic environment of the substrate binding site, thereby affecting substrate recognition and catalytic activity. The amino acid changes at positions 95 and 384 are not located in the methyltransferase active region, but they alter the physicochemical properties and steric hindrance of the amino acid residues, potentially leading to changes in amino acid conformation. Figure 2 A and Figure 2 (C). Based on these four SNPs, the inbred line population was divided into two haplotypes, one of which is the AGCC haplotype Hap. AGCC It has relatively high ω-6 and ω-3 contents and is defined as an excellent haplotype ( Figure 2 (D). Haplotype Hap with base type GAAG. GAAG The ω-6 and ω-3 contents were low. These results indicate that natural variations in ZmPMT1 significantly affect the ω-6 and ω-3 fatty acid content in maize kernels. Activation ZmPMT1 Genes can increase the content of ω-3 and ω-6 fatty acids in corn kernels.

[0041] ZmPMT1 The nucleotide sequence of the wild-type gene is shown in SEQ ID NO.1, and the superior haplotype Hap... AGCC The nucleotide sequence is shown in SEQ ID NO.2.

[0042] SEQ ID NO.1:

[0043] SEQ ID NO.2:

[0044] Example 3: Screening and identification of maize materials and verification of fatty acid phenotypes.

[0045] 1. Screening and identification of corn materials To verify ZmPMT1 Effects on the content of ω-6 and ω-3 fatty acids in maize kernels. Referring to the fourth edition of the maize B73 reference genome, mutant materials were purchased from a maize EMS mutagenesis mutant library constructed using the maize inbred line B73 as the background, and named... Zmpmt1-1 and Zmpmt1-2 The mutant database shows... Zmpmt1-1 The mutation site is located at ZmPMT1 At position 1452 of the gene coding sequence (CDS), a mutation from C to T causes the encoded tryptophan (Trp) to be changed to a stop codon, resulting in a truncated ZmPMT1 protein. Zmpmt1-2 lie in ZmPMT1 At position 1482 of the coding sequence (CDS), a mutation from C to T causes the encoded tryptophan (Trp) to be replaced by a stop codon, resulting in the truncated ZmPMT1 protein. Figure 3 (A) For the purchased mutant materials, based on the provided mutation site information, primers are designed upstream and downstream of the mutation site to detect... Zmpmt1-1 The primers for the mutation site include the upstream primer shown in SEQ ID NO.3. Zmpmt1-1 -F and the downstream primers shown in SEQ ID NO.4 Zmpmt1-1 -R; Detect Zmpmt1-2 The primers for the mutation site include the upstream primer shown in SEQ ID NO.5. Zmpmt1-2 -F and the downstream primers shown in SEQ ID NO.4 Zmpmt1-2 -R.

[0046] SEQ ID NO.3: CACGTTATGAAGCGAATCCCATCG; SEQ ID NO.4: CTGAGTTTGCCCAGGTGATTCGA; SEQ ID NO. 5: CCATCGGTGAATTGCAGAAGC.

[0047] DNA was extracted from the leaves of the mutant, and the sequence covering the mutation site was amplified and sequenced. The amplification system was 30 μL: 15 μL of Novizan 2*Tag enzyme; 1.5 μL each of R and F terminators; 2 μL of DNA; 10 μL of water. The PCR reaction conditions were: high temperature denaturation (95℃ melting) for 30 s, annealing for 30 s (57℃ primer binding), and extension at 72℃ for 30 s.

[0048] The results are as follows Figure 3 As shown, consistent with the information provided by the EMS mutagenesis library, in Zmpmt1-1 In the mutant material, the mutation site has a T base type and a single peak, indicating that the mutation site is a homozygous mutation. Zmpmt1-2 In mutant materials, the mutation site has a base type of T and a single peak, indicating that the mutation site is a homozygous mutation. Figure 3 A).

[0049] 2. Verification of fatty acid phenotypes like Figure 3 As shown, ZmPMT1 The mutation caused changes in the grain morphology. Figure 3 (B) Zmpmt1-1 The grain length was significantly reduced, but the grain width, grain weight, and 100-grain weight were not significantly different from those of wild-type B73. Zmpmt1-2 The grain length, width, and thickness decreased significantly, but the weight of 100 grains did not change significantly. This indicates... ZmPMT1 The mutation does not lead to a decrease in yield. Figure 3 (C).

[0050] GC-MS lipidomics results showed that, compared with the wild-type maize inbred line B73, the mutant... Zmpmt1-1 and Zmpmt1-2 The content of ω-6 and ω-3 in the grains was significantly reduced, but the significant changes in other types of fatty acids indicate that... ZmPMT1 The mutation specifically reduced the ω-6 and ω-3 content in maize kernels ( Figure 3 D).

[0051] The above results validate the molecular function of ZmPMT1, and loss-of-function mutations lead to a specific decrease in the content of ω-6 and ω-3 in maize kernels. These results also validate the aforementioned conclusions of population genetics. ZmPMT1 It affects the ω-6 and ω-3 content in corn kernels.

[0052] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0053] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. ZmPMT1 The application of genes in identifying superior haplotypes with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels is characterized by, Referencing the fourth edition of the maize B73 reference genome, ZmPMT1 The gene is located on chromosome Chr03, and the stated ZmPMT1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. ZmPMT1 There are four mutation sites on the gene, which are located at... ZmPMT1 Mutations at positions 283bp (A / G), 1151bp (G / A), 1367bp (C / A), and 1387bp (C / G); when the haplotype is Hap AGCC At that time, it was identified as an excellent haplotype with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels.

2. As described in claim 1 ZmPMT1 The application of genes in identifying superior haplotypes with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels is characterized by, The nucleotide sequence of the superior haplotype with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in the corn kernel is shown in SEQ ID NO.

2.

3. ZmPMT1 The application of genes in regulating the content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels is characterized by, Referring to the fourth version of the maize B73 reference genome, activate the method described in claim 1. ZmPMT1 Genes are used to increase the content of ω-3 and ω-6 fatty acids in the corn kernels; ZmPMT1 Loss-of-function mutations in genes are used to reduce the content of ω-6 and ω-3 in maize kernels.

4. The method according to claim 3 ZmPMT1 The application of genes in regulating the content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels is characterized by, ZmPMT1 Loss-of-function mutations of genes ZmPMT1 The gene coding sequence at position 1452 is mutated from C to T, or... ZmPMT1 The gene coding sequence at position 1482 is mutated from C to T.

5. The method according to claim 4 ZmPMT1 The application of genes in regulating the content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels is characterized by, Detection ZmPMT1 The primers for detecting the mutation site at position 1452 of the gene coding sequence, where C is mutated to T, include the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.

4.

6. The method according to claim 4 ZmPMT1 The application of genes in regulating the content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels is characterized by, Detection ZmPMT1 The primers for detecting the mutation site at position 1482 of the gene coding sequence, where C is changed to T, include the upstream primer shown in SEQ ID NO.5 and the downstream primer shown in SEQ ID NO.

4.

7. The method according to claim 6 ZmPMT1 The application of genes in regulating the content of polyunsaturated fatty acids ω-6 and / or ω-3 in maize kernels is characterized by, Detection ZmPMT1 The PCR reaction conditions for the mutation site at position 1482 of the gene coding sequence, where C is mutated to T, are: denaturation at 95℃ for 30 s, annealing for 30 s, and extension at 72℃ for 30 s.

8. ZmPMT1 The application of genes in maize breeding is characterized by, Select the superior haplotype Hap with high content of polyunsaturated fatty acids ω-6 and / or ω-3 in corn kernels according to claim 1. AGCC They bred corn varieties.

Images