Pathogenic gene MYH7c.794C > T (p.Thr265Ile) for hypertrophic cardiomyopathy and application thereof

Abstract

The invention belongs to the technical field of biological medicine and molecular biology, and provides a hypertrophic cardiomyopathy virulence gene MYH7c.794Cgt; the invention relates to T (p.Thr265Ile) and an application thereof. The MYH7 gene mutation is located on the ninth exon, the 794th base is mutated from C to T, namely ACC is mutated to ATC, and the 265th amino acid in the coded amino acid sequence is mutated from threonine to isoleucine. The mutation induces cardiac hypertrophy by disrupting energy metabolism-this defect occurs prior to the occurrence of systolic dysfunction. Along with increasingly prominent status of precision medicine in cardiovascular treatment, a treatment strategy aiming at an upstream pathological process (such as energy homeostasis and mitochondrial dysfunction) provides a way with a wide prospect for preventing and treating MYH7-related hypertrophic cardiomyopathy. MYH7 gene screening has important values in the aspects of promoting early diagnosis, guiding timely treatment intervention and realizing risk-based prevention and management.

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and molecular biology, specifically relating to pathogenic genes of hypertrophic cardiomyopathy. MYH7 c.794C>T(p.Thr265Ile) and its applications. Background Technology

[0002] Hypertrophic cardiomyopathy (HCM) is the most common primary cardiomyopathy, with a global prevalence estimated at 1 in 500 to 1 in 200. It is a leading cause of sudden death in adolescents and athletes. The 2024 "Guidelines for the Management of Myocardial Diseases" jointly published by the American Heart Association, American College of Cardiology, American College of Sports Medicine, Heart Rhythm Society, European Society of Cardiology, and Society of Cardiology emphasizes that HCM constitutes a significant public health burden and points out that accurate genetic diagnosis and individualized risk stratification for sudden death are core aspects of clinical management.

[0003] The myosin heavy chain gene 7 (encoding β-myosin heavy chain (β-MHC)) MYH7 α is a major pathogenic gene for hypertrophic cardiomyopathy (HCM), accounting for approximately 30% to 50% of familial cases. A large number of pathogenic mutations are concentrated in the globular head domain and the transition region from the head to the rod structure of this protein. Small structural perturbations in these key functional regions can trigger diverse molecular pathophysiological consequences. However, approximately 25-30% of clinically diagnosed HCM patients lack identifiable pathogenic mutations, highlighting the current lack of understanding of this gene. MYH7 Significant gaps exist in our understanding of mutation maps—especially in the understanding of rare mutations involving key functional regions, whose mechanisms and effects remain largely unexplained.

[0004] Traditionally, MYH7 The underlying pathological mechanisms have been attributed to excessive sarcomere contraction, with mutations in the globular head and adjacent transition regions enhancing calcium sensitivity, leading to increased tension generation and enhanced contractile activity. However, emerging evidence has shifted the focus to metabolic disorders. Existing research shows that mutations affecting the myosin head may impair ATP utilization efficiency, thereby triggering primary energy deficits. Subsequently, it has been confirmed that myocardial energy metabolism dysfunction, mitochondrial damage, and related oxidative stress may be early pathogenic drivers of hypertrophic cardiomyopathy. These pathological changes occur independently of, and may precede, significant contractile dysfunction, thus establishing a pathogenic axis centered on the interaction between energy metabolism, calcium processing, and mitochondrial integrity. Summary of the Invention

[0005] This invention provides a pathogenic gene for hypertrophic cardiomyopathy. MYH7 c.794C>T(p.Thr265Ile) and its applications.

[0006] This invention is achieved by the following technical solution: Hypertrophic cardiomyopathy pathogenic gene MYH7 c.794C>T(p.Thr265Ile), the MYH7 The gene mutation is located in exon 9, where the 794th base is changed from C to T, i.e., ACC is changed to ATC. The 265th amino acid in the encoded amino acid sequence is changed from threonine to isoleucine.

[0007] The MYH7 The c.794C>T(p.Thr265Ile) mutation is located in the head domain of the β-MHC, close to the ATP binding site, and the ATP binding affinity of the mutant protein is reduced.

[0008] The MYH7 The c.794C>T(p.Thr265Ile) mutation drives key pathological features of hypertrophic cardiomyopathy, including cardiomyocyte hypertrophy, mitochondrial damage, energy metabolism disorders, and calcium dysregulation.

[0009] The MYH7 The c.794C>T(p.Thr265Ile) mutation leads to changes in cardiac structure and mitochondrial dysfunction in a sex-dependent manner.

[0010] The MYH7 The c.794C>T(p.Thr265Ile) mutation leads to an increase in the pathological severity of hypertrophic cardiomyopathy with age.

[0011] This invention also provides the pathogenic gene for hypertrophic cardiomyopathy. MYH7 Application of c.794C>T (p.Thr265Ile) in the preparation of kits for the detection or early diagnosis of hypertrophic cardiomyopathy.

[0012] This invention identifies a novel missense mutation in a large Chinese family with autosomal dominant hypertrophic cardiomyopathy: MYH7 c.794C>T(p.Thr265Ile). This mutation is located at the interface between the myosin head domain and the head-rod transition region—a region highly conserved across species and closely related to the mechanochemical coupling efficiency during ATP hydrolysis and lever arm movement. However, this mutation has not yet been found in domestic or international genomic databases, and its pathogenicity, molecular mechanism, and potential association with energy metabolism-driven pathogenic pathways remain unclear. Notably, clinical observations show that the proband developed symptoms during adolescence, while his father only exhibited a hypertrophic cardiomyopathy phenotype in adulthood, suggesting that age may modulate the penetrance and expression level of this mutation. Furthermore, the potential influence of sex on the phenotypic expression of this mutation remains unclear.

[0013] To fill these knowledge gaps, we propose the following hypothesis: MYH7The c.794C>T (p.Thr265Ile) mutation may disrupt myosin-ATP interactions, inducing mitochondrial dysfunction and thus promoting the development and progression of pathological myocardial hypertrophy—a process that may be regulated by age and sex. This invention, using genetically engineered mouse models and human cell systems, combined with in vitro and in vivo experimental methods, systematically investigates the pathogenicity of this novel mutation, elucidates its molecular mechanism, and assesses the effects of age and sex. The research findings aim to provide a solid experimental and theoretical foundation for the early detection and precise therapeutic intervention of carriers of this mutation.

[0014] This invention identifies a novel mutation, previously unreported, in a case of familial hypertrophic cardiomyopathy (HCM). MYH7 c.794C>T(p.Thr265Ile). Through comprehensive gene-phenotype cosegregation analysis and integrated in vitro and in vivo functional studies, we confirmed that this mutation drives myocardial hypertrophy and elucidated its molecular mechanism. The study shows that... MYH7 The c.794C>T (p.Thr265Ile) mutation induces cardiac hypertrophy by disrupting energy metabolism—a defect that occurs before systolic dysfunction develops. With the increasing prominence of precision medicine in cardiovascular treatment, therapeutic strategies targeting upstream pathological processes (such as energy homeostasis dysregulation and mitochondrial dysfunction) are crucial for both prevention and treatment. MYH7 Related hypertrophic cardiomyopathy offers a promising avenue. With the continuous advancements in molecular genetics, gene testing is increasingly being integrated into clinical workflows. MYH7 Genetic screening is of great value in promoting early diagnosis, guiding timely treatment interventions, and enabling risk-based prevention management. Attached Figure Description

[0015] Figure 1 To analyze the clinical phenotype and genotype characteristics of the study cohort. In the figure: (A) The proband's electrocardiogram shows sinus rhythm with complete left bundle branch block. (B) The proband's two-dimensional echocardiography shows mild left atrial enlargement, left ventricular cavity reduction, and significant left ventricular wall thickening. (CD) The proband's color Doppler and spectral Doppler echocardiography shows mild aortic regurgitation and a mitral valve flow pattern with E / A < 1, suggesting left ventricular diastolic dysfunction. (E) A four-generation Chinese family pedigree of hypertrophic cardiomyopathy, with the proband (III-12) indicated by an arrow. Roman numerals indicate generations; Arabic numerals identify individual members. Boxes represent males; circles represent females. Diagonal lines indicate deceased individuals. Red and blue boxes represent carriers, respectively. MYH7 c.2524A>G(p.Ser842Gly) mutation and MYH7 Affected males with the c.794C>T(p.Thr265Ile) mutation. Blue-orange circles represent carriers. MYH7c.2524A>G(p.Ser842Gly) mutation and simultaneously carrying TNNT2 Women with the mutation. (F) Whole-exome sequencing was performed on family members of the proband, followed by screening for potential mutated genes isolated within the family using first-generation Sanger sequencing. Whole-exome sequencing was performed on affected individuals (III-12, III-10) and unaffected family members (I-3, II-11). MYH7 Two heterozygous mutations were found in the gene: c.794C>T (p.Thr265Ile) and c.2524A>G (p.Ser842Gly). (G)Sanger sequencing chromatogram confirmed the proband. MYH7 Heterozygote exists in exon 9 of the gene MYH7 c.794C>T (p.Thr265Ile) mutation. (H) Proband confirmed by Sanger sequencing chromatogram. MYH7 Heterozygote exists in exon 19 of the gene. MYH7 c.2524A>G (p.Ser842Gly) mutation. Sanger sequencing chromatograms of (I)II-7 show... TNNT2 The gene contains a heterozygous mutation. Sanger sequencing chromatograms of (J)III-10 confirm its presence. TNNT2 The same heterozygous mutation exists in the gene. (K) Two-dimensional echocardiography of the proband's father (II-9) shows mild left ventricular enlargement and interventricular septal thickening. (L) Color Doppler flow imaging (CDFI) of the proband's father shows mild mitral and tricuspid regurgitation. (M) Pulsed Doppler (PW) analysis of the mitral annulus of the proband's father shows a biphasic pattern with an E / A ratio <1, consistent with diastolic dysfunction. (N) Combined color and spectral Doppler assessment of the proband's father confirms left ventricular filling dysfunction. (O) Color and spectral Doppler imaging of III-10 confirms hypertrophic cardiomyopathy; this condition is subsequently associated with the development of hypoxic-ischemic encephalopathy. (P) Two-dimensional echocardiography of individual II-7 shows left atrial enlargement. (Q) Pulsed wave Doppler assessment of II-7 shows a biphasic pattern of mitral valve flow with an E / A ratio <1, consistent with left ventricular diastolic dysfunction; Figure 2 New findings were evaluated for bioinformatics analysis. MYH7 Pathogenicity of the c.794C>T (p.Thr265Ile) mutation. (A) Conservation analysis of β-MHC. Conservation analysis of amino acid residue 265 of β-MHC in different species; similarly, conservation analysis of amino acid residue 842 of β-MHC was performed. (B) Analysis using multiple bioinformatics tools (MutationAssessor, Mutation Taster, FATHMM, PROVEAN) MYH7Computer-aided prediction of the effect of the c.794C>T(p.Thr265Ile) mutation on β-MHC function showed that the mutation had a detrimental effect. (C) Structural modeling of wild-type and mutant β-MHC proteins revealed conformational changes induced by the T265I substitution, including the loss of hydrogen bonds and increased hydrophobicity. (DE) MYH7 The c.794C>T (p.Thr265Ile) mutation is located in the β-MHC head domain, adjacent to the ATP binding site. (F) Molecular docking simulations of ATP binding to the β-MHC head domain show... MYH7 The c.794C>T (p.Thr265Ile) mutant has a lower binding affinity than the wild type, as evidenced by an increased predicted binding energy (−7.5 kcal / mol vs. −8.1 kcal / mol); Figure 3 To pass Myh7 T265I / + WT obtained from mouse pairing and breeding Myh7 T265I / + , Myh7 T265I / T265I Mouse number and genotype identification results. In the figure: (A) Target Myh7 The gRNA of the gene, a donor vector containing the "KI region-p.T265I (ACC→ATC)" fragment, and Cas9 mRNA were co-injected into fertilized mouse oocytes to generate targeted knock-in offspring. The F0 generation founder animals were identified by PCR-binding sequence analysis, and they were mated with wild-type mice to detect germline transmission. The F1 generation offspring were identified by PCR-binding sequence analysis, and they were mated with wild-type mice to detect germline transmission. mRNA was co-injected into fertilized mouse oocytes to obtain targeted knock-in offspring. The F0 generation founder animals were identified by PCR and subsequent sequencing, and they were mated with wild-type mice to detect germline transmission and the generation of F1 generation animals. Heterozygous FN mice were obtained by hybridizing heterozygous F1 generation mice. (B) Myh7 T265I / + WT obtained from mouse pairing and breeding Myh7 T265I / + , Myh7 T265I / T265I Number of mice. (C)WT, Myh7 T265I / + Genotyping of mice was performed using PCR. Figure 4 for Myh7 T265I / + and Myh7 T265I / T265I At 8 weeks of age, male rats showed increased ventricular wall thickness but no significant change in diastolic function. Figure: (A) Wild-type (WT) confirmed by Sanger sequencing. Myh7 T265I / + and Myh7 T265I / T265I (B) Genotypes of mice. Schematic diagram of the experimental design shown in Figure (CI). (C) Echocardiographic assessment parameters of 8-week-old male mice: left ventricular anterior wall thickness at end-diastole (LVAW;d), left ventricular posterior wall thickness at end-diastole (LVPW;d), left ventricular mass (LV mass AW), ejection fraction (EF), and ventricular systolic fraction (FS). (D) Doppler-derived parameters include isovolumetric contraction (IVCT), early to late ventricular filling velocity ratio (E / A), and early mitral annular tissue velocity to late filling velocity ratio (E′ / A′). (E) WT of 8-week-old mice (n=8). Myh7 T265I / + (n=4) and Myh7 T265I / T265I (n=5) Images of isolated male mouse hearts. Heart weight (HW), heart weight / body weight ratio (HW / BW), and heart weight / tibia ratio (HW / TL) are shown. Scale bar: 1 mm. (F) WGA-stained heart sections showing heart morphology. Scale bar: 0.5 mm. (G) WT, Myh7 T265I / + and Myh7 T265I / T265I Typical Masson trichrome stained heart sections from male mice. Scale bar: 1 mm. (H)WT and Myh7 T265I / + qRT-PCR analysis of anp and bnpm RNA levels in mouse hearts (n=3). (I) WT and Myh7 T265I / T265I qRT-PCR analysis of anp mRNA levels in mouse hearts (n=3). Statistical significance was determined using one-way ANOVA (CF, J) and t-test (HI). Data are expressed as mean ± standard error. p<0.05, p<0.01, p<0.001, p<0.0001; Figure 5 At 8 weeks of age Myh7 T265I / + , Myh7 T265I / T265I No significant changes were observed in ventricular wall thickness, systolic function, or diastolic function in female mice. Figure: (A) Schematic diagram of the experimental group (BG). (B) 8-week-old WT... Myh7 T265I / + and Myh7 T265I / T265IEchocardiographic assessment of female mice, including LVAW;d, LVPW;d, LV mass AW, EF, and FS measurements (n=3). (C) IVCT, E / A, and E′ / A′ ratio analysis (n=3). (D) WT at 8 weeks of age (n=6). Myh7 T265I / + (n=6) and Myh7 T265I / T265I (n=7) Representative whole-heart images of female mice. HW, HW / BW, and HW / TL were assessed simultaneously. Scale bar: 1 mm. (E) 8-week-old WT, Myh7 T265I / + and Myh7 T265I / T265I Representative images of Masson's trichrome stained heart sections from female mice. Scale bar: 1 mm. (F) Representative WGA-stained heart sections showing the cross-sectional area of ​​cardiomyocytes. Scale bar: 0.5 mm. (G) WT, Myh7 T265I / + and Myh7 T265I / T265I qRT-PCR analysis of bnp mRNA expression in mouse hearts (n=3). Statistical significance of panels (B–H) was determined using one-way ANOVA. Data are expressed as mean ± standard error. p<0.05, p<0.01, p<0.001, p<0.0001; Figure 6 Male Myh7 T265I / + and Myh7 T265I / T265I Mice exhibited progressive myocardial hypertrophy and diastolic dysfunction at 22 weeks of age. Figure: (A) Schematic diagram of the experimental design. (B) 22-week-old male wild-type mice (n=12). Myh7 T265I / + (n=6) and Myh7 T265I / T265I (n=6) LVAW measured by echocardiography in mice; d and (LV Mass AW). (C) Doppler-derived parameters include IVCT, E / A ratio, and E′ / A′ ratio. (D) WT, Myh7 T265I / + and Myh7 T265I / T265I Representative Masson trichrome staining of a male mouse heart section. Scale bar: 1 mm. (E)WT (n=5) Myh7 T265I / + (n=3) and Myh7 T265I / T265I(n=3) Images of isolated mouse hearts. Showing HW, HW / BW, and HW / TL. Scale bar: 1 mm. (F) Typical WGA-stained heart sections, showing cardiomyocyte area. Scale bar: 0.5 mm. (G) Representative FLASH dynamic MRI images (top row: end of diastole; bottom row: end of systole), showing 22-week wild-type (n=5). Myh7 T265I / + (n=3) and Myh7 T265I / T265I (n=3) Short-axis (SAX) view of the middle ventricle of a mouse heart. Green outlines indicate the left ventricular (LV) wall boundary. Scale bar: 1 mm. (H) WT and Myh7 T265I / + anp, bnp, β-MHC in mouse heart myh7 qRT-PCR detection of HIF-1α (n=3). (I) WT (n=4) and Myh7 T265I / T265I (n=3) Anp, bnp, β-MHC and... in mouse hearts myh7 qRT-PCR detection was performed. Statistical significance was determined by one-way ANOVA (BH) and assessed by t-test (HI). Data are expressed as mean ± standard error (SEM). p<0.05, p<0.01, p<0.001, p<0.0001; Figure 7 For carrying Myh7 T265I / + and Myh7 T265I / T265I Mutant male mice exhibited further exacerbation of myocardial hypertrophy at 48 weeks of age. Figure: (A) Schematic diagram illustrating the experimental design of (BG). (B) 48-week-old male wild-type mice (n=6). Myh7 T265I / + (n=5) and Myh7 T265I / T265I (n=8) Left ventricular end-diastolic wall thickness (LVAW;d) and left ventricular mass (LV Mass AW) measured by echocardiography in mice. (C) Doppler-derived parameters include IVCT, E / A ratio, and E′ / A′ ratio. (D) 48-week-old wild-type mice. Myh7 T265I / + and Myh7 T265I / T265I Representative images of isolated male mouse hearts and HW, HW / BW, and HW / TL data. Scale bar: 1 mm. (E) WT, Myh7 T265I / + and Myh7 T265I / T265I Representative Masson trichrome staining images of male mouse heart sections, showing increased myocardial mass and structural remodeling. Scale bar: 2 mm. (F) Representative WGA-stained heart sections, showing... Myh7 T265I / + and Myh7 T265I / T265I Enlarged male cardiomyocytes. Scale bar: 0.5 mm. (G) Representative FLASH dynamic MRI images (top row: end of diastole; bottom row: end of systole), showing wild-type (n=5) at 48 weeks. Myh7 T265I / + (n=3) and Myh7 T265I / T265I (n=3) Short-axis (SAX) view of the middle ventricle of a mouse heart. The left ventricular (LV) wall boundary is outlined in green. Scale bar: 1 mm. Statistical significance was assessed using one-way ANOVA (BG). Data are expressed as mean ± standard error (SEM). p<0.05, p<0.01, p<0.001, p<0.0001; Figure 8 for Myh7 T265I / + -AC16 cells exhibit a myocardial hypertrophy phenotype. In the figure: (A) Human cells were edited using CRISPR / Cas9 gene-editing technology mediated by electroporation. MYH7 A point mutation in exon 9 of the gene (p.T265I, ACC→ATC) was introduced into the human cardiomyocyte AC16 line. (B) PCR verification confirmed the successful establishment of the line carrying the gene. MYH7 (C) Heterozygous cell line with mutation. (D) Sanger sequencing further verifies the existence of heterozygous mutation in the target gene. (E) Cell viability is detected using the CCK-8 assay. (F) Schematic diagram illustrating the experimental design of (FN). (F) WT-AC16 cells and Myh7 T265I / + bnp and -AC16 cells Myh7 qRT-PCR analysis of mRNA levels (n=3). (G) WT-AC16 and Myh7 T265I / + Western blot analysis of ANP and BNP expression in WT-AC16 cells (n=3). (H) Analysis of ANP and BNP expression in WT-AC16 cells and Myh7 T265I / + -AC16 cells were subjected to representative immunofluorescence imaging and quantitative analysis of nuclear staining (DAPI). (J) WT-AC16 and Myh7 T265I / +Representative immunofluorescence images and quantitative analysis of the surface area of ​​AC16-cell cardiomyocytes. Scale bar: 50 μm. (K)WT-AC16 and Myh7 T265I / + - Representative scanning electron microscope (SEM) images of morphological changes in AC16 cells. Scale bar: 0.5 mm. (L) (MN) Schematic diagram of experimental design. (M) WT-AC16 cells after hypoxia treatment. Myh7 T265I / + Western blot analysis of HIF-1α protein expression in WT-AC16 cells. (N) WT-AC16 cells under hypoxic conditions and Myh7 T265I / + Representative immunofluorescence images and quantitative assessment of AC16 cell cardiomyocyte area. Scale bar: 50 μm. All experiments (A–N) were statistically analyzed using Student's t-test. Data are expressed as mean ± standard error (SEM). p<0.05, p<0.01, p<0.001, p<0.0001; Figure 9 for Myh7 T265I / + -AC16 cells exhibit mitochondrial dysfunction. In the figure: (A) WT-AC16 and... Myh7 T265I / + Quantitative analysis of intracellular ATP levels in AC16 cells (n=3). (B)WT-AC16 and Myh7 T265I / + Quantitative analysis of intracellular ADP / ATP levels in AC16 cells (n=3). (C) Measurement and comparison of WT-AC16 with... Myh7 T265I / + - ATPase activity levels in AC16 cells. (D) Representative fluorescence images showing Fluo-4 staining. Scale bar: 50 μm. (E) WT-AC16 and Myh7 T265I / + Transmission electron microscopy images and statistical analysis of healthy and damaged mitochondria in AC16 cells, showing increased mitochondrial damage in mutant cells (approximately 3 fields of view were randomly selected from each sample). Scale bar: 1 μm. (F) Figure (GJ) Schematic diagram of experimental design. (G) Transmission electron microscopy images and quantitative analysis of mitochondrial status, showing increased mitochondrial damage in 8-week-old males. Myh7 T265I / + and Myh7 T265I / T265I The number of damaged mitochondria was increased and the number of healthy mitochondria was reduced in mice (approximately 10 fields of view were randomly selected from each sample). Scale bar: 0.5 μm. (H) 8-week-old females Myh7T265I / + and Myh7 T265I / T265I Representative transmission electron microscopy images and quantitative analysis of healthy and damaged mitochondria in mice (approximately 3 fields of view were randomly selected from each sample). Scale bar: 0.5 μm. (I) 22-week-old males Myh7 T265I / + and Myh7 T265I / T265I Transmission electron microscopy (TEM) images and quantitative analysis of mouse mitochondrial status (approximately 6 fields of view randomly selected from each sample) showed an increased number of damaged mitochondria and a decreased number of healthy mitochondria. Scale bar: 0.5 μm. (J) TEM images and quantitative analysis of mitochondrial status in 48-week-old males... Myh7 T265I / + and Myh7 T265I / T265I The number of damaged mitochondria increased while the number of healthy mitochondria decreased in mice (approximately 10 fields of view were randomly selected from each sample). Scale bar: 0.5 μm. All figures (A–E) were statistically analyzed using Student's t-test. Data are expressed as mean ± standard error (SEM). p<0.05, p<0.01, p<0.001, p < 0.0001; the statistical significance of the graph (G–J) was determined by one-way ANOVA. Data are expressed as mean ± standard error; p<0.05, p<0.01, p<0.001, p<0.0001. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains, and all materials publicly cited herein and cited by them are incorporated herein by reference.

[0018] Equivalent technologies of the specific embodiments described herein that are readily apparent to those skilled in the art through routine experimentation are included in this application.

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all standard laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from regular biochemical reagent stores.

[0020] I. Materials and Methods 1. Ethical Approval: All animal experiments were conducted in accordance with the approval of the Animal Care and Use Committee of Capital Medical University and the ARRIVE guidelines. All blood samples and echocardiographic examinations collected from this family were approved by the Ethics Review Committee of Capital Medical University (Approval No.: 2021SY048). All procedures involving human probands in this invention comply with the ethical standards of the institution and / or national research council, as well as the 1964 Declaration of Helsinki and its subsequent amendments. Informed consent was obtained from all participants.

[0021] 2. Animal models: Myh7 T265I / + , Myh7 T265I / T265I The mice were constructed by Cyagen (Suzhou) Biotechnology Co., Ltd. To obtain... Myh7 T265I / + , Myh7 T265I / T265I Mice, such as Figure 3 As shown, the target Myh7 The gRNA of the gene, a donor vector containing the "KI region-p.T265I (ACC→ATC)" fragment, and Cas9 mRNA were co-injected into fertilized eggs to generate targeted knock-in offspring. The F0 generation founder animals were identified by PCR and subsequent sequencing. These were then mated with wild-type mice to verify germline transmission and obtain F1 generation animals. Heterozygous and homozygous mice were obtained through inbreeding of heterozygous F1 mice. All mice had a C57BL / 6J genetic background and were raised under specific pathogen-free laboratory conditions. Specifically: targeted... Myh7 The gRNA sequence of the gene is shown below: gRNA1 (antisense strand) SEQ ID NO.1: TGTGTCCTGACCGTATTTCGGGG; gRNA2 (positive strand) SEQ ID NO.2: CCTCAGTGCATGTCTCTTTGGG; gRNA3 (antisense strand) SEQ ID NO.3: TCTTTCCCCGAAATACGGTCAGG; gRNA4 (positive strand) SEQ ID NO.4: TCTCAGTGCATGTCTCTTTGGGG.

[0022] 3. Echocardiography and Tissue Doppler Imaging: Echocardiography was performed using a Vevo 2100 system (FUJIFILM VisualSonics, Canada). Mice were anesthetized with isoflurane, and left ventricular systolic function was measured using parasternal short-axis M-mode ultrasound. Measurement parameters included left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), end-diastolic left ventricular anterior wall thickness (LVAW;d), end-diastolic left ventricular posterior wall thickness (LVPW;d), and left ventricular mass (LV massAW). Left ventricular diastolic function was assessed using pulse wave and tissue Doppler imaging at the mitral valve level in an apical four-chamber view. Isovolumic contraction time (IVCT) and isovolumic relaxation time (IVRT) were measured, and the early / late ventricular filling velocity ratio (E / A) and the early tissue velocity / late filling velocity ratio of the mitral valve annulus (E′ / A′) were calculated. Data were then processed using statistical analysis software.

[0023] 4. Whole exome sequencing: Whole exome sequencing analysis was performed on four family members (I-3, II-11, III-10, III-12). The primer sequences used for PCR were: upstream SEQ ID NO.5: 5'-CCAAGAGGGTCATCCAGTACTTT-3', downstream SEQ ID NO.6: 5'-TAGGGTTTGGGCACAAGGAAAAT-3'; the PCR amplification system is shown in Table 1, and the PCR amplification conditions are shown in Table 2.

[0024] Table 1: PCR amplification system Table 2: PCR Amplification Conditions The products obtained after PCR amplification were sequenced, and the sequencing peak results were viewed using Chromas software. It was found that... MYH7 The gene contained heterozygous mutations (c.794C>T, p.Thr265Ile), which were identified as pathogenic candidate mutations. Sanger sequencing and pedigree analysis confirmed that this mutation co-segregated with the disease phenotype within the family.

[0025] 5. Histological Analysis: After removal of the mouse heart, it was fixed in 4% paraformaldehyde solution at room temperature for 3 days. Subsequently, the tissue was dehydrated by a series of ethanol gradients, cleared with xylene, embedded in paraffin, and cut into 5-micrometer thick sections. Serial sections were stained with wheat germ lectin (WGA) and Masson's trichrome. WGA-stained images were acquired using a fully automated slide scanning system (3DHISTECH China). ImageJ software was used to quantify the cross-sectional area of ​​cardiomyocytes, and at least 150 cells were analyzed from each animal sample to ensure statistical reliability.

[0026] 6. Immunofluorescence staining: After dewaxing, antigen retrieval, and blocking of non-specific binding sites, cardiac tissue sections were incubated overnight at 4°C with primary antibody: anti-sarcoma α-actin antibody (dilution ratio 1:200, catalog number A781111313-2-AP, Proteintech). Subsequently, they were incubated at room temperature for 2 hours with secondary antibody (Alexa Fluor 488-labeled anti-rabbit IgG, 1:400, Invitrogen), or directly counterstained with wheat germ agglutinin (WGA, 1:200, catalog number RL-1022, Vector Laboratories). After mounting with DAPI-containing mounting medium (Southern Biotech, product number 0100-20), the sections were observed under a fluorescence microscope.

[0027] 7. Western blot analysis: Heart tissue was collected and protein lysis buffer containing 1 mM benzoylmethanesulfonyl fluoride (PMSF), phosphatase inhibitors, and RIPA lysis buffer (Beijing Beyotime Biotechnology Research Institute) was added. The mixture was homogenized in a cryo-homogenizer and incubated on ice for 30 minutes. After protein concentration was determined by the BCA method, all protein samples were added to 4×SDS sample buffer at a 1:4 ratio and incubated at 70°C for 10 minutes. Subsequently, 10 μg of total protein was loaded onto a 10% sodium dodecyl sulfate-polyacrylamide gel for electrophoresis and transferred to a nitrocellulose membrane. After mounting, the membrane was incubated overnight at 4°C with the following primary antibodies: anti-ANP antibody (1:1000, Abcam, China), anti-BNP antibody (1:1000, Abcam, China), anti-β-MHC antibody (1:1000, Abcam, USA), anti- MYH7 Antibody (1:1000, Abcam, China), anti-HIF-1α (1:1000, Abcam, USA). Membranes were washed with Tris-buffered saline / 0.1% Tween 20 (TBST) and incubated with secondary antibody at room temperature for 1 hour. Protein staining was performed using Pierce™ ECL Western Blot substrate (Thermo Fisher Scientific).

[0028] 8. Extraction and qRT-PCR: Total RNA was extracted from cells and tissues using a rapid cell RNA extraction kit (RN001, ES Science) and a rapid tissue RNA extraction kit (RN002, ES Science), respectively. RNA concentration was measured using a NanoDrop spectrophotometer to quantify total RNA yield. Reverse transcription was performed using PrimeScript RT Premix (Takara, RR036A) according to the manufacturer's instructions. qRT-PCR was performed using SYBR Green qPCR premix (Applied Biosystems, USA) and amplified on a QuantStudio 5 RT-PCR system (Applied Biosystems). qRT-PCR reaction conditions are shown in Table 3.

[0029] Table 3: qRT-PCR reaction conditions The sequences of all reaction primers are as follows: Forward primer for mouse gapdh (SEQ ID NO.7): 5'-CCTTCATTGACCTCAACTAC-3', reverse primer (SEQ ID NO.8): 5'-GAAGATGGTGATGGGATTTC-3'; Mouse ANP forward primer SEQ ID NO.9: 5'-ACCTGCTAGACCACCTGGAG-3', reverse primer SEQ ID NO.10: 5'-CCTTGGCTGTTATCTTCGGTACCGG-3'; Mouse BNP forward primer SEQ ID NO11: 5'-GAGGTCACTCCTATCCTCTGG-3', reverse primer SEQ ID NO12: 5'-GCCATTTCCTCCGACTTTTCTC-3'; Mouse β-MHC forward primer SEQ ID NO13: 5'-CCGAGTCCCAGGTCAACAA-3', reverse primer SEQ ID NO14: 5'-CTTCACGGGCACCCTTGGA-3'; mice myh7 Forward primer SEQ ID NO15: 5'-TCGTGGAGCGGCGCAACAAC-3', reverse primer SEQ ID NO16: 5'-TCAAAGGCTCCAGGTCTCAGGGCT-3'; Human gapdh forward primer SEQ ID NO19: 5'-GGAGCGAGATCCCTCCAAAAT-3', reverse primer SEQ ID NO20: 5'-GGCTGTTGTCATACTTCTCATGG-3'; Human BNP forward primer SEQ ID NO21: 5'-TGGAAACGTCCGGGTTACAGGA-3', reverse primer SEQ ID NO22: 5'-TCCGGTCCATCTTCCTCCCAAA-3'; people myh7 Forward primer SEQ ID NO23: 5'-TCACCAACAACCCCTACGATT-3', reverse primer SEQ ID NO24: 5'-CTCCTCAGCGTCATCAATGGA-3'.

[0030] 9. Transmission Electron Microscopy: Immediately after collection, the myocardial tissue or cells are immersed in glutaraldehyde fixative (2.5%, electron microscope grade) and photographed. Mitochondria arranged parallel to myofibrils are classified as normal. Additionally, mitochondria exhibiting a clustered distribution but originating from the convergence of normally arranged organelles are also considered structurally intact. Conversely, mitochondria exhibiting misalignment from sarcomere structures, disordered cristae, or vacuolation are considered damaged.

[0031] 10. Magnetic Resonance Imaging (MRI): All in vivo cardiac magnetic resonance (CMR) measurements were performed using a 9.4 T small animal CMR system (Biospec 94 / 20, Bruker Biospin, Germany). Mice were anesthetized with 3% isoflurane via a mixture of medical air (500 mL / min) and oxygen (500 mL / min), and the isoflurane concentration was maintained at 0.5% to 1.0% after induction. Maintaining hemodynamic stability during CMR examinations was crucial to minimize contaminants affecting image quality and functional assessment. During arterial spin labeling (ASL)-CMR scans, supplemental oxygen was infused at a flow rate of at least 800 mL / min to prevent hypoxia. Core body temperature was maintained at 36 ± 0.5 °C using a heated water jacket system. Heart rate, respiratory rate, and core body temperature were continuously monitored using a non-invasive physiological monitoring system (Model 1025, SA Instruments Inc., Stonybrook, NY, USA). To achieve high-resolution CMR imaging, a cryogenically cooled radio frequency (RF) transceiver coil (CryoProbe, Bruker Biospin) was used. To acquire a short-axis (SAX) image sequence covering the entire left ventricle, an IntraGate-FLASH sequence was employed with the following parameters: TR / TE = 8.5 / 1.58 ms, flip angle = 20°, receive bandwidth = 98 kHz, and field of view = 11 × 22 mm. 2 The matrix size was 192×384, the slice thickness was 0.8 mm, and 16 frames were acquired per cardiac cycle. Cardiac function analysis and layer-by-layer assessment were performed using CVI42 software (Circle Cardiovascular Imaging, Calgary, Canada). The endocardial and epicardial contours at the end of systole and diastole were manually delineated on the SAX dynamic image sequence. Left ventricular ejection fraction (LVEF) and myocardial mass (diastole and systole) were calculated based on this. The maximum wall thickness was determined by measuring the left ventricular wall thickness in six SAX sections at the end of diastole.

[0032] 11. Statistical Analysis: All data are expressed as mean ± standard error of mean (SEM). Data processing and analysis were performed using GraphPad Prism 8 software (GraphPad Software, Inc.). Normality was tested using the Shapiro-Wilk test; variables with a p-value > 0.05 were considered to be normally distributed. For normally distributed data with homogeneous variance, Student's t-test was used for comparisons between two groups; for three or more groups, one-way ANOVA combined with Tukey's multiple comparison test was used. A two-tailed p-value < 0.05 was considered statistically significant. The significance level labeling rules are as follows: P<0.05, P<0.01, P<0.001.

[0033] II. Experimental Results 1. Proband Clinical Phenotypic and Genotypic Identification: In a family with hypertrophic cardiomyopathy (HCM) in Tianjin, China, the proband was a 14-year-old male who presented with subxiphoid pain and syncope during a physical examination. Echocardiography and electrocardiography confirmed the diagnosis of hypertrophic cardiomyopathy. The electrocardiogram showed sinus rhythm and complete left bundle branch block. Figure 1 A). Two-dimensional echocardiography showed: slightly enlarged left atrium, small left ventricular chambers, thickened left ventricular wall myocardium, with a diastolic left ventricular posterior wall thickness (LVPWd) of 13 mm and a systolic left ventricular posterior wall thickness (LVPWs) of 21 mm; thickened interventricular septum, with a diastolic interventricular septal thickness (IVSd) of 25 mm and a systolic interventricular septal thickness (IVSs) of 23 mm; end-diastolic volume (EDV) of 80 ml and end-systolic volume (ESV) of 21 ml; thinning of the apex; localized outward bulging of the apex at the septum; and localized motion abnormalities. Figure 1 BC). Doppler examination showed: a small amount of regurgitation signal could be detected in the aortic valve area, and the diastolic blood flow spectrum of the mitral valve orifice showed E / A <1, consistent with left ventricular diastolic dysfunction. Figure 1 D, Table 4).

[0034] Table 4: Clinical information of the proband (III-12) A family history analysis of the proband revealed multiple cases of sudden death among young adults in his family. Figure 1 E) suggests the presence of hereditary hypertrophic cardiomyopathy. Given that genetic mutations are the cause of most cases of hypertrophic cardiomyopathy, this invention screened for possible mutated genes in this family using whole-exome sequencing. Discovery MYH7 c.794C>T(p.Thr265Ile) heterozygous mutation MYH7 c.2524A>G(p.Ser842Gly) heterozygous mutation and TNNT2 There are a total of 3 mutated genes in the heterozygous mutation ( Figure 1 F). The proforever also carries MYH7 c.794C>T(p.Thr265Ile) and MYH7 c.2524A>G(p.Ser842Gly) two mutations ( Figure 1 GH). MYH7 The c.2524A>G(p.Ser842Gly) mutation is present in five family members: I-3, II-8, II-10, III-10, and III-12. MYH7The c.794C>T(p.Thr265Ile) mutation is also present in two family members: II-9 and III-12. Furthermore, individuals II-7 and III-10 were found to carry the mutation. TNNT2 Heterozygous mutation ( Figure 1 I–J).

[0035] A comprehensive clinical evaluation, including physical examination and echocardiography, was conducted on 26 surviving members across four generations of this family. In addition to the proband, two other individuals (II-9, the proband's father; III-10) showed echocardiographic manifestations resembling myocardial hypertrophy. Echocardiography of II-9 revealed left ventricular enlargement, mild interventricular septal thickening, segmental ventricular wall motion abnormalities, and mild dilation of the ascending aorta in M-mode echocardiography. Color Doppler flow imaging (CDFI) showed mild mitral and tricuspid regurgitation and mitral valve calcification. Pulsed-wave Doppler analysis showed a biphasic spectrum at the mitral valve orifice with an E / A ratio <1, suggesting left ventricular diastolic dysfunction. Figure 1 KN, Table 5). The proband, cousin III-10, was further diagnosed with hypertrophic cardiomyopathy after examination, which gradually progressed to hypoxic-ischemic encephalopathy. Figure 1 O). It is worth noting that carrying MYH7 I-3 and II-8 with the c.2524A>G(p.Ser842Gly) mutation are currently asymptomatic.

[0036] Table 5: Clinical information of the proband's father (II-9) These findings indicate MYH7 The c.794C>T (p.Thr265Ile) mutation is highly likely to be pathogenic. This has been confirmed through searches of publicly available and specialized gene databases such as HGMD. MYH7 The p.S842G mutation has been previously reported in the literature and classified as a disease-related mutation, but MYH7 The p.T265I mutation is not found in any database and is a newly discovered mutation site that has not been reported before.

[0037] 2. Bioinformatics analysis and evaluation of new discoveries MYH7 c.794C>T(p.Thr265Ile) is a harmful mutation: to clarify... MYH7 T265I / + Whether heterozygous mutations are pathogenic depends first on... MYH7 The c.794C>T(p.Thr265Ile) heterozygous mutation was evaluated using bioinformatics analysis. Amino acids 265 and 842 of the β-MHC are highly conserved across different species. Figure 2 A). Gene mutations may affect the structure and function of the β-MHC protein, potentially leading to the development of pathogenic proteins. MYH7 S842G / + As a positive control MYH7 T265I / + Predictions from four online websites—Mutation Assessor, Mutation Taster, FATHMM, and PROVEAN—all showed a detrimental effect on the function of the protein β-MHC. Figure 2 B).

[0038] To clarify MYH7 T265I / + The effects on protein structure were simulated using PYMOL 2.5 and the HOPE online website. MYH7 The structure of the protein after the c.794C>T(p.Thr265Ile) heterozygous mutation, while also... MYH7 The c.2524A>G(p.Ser842Gly) heterozygous mutation was used as a control. The results showed that... MYH7 S842G / + The change in amino acids altered the structure of the protein side chain, resulting in a smaller molecular weight of the mutated amino acid residues compared to the wild type. Wild-type amino acids have two hydrogen bonds with lengths of 3.1 Å and 108.0 Å, and angles of 142.3° and 108.0°, respectively. The mutation had no effect on the number, length, or angle of the hydrogen bonds. MYH7 T265I / + The mutant amino acid residues have a larger molecular weight than the wild type; they are also more hydrophobic. Wild-type amino acid residues can form three hydrogen bonds with lengths of 3.1 Å, 3.4 Å, and 2.7 Å, and angles of 125.7°, 103.8°, and 125.8°, respectively. The mutant amino acid residues, compared to the wild type, lose one 2.7 Å hydrogen bond; the remaining two hydrogen bonds have the same length as the wild type, but their angles change to 125.2° and 105.4°, respectively. Figure 2 C). MYH7 T265I / + The region in question is the head of the β-MHC. Figure 2 DE), the head of β-MHC contains ATPase, which, under physiological conditions, can obtain energy by hydrolyzing ATP and thus trigger myocardial contraction. MYH7 T265I / + This may affect the relationship between β-MHC and ATP. The molecular docking software AutoDock Vina was used to dock wild-type and... MYH7 T265I / + Molecular docking of the β-MHC head with ATP was performed, and the results showed that the optimal binding energy for the wild-type β-MHC head to ATP was -8.1 kcal / mol. MYH7 T265I / +The optimal binding energy for β-MHC to ATP is -7.5 kcal / mol. MYH7 T265I / + This will reduce the binding capacity of the β-MHC head to ATP. Figure 2 F).

[0039] 3. Myh7 T265I / + , Myh7 T265I / T265I At 8 weeks of age, the ventricular wall thickness of male rats increased, while diastolic function showed no significant change. This was to investigate... MYH7 To determine whether the c.794C>T(p.Thr265Ile) mutation is pathogenic, we constructed a CRISPR / Cas9 model. Myh7 T265I / + mouse model ( Figure 3 A). Myh7 T265I / + Mouse hybridization breeding to obtain Myh7 T265I / + , Myh7 T265I / T265I Mice, and they can survive ( Figure 3 B), the model simulates MYH7 The c.794C>T (p.Thr265Ile) mutation was used. Genomic DNA was extracted from the gene-edited tissue, amplified by PCR, and detected by agarose gel electrophoresis. Myh7 T265I / + The size of the amplified product fragments from heterozygous mutant mice was not significantly different from that from wild-type (WT) mice. Figure 3 C) The results are consistent with the characteristics of point mutations. Sanger sequencing confirmed this. Myh7 T265I / + , Myh7 T265I / T265I Mouse construction successful ( Figure 4 A).

[0040] We first analyzed the WT of 8-week-old infants and Myh7 T265I / + , Myh7 T265I / T265I Male rats were observed ( Figure 4 B) Echocardiography showed that, compared with wild-type (WT) littermate males, Myh7 T265I / + , Myh7 T265I / T265I In male rats, there were no significant changes in left ventricular ejection fraction (EF) and fractional shortening (FS), but the ventricular wall thickness increased. Figure 4 C), diastolic function showed no significant change. Figure 4 D). We observed Myh7 T265I / + , Myh7 T265I / T265I Some mice developed myocardial hypertrophy, with increased heart weight (HW), and a trend towards increased heart weight / body weight (HW / BW) and heart weight / tibia (HW / TL). Figure 4 E). Wheat germ agglutinin (WGA) staining showed: Myh7 T265I / + , Myh7 T265I / T265I Hypertrophy of cardiomyocytes in male rats ( Figure 4 F). Masson trichrome staining showed that, compared with WT mice, Myh7 T265I / + , Myh7 T265I / T265I The area of ​​interstitial fibrosis in male rats did not change significantly, but the thickness of the ventricular walls increased. Figure 4 G). Myh7 T265I / + There was no statistically significant difference in the expression of genes that marker myocardial hypertrophy in male rats. Figure 4 H); but Myh7 T265I / T265I qRT-PCR analysis in male mice revealed elevated atrial natriuretic peptide (ANP). Figure 4 I).

[0041] To eliminate gender differences, we evaluated the WT of 8-week-old infants. Myh7 T265I / + and Myh7 T265I / T265I Female mice were observed. Figure 5 A). Echocardiographic examination showed that, compared with littermates born to WT females, Myh7 T265I / + , Myh7 T265I / T265I In female mice, EF, FS, and diastolic function showed no significant changes, and ventricular wall thickness showed no significant changes, but tended to increase. Figure 5 (BC). Somatic microscopy revealed that, compared to WT mice, Myh7 T265I / + , Myh7 T265I / T265I In female mice, there were no significant changes in heart weight, heart-to-body weight ratio, and heart-to-tibia ratio. Figure 5 D). Masson's trichrome staining showed no significant change in the area of ​​interstitial fibrosis. Figure 5 E), WGA staining showed no significant change in cardiomyocyte size. Figure 5 F). qRT-PCR revealed WT and Myh7 T265I / + , Myh7 T265I / T265I The myocardial hypertrophy index (BNP) in female mice was not statistically significant. Figure 5 G).

[0042] These results indicate that MYH7 The c.794C>T(p.Thr265Ile) mutation leads to cardiac structural changes in a sex-dependent manner: male mice exhibit marked early hypertrophic remodeling, while female mice do not show significant myocardial hypertrophy. In summary, these results indicate that… MYH7 The c.794C>T(p.Thr265Ile) mutation may be a core factor in the pathogenesis of hypertrophic cardiomyopathy.

[0043] 4. Myh7 T265I / + , Myh7 T265I / T265I Male rats developed myocardial hypertrophy and diastolic dysfunction at 22 weeks of age: [This was to investigate...] MYH7 Whether the myocardial hypertrophy phenotype in c.794C>T (p.Thr265Ile) mutant mice has a time-cumulative effect was investigated. We further examined the myocardial hypertrophy phenotype in 22-week-old WT mice. Myh7 T265I / + and Myh7 T265I / T265I Male rats were observed ( Figure 6 A).

[0044] Echocardiographic examination showed that, compared with WT male rats, Myh7 T265I / + , Myh7 T265I / T265I Male rats showed no significant changes in EF and FS, but the chamber wall thickness increased. Figure 6 B) Diastolic dysfunction Figure 6 C). Masson's trichrome staining showed that, compared to WT male rats, Myh7 T265I / + , Myh7 T265I / T265I The area of ​​interstitial fibrosis in male rats did not change significantly, but myocardial hypertrophy and abnormal cardiac structure occurred. Figure 6 D). We further observed Myh7 T265I / + and Myh7 T265I / T265I In male rats, heart weight (HW), heart weight / body weight (HW / BW), and heart weight / tibia (HW / TL) are elevated. Figure 6 E). WGA staining showed: Myh7 T265I / + and Myh7 T265I / T265I All male rats exhibited cardiomyocyte hypertrophy. Figure 6 F).

[0045] Cardiac magnetic resonance imaging (MRI), as the gold standard for quantifying myocardial structure and function, displays... Myh7 T265I / + and Myh7 T265I / T265I The mutant mice maintained normal ejection fraction, consistent with echocardiographic findings. However, male mutant mice exhibited increased end-diastolic ventricular wall thickness, end-systolic epicardial area, and end-diastolic epicardial area. Figure 6 G), which is consistent with the clinical manifestations of the proband. Molecular level analysis showed that, compared with WT male rats, Myh7 T265I / + and Myh7 T265I / T265I Gene expression of markers of myocardial hypertrophy in male rats was significantly upregulated. Figure 6 HI).

[0046] These results indicate that MYH7 The c.794C>T (p.Thr265Ile) mutation leads to cardiac remodeling with a cumulative effect over time, including increased hypertrophy and diastolic dysfunction, but without change in systolic function. These results indicate that... MYH7 The c.794C>T(p.Thr265Ile) mutation is a core factor in the pathogenesis of hypertrophic cardiomyopathy.

[0047] 5. Myh7 T265I / + , Myh7 T265I / T265I The myocardial hypertrophy phenotype was further aggravated in male rats at 48 weeks of age: We compared the WT and... Myh7 T265I / + , Myh7 T265I / T265I Male rats were observed ( Figure 7 A). Echocardiographic analysis showed that, compared with WT male rats, Myh7 T265I / + and Myh7 T265I / T265I Mutant male mice showed no significant changes in ejection fraction (EF) and ventricular shortening fraction (FS), but increased left ventricular wall thickness. Figure 7 B) and impaired diastolic function ( Figure 7 C). Compared to WT male rats, Myh7 T265I / + , Myh7 T265I / T265I Male rats showed significant myocardial hypertrophy, increased heart weight (HW), and increased heart weight / body weight (HW / BW) and heart weight / tibia ratio (HW / TL). Figure 7 D). Masson's trichrome staining showed that, compared with WT mice, Myh7 T265I / + , Myh7 T265I / T265I Male rats developed myocardial hypertrophy and abnormal heart structure. Figure 7 E). WGA staining showed: Myh7 T265I / + and Myh7 T265I / T265I Cardiomyocyte hypertrophy occurs in male rats ( Figure 7 F), consistent with previous findings. Magnetic resonance imaging results showed that at week 48, Myh7 T265I / + and Myh7 T265I / T265I Mice showed increased end-diastolic ventricular wall thickness, accompanied by increased epicardial area at both end-systole and end-diastole, consistent with previous findings. Figure 7 G). The above results indicate that Myh7 T265I / + and Myh7 T265I / T265I The myocardial hypertrophy phenotype in mice was further aggravated at 48 weeks of age, indicating that it was related to... MYH7 Cardiac pathology associated with the c.794C>T(p.Thr265Ile) mutation worsens with age.

[0048] 6. Myh7 T265I / + -AC16 cells exhibit characteristics of myocardial hypertrophy: In order to study MYH7 The effect of the c.794C>T(p.Thr265Ile) heterozygous mutation on human cardiomyocytes was investigated using CRISPR / Cas9 gene editing technology to induce point mutations in AC16 human cardiomyocytes. Figure 8 A). Design a pair of primers binding to the point mutation region. Sequencing primers: upstream primer (SMU050-F1) SEQ ID NO.25: CCAAGAGGGTCATCCAGTACTTT; downstream primer (SMU050-R1) SEQ ID NO.26: TAGGGTTTGGGCACAAGGAAAAT. DNA was extracted from heterozygous point mutant cells, amplified by PCR, and identified by agarose gel electrophoresis. Compared with WT-AC16 cells, Myh7 T265I / + The molecular weight of the amplification product from AC16 cells did not change significantly, and the amplification product was 799 bp. Figure 8 B) exhibits characteristics of a point mutation. Microscopic observation at 100x magnification reveals the cells are in a healthy growth state. Sanger sequencing peaks show the presence of both C and T bases at the target base site in the mutant cells, indicating that this cell type is... MYH7 The c.794C>T(p.Thr265Ile) heterozygous mutant cells, with negative results for both bacteria and mycoplasma, indicate that the obtained cells are qualified. MYH7 c.794C>T(p.Thr265Ile) heterozygous mutant cells ( Figure 8 C).

[0049] Cell viability was determined by CCK-8 assay, and the results showed that... Myh7 T265I / + -AC16 cell viability decreased ( Figure 8 D). To observe changes in the levels of markers of myocardial hypertrophy (D). Figure 8 E), qRT-PCR found Myh7 T265I / + - AC16 cell hypertrophy marker BNP, myh7 The content increased significantly ( Figure 8 F). Western Blot findings Myh7 T265I / + - AC16 cells showed significantly increased levels of ANP and BNP. Figure 8 G). Immunofluorescence staining and transmission electron microscopy revealed... Myh7 T265I / + -AC16 cells show nuclear swelling and increased perinuclear cell diameter. Figure 8 HI). Immunofluorescence results showed that, compared with WT-AC16 cells, under normoxic conditions... Myh7 T265I / + -AC16 cell area showed no significant change. Figure 8 J). Scanning electron microscopy revealed that WT-AC16 cells were spindle-shaped with dense microvilli and exhibited good absorption function. Myh7 T265I / + - AC16 cells are short and stout, with degenerated microvilli, affecting their absorption function. Figure 8 K). WT-AC16 cells and Myh7 T265I / + AC16 cells exposed to hypoxic conditions ( Figure 8 KL), immunofluorescence staining revealed Myh7 T265I / + - AC16 cell area increased ( Figure 8 The presence of N indicates that hypertrophy is further aggravated under stress conditions. These findings collectively demonstrate that... Myh7 T265I / + -AC16 cells exhibit the phenotypic characteristics of cardiomyocyte hypertrophy.

[0050] These findings ultimately proved that, MYH7 The p.T265I mutation drives key pathological features of hypertrophic cardiomyopathy, including cardiomyocyte hypertrophy, mitochondrial damage, energy metabolism disorders, and calcium dysregulation, revealing a series of cellular dysfunctions in the pathogenesis of hypertrophic cardiomyopathy.

[0051] 7. MYH7 The c.794C>T (p.Thr265Ile) mutation causes energy metabolism disorders by affecting ATP levels, which in turn leads to mitochondrial damage and may ultimately cause HCM: chemiluminescence assays have revealed that... Myh7 T265I / +- The ATP content in AC16 cells decreases ( Figure 9 A), but ADP / ATP and ATPase activities showed no significant changes ( Figure 9 B–C). Fluo-4 AM staining analysis revealed that... Myh7 T265I / + - AC16 cell calcium overload ( Figure 9 D). Furthermore, transmission electron microscopy revealed... Myh7 T265I / + AC16 cells show an increase in damaged mitochondria and a decrease in healthy mitochondria, characterized by mitochondrial swelling, cristae rupture, and vacuolation. Figure 9 E).

[0052] To investigate the time-dependent and sex-specific nature of mitochondrial damage, we used transmission electron microscopy to study 8-week-old infants. Myh7 T265I / + and Myh7 T265I / T265I Heart tissue from male and female mice, and at 22 and 48 weeks of age. Myh7 T265I / + and Myh7 T265I / T265I Male rats were observed ( Figure 9 F). At 8 weeks of age Myh7 T265I / + and Myh7 T265I / T265I Significant mitochondrial ultrastructural abnormalities were observed in all mice, specifically an increased number of damaged mitochondria, matrix swelling, disordered cristae structure, and vacuolation, while the proportion of morphologically intact normal mitochondria was significantly reduced. Figure 9 G). Females of the same age Myh7 T265I / + and Myh7 T265I / T265I Mice exhibited similar mitochondrial pathological features: compared to WT mice, mutant mice had an increased number of damaged mitochondria and a decreased number of healthy mitochondria. Figure 9 H) indicates that mitochondrial dysfunction occurs before the myocardial hypertrophy phenotype, and energy metabolism disorders may precede the onset of contractile dysfunction. At 22 and 48 weeks... Myh7 T265I / + and Myh7 T265I / T265I In male mice, transmission electron microscopy further confirmed that mitochondria exhibited continuous and progressive degenerative changes, characterized by further accumulation of damaged mitochondria and a continuous decrease in the proportion of healthy mitochondria. Figure 9 J).

[0053] These results indicate that MYH7Mutations in the p.T265I gene drive key pathological features of hypertrophic cardiomyopathy, including cardiomyocyte hypertrophy, mitochondrial damage, energy metabolism disorders, and calcium ion dysregulation, revealing a cascade of cellular dysfunction in the pathogenesis of hypertrophic cardiomyopathy.

[0054] Hypertrophic cardiomyopathy (HCM) often leads to sudden cardiac death, heart failure, and stroke. It is a hereditary myocardial disease characterized by asymmetric thickening of the ventricular walls. A diagnosis of HCM is made when the interventricular septum or left ventricular wall thickness is ≥15 mm in individuals without a family history, or ≥13 mm in individuals with a clear family history. HCM is caused by mutations in genes encoding sarcomeres or sarcomere proteins. More than 900 HCM-related mutations have been reported, primarily located in… MYH7 13 cardiac sarcoprotein genes, etc. MYH7 It is the most important genetic factor leading to hypertrophic cardiomyopathy.

[0055] In a four-generation HCM family in China, we identified MYH7 Two-site mutations: the previously reported pathogenic mutation c.2524A>G (p.Ser842Gly) and the newly discovered mutation c.794C>T (p.Thr265Ile). Proband III-12 was a male adolescent who experienced chest pain and sudden syncope during a physical examination. An electrocardiogram showed complete left bundle branch block, and echocardiography confirmed hypertrophic cardiomyopathy. The proband's cousin, III-10, was also diagnosed with hypertrophic cardiomyopathy. Patient II-7 underwent echocardiography and was found to have left atrial enlargement; pulse wave analysis showed a biphasic mitral valve flow spectrum, E / A ratio <1, and decreased left ventricular diastolic function. Figure 1 In addition, four other members of this family died suddenly. (Q, Table 6).

[0056] Table 6: Clinical Information for II-7 To determine the etiology of hypertrophic cardiomyopathy in this family, peripheral venous blood was collected from 26 members across four generations. Whole-exome sequencing was performed on peripheral venous blood from two patients and two healthy members, I-3 and II-11. The selection criteria for the two healthy members were: (1) sex matching: the two patients were one male and one female, therefore the healthy controls should also include both males and females; (2) genetic background matching: the two patients shared a common maternal genetic background, therefore controls with a common maternal genetic background were selected; (3) the healthy controls did not have clinical phenotypes of HCM and related cardiovascular diseases. I-3 was the maternal grandmother (female) of the two patients and the source of the maternal genetic background in this family of 26 across four generations. II-11 was the maternal uncle (male) of the two patients and shared a common maternal genetic background. Furthermore, both I-3 and II-11 showed no clinical manifestations of HCM and related cardiovascular diseases during their health checkups, thus meeting the requirements for selecting healthy controls.

[0057] Analysis of the whole-exome sequencing results revealed that healthy control I-3, proband III-12, and the proband's cousin III-10 all carried the virus. MYH7 The c.2524A>G (p.Ser842Gly) heterozygous mutation was identified as a pathogenic mutation for hepatocellular carcinoma (HCM) in studies reported by searching the HGMD database. Healthy controls II-11 did not carry any HCM-related mutations. Furthermore, the c.2524A>G (p.Ser842Gly) mutation was detected in the peripheral blood of proband III-12. MYH7 The c.794C>T (p.Thr265Ile) heterozygous mutation was found to be absent from all mutation databases after searching HGMD, 1000Genome, and ESP6500si databases. This is a newly discovered mutation that has never been reported before. MYH7 Mutation site.

[0058] To further confirm whether other family members carried the candidate gene mutation, first-generation sequencing was performed on peripheral venous blood samples from other family members. The results showed that proband III-12 also carried the mutation. MYH7 c.2524A>G(p.Ser842Gly) heterozygous mutation and MYH7The c.794C>T (p.Thr265Ile) heterozygous mutation was inherited from the mother, II-10, and the father, II-9, respectively. Among the family members carrying the mutation, only the proband, III-12, and the proband's cousin, III-10, were diagnosed with HCM. III-11 (III-10's sister, the proband's cousin) had a slightly faster heart rate than her age, but this did not meet the diagnostic criteria, and she had no other abnormal physical signs, possibly due to her young age. The proband's father, II-9, showed hypertrophic cardiomyopathy-like features on echocardiography, but this did not meet the diagnostic criteria. Furthermore, the proband's father had a five-year history of hypertension, so the possibility of myocardial hypertrophy caused by the impact of hypertension on cardiac load could not be ruled out. It is noteworthy that in this family, I-3, II-8, II-10, and III-11 only carried the reported pathogenic mutations. MYH7 c.2524A>G (p.Ser842Gly) but did not show HCM symptoms, only carried the virus. MYH7 Member II-9 with the c.794C>T (p.Thr265Ile) heterozygous mutation exhibits a hypertrophic cardiomyopathy-like clinical phenotype. This phenotypic difference supports the following hypothesis: MYH7 The c.794C>T(p.Thr265Ile) mutation is likely the main driver of the proband's disease presentation.

[0059] Linkage analysis of the proband's and his father's genetic and clinical phenotypes suggests that... MYH7 c.794C>T(p.Thr265Ile) may be pathogenic. We extracted data from gnomAD v4.1 to assess the pathogenicity of the population. MYH7 The mutation frequency at gene position 794 was found in this database in the Allele Count European (non-Finnish) population. MYH7 The c.794C>A (p.Thr265Asn) mutation, with a cadd value of 26.4 (Table 7), affects protein function and may be pathogenic. MYH7 The c.794C>T (p.Thr265Ile) mutation may be pathogenic and closely related to the occurrence of specific diseases. We first used various bioinformatics analysis methods to analyze the newly discovered mutation. MYH7 Preliminary evaluation was conducted on c.794C>T (p.Thr265Ile). Genetic conservation analysis confirmed that the amino acid site encoded by the newly discovered mutation is highly conserved, indicating its functional importance. Molecular structure simulation software showed that the mutant amino acid loses a hydrogen bond, increasing hydrophobicity. Four protein function prediction software programs indicated that the mutation at this site may be detrimental to protein function, supporting its potential impact on β-MHC function.

[0060] Table 7: MYH7 The carrier frequency of the c.794 gene mutation has been recorded in the gnomAD database. To clarify MYH7 To determine whether c.794C>T(p.Thr265Ile) is pathogenic, we constructed a CRISPR / Cas9 model. Myh7 T265I / + , Myh7 T265I / T265I Mouse model. Since the penetrance of HCM gradually increases with age, there may be a time-cumulative effect. Therefore, we first used mutant mice in vivo to conduct time-series observations at different ages... MYH7 The role of c.794C>T (p.Thr265Ile) was assessed in 8-week-old mice to simulate young adults, 22-week-old mice to simulate middle-aged adults, and 48-week-old mice to simulate old adults. The study systematically evaluated c.794C>T (p.Thr265Ile) at the morphological, functional, and molecular marker levels. MYH7 Pathogenicity of c.794C>T (p.Thr265Ile). Compared with WT mice, Myh7 T265I / + , Myh7 T265I / T265I In male rats at 8 weeks of age, ventricular wall thickness increased, but systolic and diastolic function remained unchanged. At 22 weeks, the hypertrophic phenotype was evident, accompanied by diastolic dysfunction, and the hypertrophic phenotype further worsened at 48 weeks. This confirmed... MYH7 c.794C>T (p.Thr265Ile) is pathogenic, and the hypertrophic myocardial phenotype it induces has a cumulative effect over time.

[0061] Myh7 T265I / + , Myh7 T265I / T265I Significant mitochondrial damage was observed in male rats at 8 weeks of age, including mitochondrial swelling, cristae rupture, and vacuolation. However, no myocardial dysfunction was observed at this time, indicating that energy impairment preceded systolic and diastolic dysfunction, suggesting... MYH7 The c.794C>T (p.Thr265Ile) mutation may drive myocardial hypertrophy through energy metabolism disorders. Bioinformatics analysis revealed... MYH7 The amino acid residues encoded by c.794C>T (p.Thr265Ile) are located next to the ATP-binding site in the β-MHC head. Simulated docking experiments revealed... MYH7 The decreased ATP-binding ability of the β-MHC head encoded by c.794C>T(p.Thr265Ile) suggests that... MYH7 The newly discovered c.794C>T(p.Thr265Ile) mutation site may lead to myocardial hypertrophy by affecting ATP and causing insufficient energy supply.

[0062] We used CRISPR / Cas9 gene editing technology to induce heterozygous point mutations in AC16 ventricular myocytes in vitro. Myh7 T265I / + AC16 cells exhibited hypertrophy, mitochondrial damage, decreased ATP levels, and calcium overload. These results suggest that this mutation may cause mitochondrial damage, leading to reduced ATP, delayed SER regeneration of Ca²⁺, calcium overload, and further mitochondrial damage, creating a vicious cycle.

[0063] MYH7 The c.794C>T (p.Thr265Ile) mutation causes myocardial hypertrophy that differs between sexes, with higher penetrance in male mice, consistent with the clinical trend of male-predominant myocardial hypertrophy. This phenomenon can be explained by modification of the testosterone-mitochondrial axis; male mice, due to a high testosterone background, amplify hypertrophy through the AR-mitochondrial-calcium-ROS axis. MYH7 The energy crisis caused by the mutation results in higher HCM penetrance; females, on the other hand, are better "tolerant" to the same mutation due to lower androgen levels and stronger mitochondrial antioxidant reserves. This mechanism provides a theoretical basis for clinical sex-based risk assessment.

[0064] We detected a novel, previously unreported mutation in an HCM family. MYH7 The pathogenicity and potential pathogenic mechanism of the c.794C>T (p.Thr265Ile) mutation in myocardial hypertrophy were determined through gene-phenotype cosegregation analysis, in vivo and in vitro experiments. Our study confirms... MYH7 c.794C>T (p.Thr265Ile) drives hypertrophy through energy metabolism disorders, which precede systolic and diastolic dysfunction. With the increasing attention given to the concept of "precision medicine," is it possible to achieve individualized prevention or treatment by reducing myocardial energy metabolism and mitochondrial damage? MYH7 The occurrence of related hepatic muscular dystrophy (HCM) has significant clinical implications. With the development of molecular genetics, gene diagnosis is increasingly being applied clinically. MYH7 Genetic testing has positive significance in assisting early clinical diagnosis, early treatment, and early prevention.

[0065] Finally, it should be clarified that the foregoing embodiments are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the embodiments, or make equivalent substitutions for some or all of their technical features, and the essence of these modified and substituted technical solutions does not exceed the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Genes causing hypertrophic cardiomyopathy MYH7 c.794C>T(p.Thr265Ile), characterized in that: The MYH7 The gene mutation is located in exon 9, where the 794th base is changed from C to T, i.e., ACC is changed to ATC. The 265th amino acid in the encoded amino acid sequence is changed from threonine to isoleucine.

2. The pathogenic gene for hypertrophic cardiomyopathy according to claim 1 MYH7 c.794C>T(p.Thr265Ile), characterized in that: The MYH7 The c.794C>T(p.Thr265Ile) mutation is located in the head domain of the β-MHC, close to the ATP binding site, and the ATP binding affinity of the mutant protein is reduced.

3. The pathogenic gene for hypertrophic cardiomyopathy according to claim 1 MYH7 c.794C>T(p.Thr265Ile), characterized in that: The MYH7 The c.794C>T(p.Thr265Ile) mutation drives key pathological features of hypertrophic cardiomyopathy, including cardiomyocyte hypertrophy, mitochondrial damage, energy metabolism disorders, and calcium dysregulation.

4. The pathogenic gene for hypertrophic cardiomyopathy according to claim 1 MYH7 c.794C>T(p.Thr265Ile), characterized in that: The MYH7 The c.794C>T(p.Thr265Ile) mutation leads to changes in cardiac structure in a sex-dependent manner.

5. The pathogenic gene for hypertrophic cardiomyopathy according to claim 1 MYH7 c.794C>T(p.Thr265Ile), characterized in that: The MYH7 The c.794C>T(p.Thr265Ile) mutation leads to an increase in the pathological severity of hypertrophic cardiomyopathy with age.

6. The hypertrophic cardiomyopathy pathogenic gene as described in claim 1 MYH7 Application of c.794C>T (p.Thr265Ile) in the preparation of kits for the detection or early diagnosis of hypertrophic cardiomyopathy.

Images