Method for screening thermostable mutation sites of G-protein coupled receptor and application of thermostable mutation sites of G-protein coupled receptor
By replacing the intracellular loop sequence of GPCRs and labeling the SmBiT peptide, combined with temperature gradient incubation of nanobodies and LgBiT complexes and luciferase detection, the problems of low efficiency and high cost of GPCR screening are solved. This achieves efficient screening of thermostable mutation sites, applicable to a variety of GPCR subtypes, especially orphan receptors, supporting structural analysis and drug development.
Patent Information
- Application Number
- CN202511493999.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-20
AI Technical Summary
Existing GPCR thermostable mutant screening methods suffer from problems such as low screening efficiency, high cost, dependence on ligands and high-end equipment, and interference from exogenous markers, especially limiting research on orphan receptors.
By replacing the third intracellular loop of the wild-type GPCR with the kappa opioid receptor sequence, tagging the SmBiT peptide, combining it with a nanobody and an LgBiT complex, and using temperature gradient incubation and luciferase detection, ligand and protein purification were avoided, and thermostable mutation sites were screened using a conventional microplate reader.
It improves the efficiency of thermostability screening for GPCRs, especially orphan receptors, reduces R&D costs and time investment, and provides efficient technical support for structural analysis and drug development.
Smart Images

Figure CN120948816A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biology and biotechnology, specifically to a method for screening thermostability mutation sites of G protein-coupled receptors and its applications. Background Technology
[0002] G protein-coupled receptors (GPCRs) are the largest family of membrane proteins in eukaryotes, comprising over 800 members. They are primarily responsible for sensing extracellular signals and transmitting them into the cell, participating in the regulation of many important physiological processes and playing a crucial role in cell signal transduction. GPCRs are an important class of drug targets. GPCRs possess a typical seven-transmembrane helix structure (TM1-7), encompassing an extracellular N-terminal domain, three extracellular loops (ECL1-3), three intracellular loops (ICL1-3), an intracellular soluble α-helix (Helix8), and a C-terminal domain. Despite the high medicinal value of GPCRs, their structural analysis remains a significant challenge, especially for orphan receptors lacking ligands. GPCRs exhibit highly dynamic conformations, containing numerous flexible regions and exhibiting extremely low structural stability, making efficient purification difficult and severely hindering structure-based analysis, drug screening, and research progress. Improving GPCR stability through thermostability point mutation screening has become an important tool for assisting structural analysis, particularly for orphan receptors lacking ligands and with unclear downstream signal transduction pathways. Currently, the following three technical approaches are mainly used for screening thermostability mutants of GPCRs: 1. Radioligand binding assay: This method assesses the stability of GPCRs by detecting their binding ability to radioligands under a temperature gradient. Active GPCRs can specifically bind to labeled ligands; however, their binding ability decreases after heat treatment causes protein denaturation and inactivation. By measuring the residual binding activity at different temperatures, the Tg of different mutant proteins can be calculated. m This allows for the rapid screening of mutants with improved thermal stability.
[0003] 2. Fluorescence detection method based on thermal denaturation: This method utilizes the covalent binding of BODIPY FL L-cysteine dye to the free thiol groups of GPCR mutant proteins, or the specific binding characteristics of CPM (7-diethylamino-3-(4'-maleimidephenyl)-4-methylcoumarin) dye to protein thiol groups. After incubation at different temperature gradients, changes in fluorescence intensity are detected, and the melting temperature (Tm) of each mutant is calculated. m ), thereby filtering out those with higher T m Value thermal stability mutant.
[0004] 3. NanoDSF (NanoTemper Monolith Biomolecular Interaction Detector): This method uses a NanoTemper Monolith biomolecular interaction detector to directly monitor the changes in endogenous fluorescence of GPCR mutants under a temperature gradient, accurately determining the T of each mutant without the need for exogenous dye labeling. m The value was used to complete the screening of thermally stable mutants.
[0005] However, the above-mentioned GPCR thermostability mutant screening methods have the following main technical drawbacks: (1) Ligand-dependent defects: The application of radiolabeled ligand binding assays relies on known high-affinity ligands. For orphan GPCRs for which no endogenous ligands have been found, this method is difficult to apply directly. In addition, the preparation and use of radiolabeled ligands are costly and involve the handling of radioactive materials, which places higher demands on experimental safety and waste disposal.
[0006] (2) Protein purification-dependent defects: Although fluorescence detection and micro-differential scanning fluorescence do not require ligands, their effectiveness is highly dependent on high-purity, homogeneous GPCR protein samples. However, for conformationally unstable GPCRs, especially orphan receptors lacking ligand binding, the purification process is prone to protein denaturation or aggregation, making it difficult to obtain homogeneous protein samples that meet the detection requirements, which severely restricts the screening efficiency of thermostable mutants.
[0007] (3) Defects of exogenous labeling interference: The detection method based on BODIPY FL L-cysteine and CPM dye requires chemical labeling of the protein. This covalent modification may change the native conformation and functional properties of GPCR, leading to deviations in screening results. At the same time, the cost of fluorescent labeling reagents is high, increasing the experimental cost.
[0008] (4) Equipment dependency: The NanoDSF method requires specialized high-end detection equipment such as NanoTemper Monolith. These instruments are expensive and complex to operate, which limits the widespread application of the method.
[0009] These technical limitations severely hinder research on the thermostability modification of GPCRs, particularly orphan receptors. Therefore, there is an urgent need to develop a novel method for screening thermostability mutants of GPCRs that is highly efficient and cost-effective. Summary of the Invention
[0010] Therefore, the technical problem to be solved by this invention is to overcome the shortcomings of low screening efficiency and high cost in the prior art, thereby providing a method for screening thermostable mutation sites of G protein-coupled receptors and its applications. The method of this invention requires no ligands and no protein purification steps, which can improve screening efficiency, avoid conformational interference that may be caused by the introduction of exogenous labels, and can be completed using only a conventional microplate reader, greatly reducing the technical threshold and equipment requirements. Through temperature gradient incubation and T... m By combining value calculation with other methods, this approach can rapidly screen for mutation sites with enhanced thermostability from a large number of GPCR point mutations. Compared to traditional methods, this technique significantly improves screening efficiency, saves considerable R&D time and costs, and provides a more efficient and economical solution for structural studies and drug development of difficult-to-analyze targets such as orphan receptors.
[0011] Therefore, the present invention provides the following technical solution: This invention provides a method for screening thermostability mutation sites of G protein-coupled receptors, comprising: S1. Replace the entire third intracellular loop segment in the wild-type G protein-coupled receptor with the third intracellular loop sequence of the kappa opioid receptor; and label the wild-type G protein-coupled receptor with an SmBiT peptide tag. S2. Mutate the wild-type G protein-coupled receptor described in step (1) according to the mutation sites in the mutant of the G protein-coupled receptor to be tested; S3. After processing in step S2, the modified G protein-coupled receptor mutant is obtained; the modified G protein-coupled receptor mutant is incubated at different temperatures to obtain modified G protein-coupled receptor samples treated at different temperatures. S4. The modified G protein-coupled receptor samples treated at different temperatures were mixed and incubated with nanobodies and LgBiT complexes, and then luciferase substrate was added for detection.
[0012] In some embodiments, step S1 further includes replacing 5-12 amino acids near the N-terminus of the third intracellular loop segment in the TM5 segment upstream of the third intracellular loop segment of the wild-type G protein-coupled receptor with the third intracellular loop sequence of the kappa opioid receptor, and replacing 5-25 amino acids near the C-terminus of the third intracellular loop segment in the TM6 segment downstream with the third intracellular loop sequence of the kappa opioid receptor.
[0013] In some embodiments, in step S1, the SmBiT peptide tag is labeled at the C-terminus of the wild-type G protein-coupled receptor; In some embodiments, the SmBiT peptide tag is attached to the wild-type G protein-coupled receptor via a flexible peptide. In some embodiments, the amino acid sequence of the SmBiT peptide tag is shown in SEQ ID NO.1.
[0014] In some implementations, the different temperatures in step S3 are gradient temperatures.
[0015] In some implementations, in step S3, the different temperature ranges are 30°C to 75°C, and the temperature is any one number or a range between any two values from 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 75°C.
[0016] In some implementations, in step S3, the temperature difference between two adjacent temperatures in the gradient temperature does not exceed 6°C.
[0017] In some embodiments, in step S3, the incubation time is 30 to 40 minutes, such as any number or a range between any two values of 30, 35, or 40 minutes; after incubation, the temperature is cooled at 4 to 10°C for 10 to 20 minutes.
[0018] In some embodiments, in step S3, the concentration range of the modified G protein-coupled receptor is 0.1 mg / mL to 1 mg / mL, for example, any one of 0.1, 0.5, 1 mg / mL or a range between any two values.
[0019] In some embodiments, in step S4, the nanobody is selected from Nb6 nanobodies; In some embodiments, in step S4, the LgBiT is attached to the C-terminus of the nanobody; In some embodiments, in step S4, the LgBiT is attached to the nanobody via a flexible peptide.
[0020] In some embodiments, in step S4, the modified G protein-coupled receptor samples treated at different temperatures are mixed with nanobodies and LgBiT complexes at a molar ratio of 60:1 to 600:1. In some embodiments, in step S4, the incubation conditions are room temperature (20-25°C) for 15-20 minutes. In some embodiments, in step S4, the luciferase substrate is selected from coelenterate h, furimazine, hydrofurimazine (HFz), or fluorofurimazine (FFz). In some embodiments, in step S4, the final concentration of the luciferase substrate added is a molar concentration of 20~100 nM; In some embodiments, in step S4, the detection step involves detecting the chemiluminescence signal at an emission wavelength of 460±20 nm without excitation wavelength, and calculating T. m value.
[0021] The embodiments of the present invention provide a method for screening thermostability mutation sites of G protein-coupled receptors, which has any of the following uses: (1) Application in screening thermostable mutation sites in G protein-coupled receptors; (2) Quantitatively assess the effect of thermostability mutation sites in G protein-coupled receptors on the level of thermostability enhancement of G protein-coupled receptors; (3) Use in improving the thermostability and / or structural resolution of G protein-coupled receptors; (4) Uses in the research and development of G protein-coupled receptor-based drugs; (5) Use in assisting the purification of G protein-coupled receptors.
[0022] In some embodiments, the G protein-coupled receptor includes receptors with known Class A ligands or orphan receptors with unknown Class A ligands.
[0023] This invention provides a highly thermally stable G protein-coupled receptor, which is obtained by screening using the aforementioned method for screening G protein-coupled receptors for thermal stability mutation sites.
[0024] In some embodiments, the highly thermostable G protein-coupled receptor comprises: the orphan receptor GPR151 including at least one of the following mutation sites: L127 3.41 W or S300 7.47 A.
[0025] In some embodiments, the orphan receptor GPR151 further includes at least one of the following mutation sites: I58 1.54 L, N64 1.60 Y, S86 2.52 L, M72 2.38 A, K101 2.67 G, M122 3.36 A, S126 3.40 A, A140 3.54 L, W155 4.43 A, W173 4.61 A, S200 5.36 A, L205 5.41 A, A2185.54 I, W274 6.59 C, L294 7.41 A or F306 7.53 L.
[0026] In some implementations, the orphan receptor GPR151 includes the following mutation site: L127 3.41 W, S300 7.47 A, S86 2.52 L, S200 5.36 A.
[0027] This invention provides a method for structural analysis of the highly thermally stable G protein-coupled receptor, comprising assembling the highly thermally stable G protein-coupled receptor with a Lego antibody to form a complex, and then using cryo-electron microscopy to analyze the three-dimensional structure.
[0028] The technical solution of this invention has the following advantages: 1. This invention provides a method for screening thermostability mutation sites in G protein-coupled receptors, comprising: S1, replacing the third intracellular loop segment in a wild-type G protein-coupled receptor with the third intracellular loop sequence of a kappa opioid receptor; labeling the wild-type G protein-coupled receptor with an SmBiT peptide tag; S2, mutating the wild-type G protein-coupled receptor described in step S1 according to the mutation sites in the G protein-coupled receptor mutant to be tested; S3, after processing in step S2, obtaining a modified G protein-coupled receptor mutant; incubating the modified G protein-coupled receptor at different temperatures to obtain modified G protein-coupled receptor samples treated at different temperatures; S4, mixing and incubating the modified G protein-coupled receptor samples treated at different temperatures with nanobodies and LgBiT complexes, then adding luciferase substrate for detection; in the above method... In step S1, the third intracellular loop (ICL3) segment between the fifth transmembrane helix (TM5) and the sixth transmembrane helix (TM6) of the target GPCR is selected and replaced with the third intracellular loop sequence of the kappa opioid receptor (KOR) to enhance the specific binding ability with nanobodies such as Nb6. Simultaneously, an SmBiT peptide tag is attached to the end of the GPCR to form a functional complex, NanoLuc protein, with the complementary protein LgBiT. In step S2, the aim is to introduce the thermostable mutation site to be screened. The modified G protein-coupled receptor mutant after steps S1 and S2 can be routinely expressed to prepare crude protein samples. Routine expression to prepare crude protein samples refers to collecting the cell membrane (also known as crude membrane preparation), because G protein-coupled receptors are membrane proteins that are directly expressed and embedded in the cell membrane. The cell membrane is separated by centrifugation or other methods to obtain a protein sample enriched with the target receptor. Although this sample contains other membrane proteins and other impurities, the concentration of its target GPCR is sufficient for subsequent experiments in this invention, thus eliminating the need for purification, ligands, and exogenous fluorescent dye labeling. In step S3, the modified G protein-coupled receptor mutant is treated at different temperatures. The modified G protein-coupled receptor samples treated at different temperatures are then mixed and incubated with the nanobody-LgBiT complex. The nanobody specifically binds to the third intracellular loop sequence of the kappa opioid receptor (KOR) in the modified G protein-coupled receptor mutant. The SmBiT peptide tag at the end of the modified G protein-coupled receptor mutant and the LgBiT in the nanobody-LgBiT complex complement each other to form a luminescent system. Then, under the action of luciferase substrate, the T values of wild-type and various mutant GPCRs can be detected by an enzyme-linked immunosorbent assay (ELISA) reader. m Value, filtering compared to wild type T mThe method provides an effective thermostable mutation with improved values and low equipment requirements. In summary, the method of this invention requires no ligands or protein purification steps, avoids the introduction of exogenous labels, and can be completed using only a conventional microplate reader, significantly reducing the technical threshold and equipment requirements. Through temperature gradient incubation and T... m By combining numerical calculation with analytical methods, this approach can rapidly screen for mutation sites that enhance thermostability from a large number of GPCR point mutations. Compared to traditional methods, this technique significantly improves the screening efficiency for the thermostability of GPCRs, especially orphan receptors, saving research and development time and costs. It offers key technical support for the structural analysis of GPCRs, thereby accelerating the development of related drugs.
[0029] Furthermore, the method of the present invention is universal and reliable, and can be adapted to screen different GPCRs, such as typical representatives of Class A GPCRs with known thermostable point mutations—dopamine D2 receptor (DRD2) and serotonin 2A receptor (5-HT2). 2A R) and adenosine A 2A receptor (A) 2A The method of this invention can quantitatively assess the effect of these mutations on receptor stability, fully demonstrating the wide applicability of the method of this invention in different subtype GPCRs.
[0030] 2. This invention provides a highly thermostable G protein-coupled receptor. Furthermore, the method of this invention has been successfully applied to the Class A orphan receptor GPR151, whose ligand information and downstream signal transduction mechanisms are not yet fully understood. Through screening using the GPCR point mutation database (GPCRdb) and verification using the method of this invention, the optimal thermostable point mutation combination for GPR151 was obtained. Experimental data show that this mutation combination can enhance the T-cell stability of GPR151. m The value was significantly increased by 7.3℃, effectively solving the technical problem of unstable receptor structure.
[0031] 3. This invention provides a method for structural analysis of a highly thermostable G protein-coupled receptor, and further, a method for structural analysis of GPR151. GPR151 is modified using thermostable point mutation combinations obtained through screening in this invention, transforming it from an unstable and unpurifiable state to a stable and purifiable state. Subsequently, the modified receptor is assembled with a Legobody antibody to form a complex. Finally, its three-dimensional structure is successfully resolved using cryo-electron microscopy. This structural analysis method provides an important structural foundation for drug design and synthesis based on the GPR151 structure. Attached Figure Description
[0032] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0033] Figure 1 This is a schematic diagram of the process for screening thermostability mutation sites of G protein-coupled receptors in Embodiment 1 of the present invention; Figure 2 This is an example of the verification of known thermally stable point mutations using the G protein-coupled receptor thermostability mutation screening method described in Example 2 of this invention; where A represents the DRD2- thermostability screening result; and B represents 5-HT. 2A R is the thermal stability screening result; C is A 2A R thermal stability screening results; Figure 3 This is the screening of the optimal thermal stability point mutation combination of GPR151 in Embodiment 3 of the present invention; wherein, A is a serpentine diagram of GPR151, yellow represents point mutation sites, and red represents effective point mutation sites; B is the optimal thermal stability point mutation combination of GPR151 obtained by screening using the method of the present invention. Figure 4 This is the thermal stability point mutation-assisted GPR151 structure analysis in Example 4 of the present invention; wherein, A is the GPR151 purification peak diagram; B is the high-efficiency purification characteristic peak of the GPR151-K-Legobody complex; C is the GPR151 structural model diagram resolved by cryo-electron microscopy (pink is GPR151, blue is the Legobody complex). Detailed Implementation The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.
[0034] For experiments not specifically described in the examples, the procedures or conditions should be followed according to the conventional experimental procedures described in the literature in this field. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.
[0035] The materials and methods involved in the following embodiments are as follows: 1. Experimental bacterial strains and cell lines The strains used in this invention include: the *E. coli* TOP10 engineered strain used for plasmid cloning, the *E. coli* BL21(DE3) strain used for recombinant protein expression, and the *E. coli* DH10Bac strain used for recombinant baculovirus preparation. Regarding cell lines, this invention selected the human embryonic kidney epithelial cell line HEK293T for functional verification experiments, and simultaneously employed... Spodoptera frugiperda Sf9 insect cells and Expi293F mammalian cells were used as recombinant protein expression systems. All the strains and cell lines mentioned above are commercially available products.
[0036] 2. HEK293T cell culture HEK293T cells were cultured in DMEM medium (commercially available, Thermo Fisher Scientific, C11995500BT) containing 10% fetal bovine serum (FBS) in a culture dish at 37°C under 5% CO2 conditions. Once the cells had confluently adhered to the culture dish, the medium was aspirated with a pipette, and excess serum was removed by gently washing with 1 mL of PBS. 800 μL of 0.25% trypsin was added, and the cells were incubated for 2 min to digest. The cells were then removed and observed under a microscope; they became rounded and moved freely at the bottom of the dish. 2 mL of serum-containing culture medium was added to stop the digestion. The cells were gently dispersed into single cells using a 1 mL pipette. Finally, the cells were passaged or used for further experiments as needed.
[0037] 3. HEK293T cell transfection One day before transfection, HEK293T cells confluent in one 6 cm culture dish were passaged into four 6 cm culture dishes at a ratio of 1:4. Twenty hours later, when the cell density reached 50%-70%, transfection was prepared. 400 μL of 150 mM NaCl was placed in a clean EP tube, and 4 μg of plasmid was added. Simultaneously, PEI transfection reagent (commercially available, Polysciences, 24765-1) was added at four times the amount of plasmid, and the mixture was thoroughly mixed. The mixture was incubated at room temperature for 20 minutes. 400 μL of the transfection solution was then added dropwise to the culture dish, and the mixture was gently shaken to mix.
[0038] 4. Extraction of cell membrane proteins containing specific point mutation receptors On day 1, HEK293T cells at approximately 70% confluence in a 6 cm culture dish were transiently transfected with 4 μg of receptor and 16 μL of PEI transfection reagent. On day 2, the culture medium was replaced with 5% FBS DMEM. On day 3, cell membranes were harvested. Specifically, the culture medium in the 6 cm dish was aspirated using a vacuum pump, the cells were washed once with 1×PBS, and 3 mL of lysis buffer (1 mM HEPES, 2 mM EDTA, pH 7.4) was added. The cells were then placed in a 4°C freezer for 10 minutes. After cell detachment, the cells were transferred to a 15 mL centrifuge tube and centrifuged at 5000 rpm for 5 minutes at 4°C. The supernatant was discarded. The cell pellet was transferred to a tissue homogenizer, 3 mL of lysis buffer was added, and the cells were thoroughly homogenized until lysed. The cell pellet was then centrifuged and the supernatant was discarded. This process was repeated twice, and the pellet was collected. Finally, the precipitate was resuspended with lysis buffer, and the cell suspension was divided into multiple EP tubes. The tubes were centrifuged at 15,000 rpm for 5 minutes at 4°C. The supernatant was discarded, and the precipitate was the cell membrane component containing the specific receptor. The precipitate was stored at -80°C.
[0039] 5. Expi293F cell culture Expi293F cells were cultured in suspension using UP1000 perpetual transfer medium under the following conditions: constant temperature of 37°C and constant shaking at 170 rpm. When the cell density reached 4 × 10⁻⁶ cells / year... 6 Subculturing is performed when the cell count reaches 1 / ml (mid-logarithmic growth phase). The subculturing procedure includes: transferring the cell suspension to a preheated culture shake flask under aseptic conditions, adding fresh culture medium preheated to 37°C, adjusting to the appropriate inoculation density, and continuing to culture under the above conditions.
[0040] 6. Spodoptera frugiperda Sf9 insect cell culture Sf9 insect cells were cultured in suspension using ESF 921 protein-free insect cell culture medium under the following conditions: constant temperature of 27°C and constant shaking at 170 rpm (no CO2 control required). When the cell density reached 6 × 10⁶ cells / year... 6 Passaging is performed when the cell density reaches 1 / ml (mid-logarithmic growth phase). The specific method is as follows: In a biosafety cabinet, the cell suspension is transferred to a sterile shake flask, fresh culture medium preheated to 27°C is added, the cell density is adjusted, and the cells are then placed under the above culture conditions for further amplification.
[0041] 7. Purification of the Legobody complex 7.1 Fab protein expression and purification The Fab_8D3_2 protein in this invention was expressed in Expi293F cells using a mammalian expression system. 750 mL of Expi293F cells were naturally grown to a density of 3 × 10⁻⁶ cells / cell. 6 When the protein expression rate reaches 100 μg / mL, prepare for transfection. Add 750 µg of Fab plasmid containing both the light and heavy chains (see "Structural basis of psychedelic LSD recognition atdopamine D1 receptor") to 50 mL of Yonglian medium, then add 3 mL of 1 g / L PEI transfection reagent and mix thoroughly. Let stand for 30 minutes. Add 50 mL of the transfection system to Expi293F cells. To increase expression levels, add 4 mL of 400 mM sodium valproate to a final concentration of 2 mM. Incubate at 37 °C with shaking for 72 hours to allow for adequate protein expression.
[0042] Fab_8D3_2 protein was purified using nickel column affinity chromatography. The supernatant from Expi293F cells expressing the protein was adjusted to pH 7.4 with 25 mM HEPES and then incubated with equilibrated Ni-NTA resin at 4°C for 6 hours via rotation. After washing with 20 mM imidazole buffer, the target protein was eluted with 300 mM imidazole buffer. SDS-PAGE electrophoresis confirmed the presence of a single target band, indicating the acquisition of high-purity Fab_8D3_2 protein, which was then aliquoted and stored at -80°C for later use.
[0043] 7.2 MBP Protein Expression and Purification This invention employs the following method to express and purify MBP_PrA / G protein. The MBP_PrA / G gene with a 6×His tag at the N-terminus was cloned into the pET22b vector (see "Structural basis of psychedelic LSD recognition atdopamine D1 receptor"), transformed into BL21(DE3) Codon Plus competent cells, and collected after IPTG induction. The cells were sonicated on ice with resuspension buffer containing 20 mM imidazole, centrifuged at 20,000 rpm, and the supernatant was incubated overnight at 4°C on a nickel column. The cells were then treated sequentially with wash buffer containing 20 mM imidazole and elution buffer containing 200 mM imidazole to obtain crude purified protein. The crude purified protein was concentrated using a 10 kDa ultrafiltration tube and then purified by molecular sieving using a Superdex 75 Increase 10 / 300 GL column. The mobile phase was 25 mM HEPES (pH 7.4) and 150 mM NaCl, with a flow rate of 0.5 mL / min. The elution peak at 56 kDa (approximately 10 mL) was collected. After verifying the molecular weight and purity by SDS-PAGE, 5% glycerol was added, and the mixture was aliquoted and flash-frozen in liquid nitrogen at -80°C. The entire process ensured the acquisition of high-purity, highly homogeneous MBP_PrA / G protein by controlling the induction conditions, buffer composition, and chromatographic parameters.
[0044] BL21(DE3) Codon Plus competent cells were purchased from Weidi Biotechnology.
[0045] Example 1 This embodiment provides a method for detecting point mutations that improves the thermal stability of G protein-coupled receptors (GPCRs). The procedure is as follows: Figure 1 As shown, the specific steps include the following: 1. Engineering modification of GPCR In the G protein-coupled receptor (GPCR), the third intracellular loop (ICL3) segment between the fifth transmembrane helix (TM5) and the sixth transmembrane helix (TM6) was selected and replaced with the third intracellular loop sequence of the kappa opioid receptor (KOR). Simultaneously, a SmBiT peptide tag (VTGYRLFEEIL) was attached to the C-terminus of the GPCR via the SGGGGS flexible linker peptide shown in SEQ ID NO.14. The amino acid and nucleotide sequences of the resulting modified GPCR were obtained.
[0046] 2. Obtaining G protein-coupled receptors containing the thermostability mutation sites to be tested 2.1 Recombinant expression plasmids of G protein-coupled receptors containing mutation sites for thermostability testing Based on the thermostable mutation sites in the GPCRs to be tested, point mutations were performed at corresponding sites in the nucleotide sequence of the modified GPCRs from step 1. The point mutations were introduced using polymerase chain reaction (PCR) site-directed mutagenesis. An unmutated wild-type was also included. The nucleotide sequences of the modified GPCRs from both wild-type and mutant types were inserted into the expression plasmid to construct the recombinant expression plasmid. (1) PCR amplification The PCR reaction system consisted of 0.5 μL of 50 ng / μL template, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 5 μL of 2×PrimeStar Mix (Takara), and 5 μL of ddH2O. The reaction program was as follows: preheating at 98 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 58 °C for 15 s, extension at 72 °C for 2 min (5–10 s / kb, depending on the length of the amplified fragment), repeated for 35 cycles; and final extension at 72 °C for 10 min.
[0047] (2) DpnI digestion template PCR products were treated with 0.5 μL of DpnI enzyme at 37 °C for 3 hours to completely digest the template.
[0048] (3) Transformation The digested product was added to 30 μL of TOP10 competent cells (Weidi Biotechnology), incubated on ice for 30 minutes, followed by heat shock at 42 °C for 90 seconds. The cells were then rapidly transferred to ice and incubated for 3 minutes. 500 μL of antibiotic-free LB medium was added, and the cells were incubated at 37 °C for 2 hours. The precipitate was collected, plated on plates containing specific antibiotics, and incubated overnight at 37 °C. The next day, single clones were picked, cultured, and sequenced. Plasmids were extracted from correctly sequenced clones using the Tiangen Plasmid Mini-Prep Kit for later use.
[0049] 2.2 Transfection and expression of recombinant expression plasmids The recombinant expression plasmids obtained in step 2.1 were transfected into 293T cells with a confluence of 50%-70%, using the transfection method described in "3. HEK293T cell transfection" above. The cells were then cultured at 37°C and 5% CO2 for 48 hours to allow for full expression of the target protein. Using a 6 cm diameter culture dish as an example, after protein expression, the culture medium was aspirated, and the cells were washed once with 1×PBS buffer. 3 mL of pre-chilled lysis buffer (1 mM HEPES, 2 mM EDTA, pH 7.4) was added, and the cells were incubated at 4°C for 10 minutes to allow cell detachment. The cell suspension was collected, centrifuged at 5000 rpm for 5 minutes at 4°C, and the supernatant was discarded. The cell pellet was transferred to a tissue homogenizer, and 3 mL of lysis buffer was added to homogenize the cells thoroughly until complete lysis. The centrifugation and grinding steps were repeated twice. The precipitate was collected and resuspended in lysis buffer. After aliquoting, it was centrifuged at 4°C and 15,000 rpm for 5 minutes. The resulting precipitate was the cell membrane component containing the target receptor (G protein-coupled receptor with a thermostability mutation site to be tested). The obtained cell membrane component was extracted according to the aforementioned "4. Extraction of cell membrane proteins containing specific point-mutated receptors" to obtain membrane protein samples containing the target receptor.
[0050] 3. Heat treatment Taking the membrane protein sample extracted from cells cultured in a 6 cm diameter culture dish in step 2 as an example, firstly, resuspend the membrane pellet in 3 mL of 1×PBS buffer (concentration 0.1 mg / mL~1 mg / mL, total amount 0.3 mg~3 mg, approximately 1 mL for each experiment, i.e., approximately 0.1 mg~1 mg). After thorough mixing, aliquot the sample into 12 0.2 mL PCR tubes, 80 μL per tube. Store the remaining sample at -80℃ for later use. Set the PCR instrument temperature program to 25℃ for preheating for 3 minutes, then increase the temperature to the set temperature at a rate of 2℃ / min, setting 12 temperature gradients, ranging from 30-75℃, with an interval of approximately 4.5℃. Maintain the target temperature for 30 minutes, then cool at 10℃ for 10 minutes. After the reaction is complete, transfer 30 μL of the sample from each temperature treatment to two adjacent wells in a Beyotime all-white 96-well plate to ensure minimal cross-contamination between wells. Dispose of the remaining sample as biological waste.
[0051] 4. Preparation of Nb6-LgBiT complex.
[0052] 4.1 Nb6-LgBiT recombinant plasmid The C-terminus of the Nb6 amino acid sequence was linked to the LgBiT protein via the SGGGGS flexible linker peptide shown in SEQ ID NO.14, yielding the Nb6-LgBiT complex, whose amino acid sequence is SEQ ID NO.2 (positions 1-119 are the Nb6 amino acid sequence, and positions 126-184 are the LgBiT protein amino acid sequence), and whose nucleotide sequence is shown in SEQ ID NO.4. The nucleotide sequence of the Nb6-LgBiT complex was cloned into the pET15b vector (purchased from Qingke Biotechnology), which contains an N-terminal T7, a pel B secretion signal peptide (MKYLLPTAAAGLLLLAAQPAMA), and a 6×His purification tag. The method is as follows: (1) PCR amplification Nb6-LgBiT insert amplification: The PCR reaction system consisted of 1 μL of 50 ng / μL template, 0.5 μL of 10 μM upstream primer (SEQ ID NO.15: CAGGTGCAGCTGCAGGAG), 0.5 μL of 10 μM downstream primer (SEQ ID NO.16: ACTGTTGATGGTTACTCGGAACAG), 25 μL of 2×PrimeStar Mix (Takara), and 25 μL of ddH2O. The reaction program was as follows: preheating at 98 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 58 °C for 15 s, extension at 72 °C for 2 min (5–10 s / kb, depending on the length of the amplified fragment), repeated for 35 cycles; and final extension at 72 °C for 10 min.
[0053] amplification of the pET15b vector fragment: The PCR reaction system included 1 μL of template at a concentration of 50 ng / μL, 0.5 μL of 10 μM upstream primer (SEQ ID NO.17: ACCATCAACAGTTAAggatccggctgctaac), 0.5 μL of 10 μM downstream primer (SEQ ID NO.18: CAGCTGCACCTGtgattggaagtagaggttctcg), 25 μL of 2×PrimeStar Mix (Takara), and 25 μL of ddH2O. The reaction program was as follows: preheating at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 s, annealing at 58 ℃ for 15 s, extension at 72 ℃ for 2 min (5–10 s / kb, depending on the length of the amplified fragment), repeated for 35 cycles; and a final extension at 72 ℃ for 10 min.
[0054] (2) Homologous recombination PCR products were subjected to agarose gel electrophoresis. The target band was cut and the target fragment was recovered using a Tiangen gel recovery kit. The vector fragment and the insert fragment were mixed in 5 μL of 2×MutiF Seamless Assembly Mix (abclonal) at a molar ratio of 1:2 and reacted at 50 °C for 30 minutes to ensure complete recombination and ligation.
[0055] (3) Transformation The digested product was added to 30 μL of TOP10 competent cells (Weidi Biotechnology), incubated on ice for 30 minutes, followed by heat shock at 42 °C for 90 seconds. The cells were then rapidly transferred to ice and incubated for 3 minutes. 500 μL of antibiotic-free LB medium was added, and the cells were incubated at 37 °C for 2 hours. The precipitate was collected, plated on plates containing specific antibiotics, and incubated overnight at 37 °C. The next day, single clones were picked, cultured, and sequenced. Plasmids were extracted from correctly sequenced clones using the Tiangen Plasmid Mini-Prep Kit for later use.
[0056] 4.2 Transfection and expression of the Nb6-LgBiT recombinant plasmid After transforming the Nb6-LgBiT recombinant plasmid from step 4.1 into BL21(DE3) Codon Plus competent cells, the cells were seeded in LB medium containing 100 μg / mL carbenicillin, with the addition of 0.2% glucose and 5 mM MgSO4, and cultured at 37°C with shaking until OD. 600 At a concentration of 0.8, 500 μM IPTG was added, and expression was induced at 20°C for 20 hours. After centrifugation at 4°C, cells were collected. Each 1 L of cells was homogenized and resuspended in 12.5 mL of TES buffer (0.2 M Tris-HCl pH 8.0, 5 mM EDTA, 0.5 M sucrose, 1× protease inhibitor) using a tissue homogenizer, and incubated at 4°C for 1 hour. Subsequently, 3 volumes of ddH2O were added for swelling for 45 minutes, followed by centrifugation at 15000 rpm for 30 minutes to collect the supernatant. A nickel column was added to the supernatant, and MgCl2 was added to a final concentration of 10 mM, and NaCl to a final concentration of 100 mM. The column was incubated overnight at 4°C. The next day, after washing with 20 mM imidazole buffer, the target protein was eluted with 300 mM imidazole buffer. SDS-PAGE electrophoresis confirmed a single target band, indicating the acquisition of high-purity Nb6-LgBiT protein. The protein was aliquoted and stored at -80°C for later use.
[0057] 5. Signal detection and analysis Add 10 μL of 1×PBS reaction buffer containing 400 nM Nb6-LgBiT to each well of the 96-well plate in step 3 (formulation: 8 g NaCl, 0.2 g KCl, 3.5 g Na2HPO4·12H2O and 0.24 g KH2PO4, dissolved in double-distilled water, adjusted to pH 7.4, and brought to a final volume of 1 L). Incubate at room temperature (25 °C) for 20 minutes to form the SmBiT-LgBiT complementary luminescence system (in subsequent detection of chemiluminescence signal, a reading greater than 10000 is considered to indicate interaction). Then add 10 μL of 1×PBS detection buffer containing 10 μM coelentrin h to each well (formulation: 8 g NaCl, 0.2 g KCl, 3.5 g Na2HPO4·12H2O and 0.24 g KH2PO4, dissolved in double-distilled water, adjusted to pH 7.4, and brought to a final volume of 1 L). The chemiluminescence signal was immediately detected using a multi-functional microplate reader with no excitation wavelength, an emission wavelength of 460±20 nm, an integration time of 0.1 seconds / well, and an automatically optimized gain value. After exporting the raw data, the chemiluminescence signals corresponding to samples treated at different temperatures were substituted into GraphPad Prism 10.3.0 software to calculate the Tg of wild-type and various mutant GPCRs. m Value, filtering compared to wild type T m The effective thermal stability mutation with improved value.
[0058] Example 2: Validation of the method of the present invention in GPCRs with known thermal stability point mutations. To verify the universality and reliability of the method of this invention, this embodiment selected three typical receptors with known thermostable point mutations in Class A GPCRs for systematic validation. These three typical receptors showed increased T compared to wild-type. m Value. The three typical receptors are as follows: dopamine D2 receptor (DRD2), serotonin 2A receptor (5-HT2A), and serotonin 2A receptor (5-HT2A). 2A R) and adenosine A 2A receptor (A) 2A The three typical receptors for R are as follows: DRD2-K-3M: For those with I122 3.40 A (isoleucine I at position 122 is mutated to alanine, 3.40 is the GPCR number for ballesteros-weinstein), L375 6.37 A (leucine L at position 137 is mutated to alanine A, 6.37 is the GPCR number for ballesteros-weinstein) and L379 6.41 A thermostable mutant with a point mutation (leucine L at position 379 is mutated to alanine A, and 6.41 is the GPCR number of ballesteros-weinstein).
[0059] 5-HT 2A RK-2M: Features L247 5.51 A (leucine L at position 247 is mutated to alanine A, 5.51 is the GPCR number for ballesteros-weinstein) and L371 7.43 A thermostable mutant with a point mutation (leucine L at position 371 is mutated to alanine A, and 7.43 is the GPCR number of ballesteros-weinstein).
[0060] A 2A RK-4M: Features A54 2.52 L (alanine A at position 54 is mutated to leucine L, 2.52 is the GPCR number for ballesteros-weinstein), T88 3.36 A (the threonine T mutation at position 88 is replaced by alanine A, and 3.36 is the GPCR number for ballesteros-weinstein), K122 4.43 A (the 122nd lysine K is mutated to alanine A, 4.43 is the GPCR number for ballesteros-weinstein) and V239 6.41 A thermostable mutant with a point mutation (valine V at position 239 is mutated to alanine A, and 6.41 is the GPCR number for ballesteros-weinstein).
[0061] Implemented according to the method in Example 1, with the difference being: In step 2.1: The amino acid sequence of the modified GPCR corresponding to the thermostability mutation site in DRD2-K-3M is SEQ ID NO.4, where positions 217-233 are the substituted third intracellular loop sequence of the kappa opioid receptor. The corresponding thermostability mutation sites are positions 122, 239, and 243, and their nucleotide sequences are shown in SEQ ID NO.5. The corresponding PCR amplification primers are: DRD2-I122 3.40 AF:GCTTCAGCATTGAACCTCTGTGCCATC (SEQ ID NO. 19); DRD2-I122 3.40 AR: TTCAATGCTGAAGCCGTACACATCATAA (SEQ ID NO. 20); DRD2-L375 6.37 A-L379 6.41 AF: CAAATGGCGGCCATTGTAGCCGGGGTGTTCATCATTTGTT (SEQ ID NO. 21); DRD2-L375 6.37 A-L379 6.41 AR: ACCCCGGCTACAATGGCCGCCATTTGGGTGGCCTTGC (SEQ ID NO.22), the nucleotide sequence of the obtained recombinant expression plasmid is shown in SEQ ID NO.43: Corresponding to 5-HT 2A The thermostable mutation site in RK-2M, and the amino acid sequence of the modified GPCR of the mutant form, are shown in SEQ ID NO. 6. Positions 264-292 are the substituted third intracellular loop sequence of the kappa opioid receptor (upstream including the N-terminus of ICL3, i.e., the TM5 portion, and downstream including the C-terminus of ICL3, i.e., the TM6 portion). The corresponding thermostable mutation sites are positions 247 and 330, and their nucleotide sequences are shown in SEQ ID NO. 7. The corresponding PCR amplification primers are: 5-HT 2A R-L247 5.51 AF: ATTCCTGCTACCATTATGGTGATCAC (SEQ ID NO. 23); 5-HT 2A R-L247 5.51 AR: AATGGTAGCAGGAATGAAGAAGGAC (SEQ ID NO. 24); 5-HT 2A R-L371 7.43 AF: GGATATGCGTCCTCAGCTGTG (SEQ ID NO. 25); 5-HT 2A R-L371 7.43 AR: TGAGGACGCATATCCGATCCATAC (SEQ ID NO. 26).
[0062] Corresponding to A 2A The thermostable mutation sites in RK-4M, and the amino acid sequence of the modified GPCR of the mutant form, are shown in SEQ ID NO. 8. Positions 204-221 represent the substituted third intracellular loop sequence of the kappa opioid receptor. The corresponding thermostable mutation sites are positions 54, 88, 122, and 231, and their nucleotide sequences are shown in SEQ ID NO. 9. The corresponding PCR amplification primers are: A 2A R-A54 2.52 LF: GACATTTTAGTAGGGGTGC (SEQ ID NO. 27); A 2A R-A54 2.52 LR: CCCTACTAAAATGTCAGCC (SEQ ID NO. 28); A 2A R-T88 3.36 AF: GTTCTGGCACAGTCTAGCATCTTCAG (SEQ ID NO. 29); A 2A R-T88 3.36 AR: AGACTGTGCCAGAACGAGGACG (SEQ ID NO.30); A 2A R-K122 4.43 AF: CGCGCCGCAGGAATCATTGC (SEQ ID NO. 31); A 2A R-K122 4.43 AR: GATTCCTGCGGCCGTGTC (SEQ ID NO.32); A 2A R-V239 6.41 AF: ATTATTGCAGGCCTTTTCGCCTTG (SEQ ID NO.33); A 2A R-V239 6.41 AR: AAGGCCTGCAATAATGGCCAGAC (SEQ ID NO. 34).
[0063] In step 3, thermal stability testing, a uniform temperature gradient (30.0 ℃, 35.1 ℃, 38.1 ℃, 40.0 ℃, 41.9 ℃, 43.0 ℃, 45.0 ℃, 46.8 ℃, 49.5 ℃, 52.8 ℃, 52.7 ℃ and 65.0 ℃) was used in the experiment.
[0064] The results are as follows: In the validation of DRD2, the thermostable mutant DRD2-K-3M showed a higher T than the wild-type DRD2-K. m The value increased by 3.2℃, T m The higher the temperature, the stronger its stability. Similar to the results of the detection method used in previous articles, this mutation site can increase T. mThe value can improve thermal stability and can be used to qualitatively detect the thermal stability of mutants, as shown in Table 1 and... Figure 2 As shown in Figure A, DRD2 is the wild-type DRD2 without the third intracellular loop sequence substitution modification of the kappa opioid receptor (after step 1 SmBiT peptide substitution, without kappa substitution, and without step 2 treatment, serving as a negative control). DRD2-K is the wild-type DRD2 modified in step 1 (including SmBiT peptide substitution and kappa substitution), but without the mutation in step 2. The T-values of the wild-type DRD2 without the third intracellular loop sequence substitution modification of the kappa opioid receptor and the modified but unmutated wild-type DRD2-K can be observed. m The values are similar or not significantly different, meaning that the substitution of the third intracellular loop sequence of the kappa opioid receptor in step 1 does not significantly increase T. m value.
[0065] In 5-HT 2A In the verification of R, the thermostability mutant of point mutation (5-HT) 2A RK-2M is more similar to the wild type (5-HT) 2A RK) T m The value increased significantly by 12.12℃, similar to the results obtained using the detection method used in previous articles. This mutation site can increase T... m The value can improve thermal stability and can be used to qualitatively detect the thermal stability of mutants, as shown in Table 1 and... Figure 2 As shown in Figure B, 5-HT 2A R represents wild-type cells that have not undergone third intracellular loop sequence substitution modification of the kappa opioid receptor (treated with SmBiT peptide in step 1, without kappa substitution, and without treatment in step 2, serving as a negative control group), 5-HT 2A RK was modified in step 1 (including SmBiT peptide replacement and kappa replacement), but not in step 2 (mutation). Unmodified wild-type 5-HT can be observed. 2A R and modified, unmutated wild-type 5-HT 2A RK's T m The values are similar or not significantly different, meaning that the modification in step 1 does not significantly improve T. m value).
[0066] In A 2A In the verification of R, the thermal stability mutant (A) 2A RK-4M) is more wild-type (A) 2A RK) T m The value also increased by 5.82℃, similar to the results obtained using the detection method in previous articles. This mutation site can increase T... mThe value can improve thermal stability and can be used to qualitatively detect the thermal stability of mutants, as shown in Table 1 and... Figure 2 As shown in C, A in the figure 2A R represents wild-type cells that have not undergone third intracellular loop sequence substitution modification of the kappa opioid receptor (treated with SmBiT peptide substitution in step 1, without kappa substitution, and without treatment in step 2, serving as a negative control group), A 2A RK represents the modified product that underwent step 1 treatment (including SmBiT peptide replacement and kappa replacement), but did not undergo the mutation in step 2. Unmodified wild-type A can be observed. 2A R and the modified, unmutated wild-type A 2A RK's T m The values differ slightly, but this does not affect the results of the modified, unmutated wild-type A. 2A RK and thermally stable mutants (A) 2A The comparison of RK-4M still allows for the comparison of thermostable mutants (A). 2A RK-4M) T m The value was significantly higher than that of wild-type A. 2A RK can be used to qualitatively test its thermal stability.
[0067] The above experimental results demonstrate that the method of the present invention can qualitatively detect different GPCR subtypes (including DRD2, 5-HT). 2A R and A 2A R) Changes in the thermal stability of the mutant, and the measured T of the mutant. m The temperature was 3.2-12.12℃ higher than that of the wild type. This result not only confirms the ability of this method to detect differences in receptor thermal stability, but also demonstrates its wide applicability and reliability in GPCR thermal stability studies.
[0068] Table 1. Validation of the thermal stability point mutation screening method in GPCR.
[0069] Example 3: Screening for thermostable point mutations in orphan receptor GPR151 using the method of the present invention. GPCRs play a crucial role in drug development. They are widely distributed in the central nervous system and are closely associated with various mental illnesses. Among these receptors, orphan receptors occupy an important position and are considered a class of potential drug targets. GPR151, as an orphan receptor, has a specific distribution in the habenula, the brain's "anti-reward center," suggesting its potential association with mental illnesses, particularly depressive symptoms. However, this receptor lacks known ligands and downstream signaling molecules, resulting in highly dynamic conformational instability, which severely hinders structural analysis and drug development. To address this technical bottleneck, the method of this invention is applied to the structural stabilization study of GPR151. Specifically: Implemented according to Example 1, with the following difference: In step 1, the F222 of GPR151... 5.58 -ICL3-S254 6.39 The section was replaced with KOR's F222. 5.58 -ICL3-S254 6.39 The segment was modified and a SmBiT tag was fused to its C-terminus. The resulting amino acid sequence of the modified GPR151 is shown in SEQ ID NO. 10, where positions 222-253 are the substituted third intracellular loop sequence of the kappa opioid receptor (i.e., F222 of KOR). 5.58 -ICL3-S254 6.39 (segment), and nucleotide sequence as shown in SEQ ID NO.11.
[0070] In step 2.1, based on structural bioinformatics analysis, the single-point mutations screened are shown in Table 2 below, such as the mutant GPR151-K L127. 3.41 W / S300 7.47 A is L127 3.41 W (leucine L at position 127 is mutated to tryptophan W, 3.41 is the GPCR number for ballesteros-weinstein) and S300 7.47 Two single-point mutations, A (serine S at position 300 is mutated to alanine A, and 7.47 is the GPCR number for ballesteros-weinstein), and so on. The amino acid sequence of the modified GPCR is SEQ ID NO.12, where positions 222-253 are the substituted third intracellular loop sequence of the kappa opioid receptor (i.e., F222 of KOR). 5.58 -ICL3-S254 6.39 The corresponding thermostable mutation sites for screening are positions 127 and 300, and their nucleotide sequences are shown in SEQ ID NO. 13. The corresponding PCR amplification primers are: GPR151 L127. 3.41WF (AAGTCCTGGACAATCGTGGTCGTGGC, see SEQ ID NO.35), GPR151 L127 3.41 WR (ATTGTCCAGGACTTTGCGGCCATACAG, see SEQ ID NO.36), GPR151 S300 7.47 AF (ATCTCCGCTGCCAATCCCCTGATCTT, see SEQ ID NO.37) and GPR151 S300 7.47 AR (TTGGCAGCGGAGATAGAGAACATCAGGAC, see SEQ ID NO.38).
[0071] In step 3, thermal stability testing, the gradient temperatures are (30.0 ℃, 32.0 ℃, 36.2 ℃, 39.3 ℃, 44.9 ℃, 49.8 ℃, 51.9 ℃, 54.0 ℃, 57.0 ℃, 62.5 ℃, 66.4 ℃ and 72.0 ℃).
[0072] The results are as follows: As shown in Table 2 and Figure 3 As can be seen, L127 3.41 W or S300 7.47 Both point mutations significantly improve receptor thermal stability. Furthermore, the constructed GPR151-K L127... 3.41 W / S300 7.47 A double mutant exhibited superior stabilization. Subsequently, referring to known stable sites described in the GPCR thermal stability point mutation database (GPCRdb), the GPR151-KL127... 3.41 W / S300 7.47 Based on A (abbreviated as GPR151-K-2M), point mutations were randomly introduced, and the optimal mutation combination GPR151-KL127 was finally obtained by screening using the thermal stability point mutation screening method of this invention. 3.41 W / S300 7.47 A / S86 2.52 L / S200 5.36 A (abbreviated as GPR151-K-4M). Experimental data show that this four-mutation combination causes the T of GPR151 to... m The value increased by 7.3℃ (Table 2, Figure 3 The successful resolution of the structural instability challenge of this important orphan receptor (A and B) lays a solid foundation for subsequent cryo-electron microscopy structural analysis and drug development, such as antidepressants. This achievement not only validates the applicability of this method in orphan receptor research but also provides important technical reference for the structural study of similar difficult-to-analyze GPCRs.
[0073] Table 2 Screening for thermostability point mutations in orphan receptor GPR151
[0074] NA indicates that it was not detected.
[0075] Example 4: Determination of the auxiliary structure of thermostable point mutations in the screened orphan receptor GPR151 Structural analysis of the orphan receptor GPR151 has long been limited by conformational instability and purification difficulties caused by the lack of known ligands and downstream signaling molecules. To overcome this technical bottleneck, the mutant combination GPR151-K-4M (L127), which exhibits the best thermostability as screened in Example 3, can be used. 3.41 W / S300 7.47 A / S86 2.52 L / S200 5.38 A).
[0076] 1. Structural stability of GPR151-K-4M after expression and purification 1.1 Construction of GPR151-K-4M recombinant plasmid (pFastbacI recombinant plasmid) The method is as follows: (1) PCR amplification GPR151-K-4M insert amplification: The PCR reaction system included 1 μL of 50 ng / μL template, 0.5 μL of 10 μM upstream primer (ATGTTGGCCGCCGCATTT, see SEQ ID NO.39), 0.5 μL of 10 μM downstream primer (CTTCACTCCTTCTCCAGTTTCTTGG, see SEQ ID NO.40), 25 μL of 2×PrimeStar Mix (Takara), and 25 μL of ddH2O. The reaction program was as follows: preheating at 98 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 58 °C for 15 s, extension at 72 °C for 2 min (5–10 s / kb, depending on the length of the amplified fragment), repeated for 35 cycles; and final extension at 72 °C for 10 min.
[0077] amplification of the pFastbacI vector (Qingke Biotechnology) fragment: The PCR reaction system included 1 μL of template at a concentration of 50 ng / μL, 0.5 μL of 10 μM upstream primer (GAAGGAGTGAAGCAGGTGCAGCTGCAGG, see SEQ ID NO. 41), 0.5 μL of 10 μM downstream primer (ACTGCCGCCTCCTCCGCT, see SEQ ID NO. 42), 25 μL of 2×PrimeStar Mix (Takara), and 25 μL of ddH2O. The reaction program was as follows: preheating at 98 ℃ for 3 min; denaturation at 98 ℃ for 10 s, annealing at 58 ℃ for 15 s, extension at 72 ℃ for 2 min (5–10 s / kb, depending on the length of the amplified fragment), repeated for 35 cycles; and a final extension at 72 ℃ for 10 min.
[0078] (2) Homologous recombination The PCR products were subjected to agarose gel electrophoresis. The target band was cut and the target fragment was recovered using a Tiangen gel extraction kit. The vector fragment and the insert fragment were mixed in 5 μL of 2×MutiF Seamless Assembly Mix (abclonal) at a molar ratio of 1:2 and reacted at 50 °C for 30 minutes to ensure complete recombination and ligation.
[0079] (3) Transformation The digested product was added to 30 μL of TOP10 competent cells (Weidi Biotechnology), incubated on ice for 30 minutes, followed by heat shock at 42 °C for 90 seconds, then rapidly transferred to ice and incubated for 3 minutes. 500 μL of antibiotic-free LB medium was added, and the cells were incubated at 37 °C for 2 hours. The precipitate was then collected, plated on plates containing specific antibiotics, and incubated overnight at 37 °C. The next day, single clones were picked, cultured, and sequenced. Plasmids were extracted from correctly sequenced clones using the Tiangen Plasmid Mini-Prep Kit. The sequence of the recombinant plasmid is shown in SEQ ID NO. 44 and is reserved for later use.
[0080] 1.2 Preparation of GPR151 Baculovirus First, 100 ng of the constructed pFastbacI recombinant plasmid was transformed into DH10Bac competent cells. The transformation method was as follows: after incubation on ice for 30 minutes, heat shock at 42℃ for 90 seconds, and recovery culture, the cells were plated on LB plates containing kanamycin (50 μg / mL), tetracycline (10 μg / mL), gentamicin (7 μg / mL), IPTG (isopropyl-β-D-thiogalactopyranoside, 40 μg / mL), and Bluo-gal (5-bromo-3-indolyl-β-D-pyranoside, 100 μg / mL). After incubation at 37℃ for 20 hours, white clones were picked for amplification culture. Baculovirus particles (referred to as baculovirus particles) were extracted using the isopropanol precipitation method. Specifically, after bacterial cells were lysed using a kit, the supernatant was collected, and an equal volume of isopropanol was added for precipitation at -20°C for 3 hours. The precipitate was then washed with 70% ethanol and dissolved in 30 μL ddH2O. Subsequently, the extracted baculovirus particles were transfected into Sf9 cells for virus packaging: 0.5 × 10⁻⁶ baculovirus particles were added to 0.5 × 10⁻⁶ cells. 6 Sf9 cells were seeded at a density of 1 mL / well in 12-well plates. After replacing the medium with SF900 III (commercially available), rod particles and Cellfectin II (commercially available) transfection complex (50 μL medium + 10 μL rod particles + 3 μL transfection reagent) were added. The plates were incubated at 27 °C. After 4 days, the supernatant from the P0 generation was collected to infect 50 mL of 3×10⁶ cells / well. 6 Sf9 cells were infected with P1 generation virus at a concentration of / mL for 72 hours. To determine the viral titer, P1 generation virus was serially diluted and used to infect Sf9 cells in 96-well plates. After 18 hours, the cells were stained with commercially available GP64-PE antibody, and the viral titer was calculated by flow cytometry to determine the positive rate. Qualified virus (titer ≥1×10⁻⁶) was selected. 9 The virus was aliquoted (IU / mL) and stored at -80℃ for later use. All parameters were strictly controlled throughout the process, including key indicators such as culture temperature (27℃), time points, and cell density, to ensure the quality and efficiency of virus preparation.
[0081] 1.3 Expression and purification of GPR151 protein sf9 cells grew to a density of 3×10⁻⁶ 6 When the cell count is 1 / mL, select high-titer P1 virus to infect cells at an MOI of 5. After incubating the infected cells in a shaker at 27 °C for 48 hours, centrifuge at 8000 rpm for 5 minutes to collect the precipitate and store it at -80 °C for later use.
[0082] 2 L of Sf9 cell pellet thawed at room temperature was washed with low-salt buffer (10 mM HEPES, pH 7.4, 10 mM MgCl2, 20 mM KCl, 1× protease inhibitor; stock solution formulation: 5 g AEBSF (serine protease inhibitor), 15 mg E-64 protease inhibitor, 20 mg leuprolide, and 41 mg aprotinin, dissolved in double-distilled water and brought to a final volume of 42 mL; this stock solution was used after 1000× dilution). The pellet was then collected by centrifugation at 40,000 g. Subsequently, it was washed three times with high-salt buffer (1.0 M NaCl, 10 mM HEPES, pH 7.4, 10 mM MgCl2, 20 mM KCl, 1× protease inhibitor) to obtain the protein-expressing cell membrane. The membrane pellet was then resuspended in resuspension buffer (10 mM HEPES, pH 7.4, 10 mM MgCl2, 20 mM KCl, 1× protease inhibitor). After resuspending thoroughly in KCl, 150 mM NaCl, 10 µM aripiprazole, and 1× protease inhibitor, extract by rotary extraction at 4°C for 2 hours in extraction buffer containing 2% (w / v) LMNG (neopentyl lauryl maltose) / 0.4% (w / v) CHS (cholesterol hemisuccinate). After centrifugation at 36,000 rpm, the supernatant was incubated overnight at 4°C with a cobalt column (TALON IMACresin) in 800 mM NaCl and 20 mM imidazole. The next day, the solution was washed sequentially with wash buffer containing 20 mM imidazole (50 mM HEPES, pH 7.4, 500 mM NaCl, 0.05% (w / v) LMNG, 0.01% (w / v) CHS, 20 mM imidazole, 10% glycerol) and imidazole-free buffer (50 mM HEPES, pH 7.4, 500 mM NaCl, 0.05%...). After washing with (w / v) LMNG, 0.01% (w / v) CHS, 10% glycerol, the target protein was eluted with an elution buffer containing 250 mM imidazole (50 mM MEPES, pH 7.4, 100 mM NaCl, 0.01% (w / v) LMNG, 0.002% (w / v) CHS, 250 mM imidazole, 10% glycerol). The protein was concentrated to 500 μL and then desalted using a column with replacement buffer. TEV enzyme and PNGase F4℃ were added and the protein was digested overnight to remove the His tag and glycosylation modifications. The homogeneity and concentration of the purified protein were determined by HPLC, and the final concentration was concentrated to 20 mg / mL for later use. The entire process strictly controlled parameters such as buffer composition, centrifugation conditions, and temperature to ensure high purity and high concentration of the target membrane protein.
[0083] Purification results are as follows Figure 4As shown in Figure A, it can be concluded that neither the wild-type GPR151 (without modification and mutation in steps 1 and 2) nor the modified wild-type GPR151-K-NB6 (modified in step 1, without mutation in step 2) yielded purified protein. However, the GPR151-K-4M screened in this invention exhibited significantly improved stability in the insect cell (Sf9) expression system. After extraction with MNG detergent (containing 2% (m / v) LMNG (lauryl maltose neopentyl glycol) / 0.4% (m / v) CHS (cholesterol hemisuccinate)), it still maintained structural integrity, successfully overcoming the technical obstacle of purifying wild-type GPR151. This indicates that the mutant GPR151-K-4M with high thermal stability was indeed screened in Example 3.
[0084] 2. Cryo-electron microscopy structural analysis of GPR151-K-4M 2.1 Assembly of GPR151-Legobody The purified GPR151-K-4M, MBP_PrA / G, and Fab_8D3_2 were mixed together in a molar ratio of 1:1.5:1.6. Maltose was added to a final concentration of 2 mM, and the mixture was incubated at 4°C in a rotary incubator for 2 hours to allow for complete binding. The protein mixture was then subjected to rapid liquid chromatography (FPLC) using a Superdex 200 Increase 10 / 300 GL column. The elution program was 0.5 mL / min, collecting 6-18 mL of sample. The column temperature was 4°C, the detection wavelength was UV 280 nm, and the mobile phase was 25 mM HEPES pH 7.4, 100 mM NaCl, 0.00075% (w / v) LMNG, and 0.00015% (w / v) CHS. The peak containing the GPR151-Legobody complex (approximately 11 mL) was collected. Figure 4 (B) SDS-PAGE electrophoresis was performed to confirm the presence of all protein components. The GPR151-Legobody complex was concentrated to approximately 15 mg / mL for cryo-electron microscopy sample preparation. Protein concentration was determined by measuring the absorbance of the protein sample at 280 nm using a Nanodrop 2000 spectrophotometer.
[0085] 2.2 Sample preparation, data collection and processing for Cryo-EM After cryogenic preparation, 300 kV Cryo-EM data were collected from the GPR151-Legobody complex sample using SerialEM. Following 2D sorting and 3D classification, model calculations and optimizations were performed to determine its structure.
[0086] The results are as follows Figure 4In Figure C, a structural model of GPR151 (pink represents GPR151, and blue represents the Legobody complex) was obtained through cryo-electron microscopy, successfully achieving a three-dimensional structure of GPR151 with a resolution of 3.1 Å. This groundbreaking achievement confirms for the first time that the thermostable mutant GPR151-K-4M was indeed screened in Example 3 of this invention, which can effectively stabilize difficult-to-resolve orphan GPCRs, providing a key template for structure-based drug design and a referable technical paradigm for the structural resolution of similar orphan receptors.
[0087] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A method for screening thermostability mutation sites in G protein-coupled receptors, characterized in that, include: S1. Replace the entire third intracellular loop segment in the wild-type G protein-coupled receptor with the third intracellular loop sequence of the kappa opioid receptor. The wild-type G protein-coupled receptor was tagged with an SmBiT peptide; S2. Mutate the wild-type G protein-coupled receptor described in step S1 according to the mutation sites in the mutant of the G protein-coupled receptor to be tested. S3. After processing step S2, the modified G protein-coupled receptor mutant is obtained. The modified G protein-coupled receptor mutant was incubated at different temperatures to obtain modified G protein-coupled receptor samples treated at different temperatures. S4. The modified G protein-coupled receptor samples treated at different temperatures were mixed and incubated with nanobodies and LgBiT complexes, and then luciferase substrate was added for detection.
2. The method for screening thermostability mutation sites of G protein-coupled receptors according to claim 1, characterized in that, In step S1, the method further includes replacing 5-12 amino acids in the TM5 segment upstream of the third intracellular loop segment of the wild-type G protein-coupled receptor with the third intracellular loop sequence of the kappa opioid receptor, and replacing 5-25 amino acids in the TM6 segment downstream of the third intracellular loop segment with the third intracellular loop sequence of the kappa opioid receptor. And / or, in step S1, the SmBiT peptide tag is labeled at the C-terminus of the wild-type G protein-coupled receptor; And / or, the SmBiT peptide tag is attached to the wild-type G protein-coupled receptor via a flexible peptide; And / or, the amino acid sequence of the SmBiT peptide tag is shown in SEQ ID NO.
1.
3. The method for screening thermostability mutation sites of G protein-coupled receptors according to claim 1, characterized in that, In step S3, the different temperatures are gradient temperatures; And / or, in step S3, the different temperature ranges are 30°C to 75°C; And / or, in step S3, the temperature difference between two adjacent temperatures in the gradient temperature does not exceed 6°C; And / or, in step S3, the incubation time is 30-40 minutes; after incubation, the temperature is cooled at 4℃-10℃ for 10-20 minutes. And / or, in step S3, the concentration range of the modified G protein-coupled receptor is 0.1 mg / mL to 1 mg / mL.
4. The method for screening thermostability mutation sites of G protein-coupled receptors according to any one of claims 1-3, characterized in that, In step S4, the nanobody is selected from Nb6 nanobody; And / or, in step S4, the LgBiT is attached to the C-terminus of the nanobody; And / or, in step S4, the LgBiT is attached to the nanobody via a flexible peptide; And / or, in step S4, the modified G protein-coupled receptor samples treated at different temperatures are mixed with nanobodies and LgBiT complexes in a molar ratio of 60:1 to 600:
1. And / or, in step S4, the incubation conditions are room temperature (20°C~25°C) for 15~20 minutes; And / or, in step S4, the luciferase substrate is selected from coelenterate h, furazolidone, hydrofuranazine, or flufuranazine; And / or, in step S4, the final concentration of the luciferase substrate added is a molar concentration of 20~100 nM; And / or, in step S4, the detection step involves detecting the chemiluminescence signal at an emission wavelength of 460±20 nm without excitation wavelength, and calculating T. m value.
5. A method for screening thermostability mutation sites of G protein-coupled receptors as described in any one of claims 1-4, having any one of the following uses: (1) Application in screening thermostable mutation sites in G protein-coupled receptors; (2) Quantitatively assess the effect of thermostability mutation sites in G protein-coupled receptors on the level of thermostability enhancement of G protein-coupled receptors; (3) Use in improving the thermostability and / or structural resolution of G protein-coupled receptors; (4) Uses in the research and development of G protein-coupled receptor-based drugs; (5) Use in assisting the purification of G protein-coupled receptors.
6. The use according to claim 5, characterized in that, The G protein-coupled receptors include receptors with known Class A ligands or orphan receptors with unknown Class A ligands.
7. A highly thermally stable G protein-coupled receptor, characterized in that, This includes screening using the thermostability mutation site screening method for G protein-coupled receptors as described in any one of claims 1-4.
8. The highly thermally stable G protein-coupled receptor according to claim 7, characterized in that, The highly thermostable G protein-coupled receptor includes: the orphan receptor GPR151 comprising at least one of the following mutation sites: L127 3.41 W or S300 7.47 A.
9. The highly thermally stable G protein-coupled receptor according to claim 8, characterized in that, The orphan receptor GPR151 also includes at least one of the following mutation sites: I58 1.54 L, N64 1.60 Y, S86 2.52 L, M72 2.38 A, K101 2.67 G, M122 3.36 A, S126 3.40 A, A140 3.54 L, W155 4.43 A, W173 4.61 A, S200 5.36 A, L205 5.41 A, A218 5.54 I, W274 6.59 C, L294 7.41 A or F306 7.53 L.
10. A method for structural determination of a highly thermostable G protein-coupled receptor as described in any one of claims 7-9, characterized in that, This includes assembling the aforementioned highly thermally stable G protein-coupled receptor with a Lego antibody to form a complex, and then using cryo-electron microscopy to resolve the three-dimensional structure.
Citation Information
Patent Citations
Mutant g-protein coupled receptors and methods for selecting them
CN101688203A
Novel fusion partners for the purpose of crystallizing G-protein coupled receptors
CN103874711A
Transformation method and application of G protein coupled receptor
CN119241687A
Cited By
Water-soluble membrane protein, recombinant vector, recombinant host bacteria, and modification method and application thereof
CN122135767A