Application of CSN6 in pancreatic cancer treatment

Abstract

The invention discloses application of CSN6 in treatment of pancreatic cancer. The CSN6 provided by the invention can enhance ribosome biogenesis through NPM1 to promote malignant progression of pancreatic cancer, a pathway-related inhibitor NSC348884 can be used for targeted treatment of pancreatic cancer, reference is provided for a new strategy for treating pancreatic cancer and improving gemcitabine drug resistance, and the CSN6 has certain conversion application value in clinical treatment and drug research and development.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of CSN6 in pancreatic cancer treatment, and especially to application of a regulation pathway targeting CSN6 in pancreatic cancer treatment. BACKGROUND

[0002] Pancreatic ductal adenocarcinoma (PDAC) is the most common subtype of pancreatic cancer, which is characterized by high invasiveness and early metastasis, and is one of the digestive tract malignant tumors with the worst prognosis. Although the medical technology has been significantly improved, the prognosis of PDAC patients is still not optimistic. Since 1997, gemcitabine (GEM) has replaced fluorouracil as the first-line chemotherapy drug for advanced pancreatic cancer, and the high primary drug resistance and rapid acquired drug resistance of GEM have seriously limited the clinical application and therapeutic effect of the drug. CSN6 (COP9 Signalosome Subunit 6, COPS6 / CSN6) is an important subunit of COP9 signalosome (CSN), which can dynamically regulate the enzyme activity of Cullin-RING Ligases (CRLs) by regulating the ubiquitin-like modification (neddylation) of Cullin protein in CRLs. CSN6 is involved in the progression of various malignant tumors by regulating the protein ubiquitination of substrates. However, the molecular regulation network and mechanism of CSN6 in the development process of pancreatic cancer are not clear, especially the molecular mechanism between the regulation network of CSN6 and drug sensitivity under the background of gemcitabine treatment needs to be studied. SUMMARY

[0003] The present application aims to clarify the molecular regulation network and mechanism of CSN6 in the development process of pancreatic cancer, and to explore the role of CSN6 and its downstream effector molecules in gemcitabine resistance of pancreatic cancer. On this basis, new molecular markers with clinical application potential are screened, in order to establish a precise treatment strategy based on tumor molecular typing, and to provide a reference and basis for PDAC treatment and gemcitabine resistance reversal.

[0004] Clinical data analysis showed that CSN6 was significantly overexpressed in pancreatic ductal carcinoma tissues and was associated with shorter overall survival of patients. Phenotype experiments showed that CSN6 could regulate the in vitro and in vivo proliferation of pancreatic cancer cells, and a transgenic mouse model showed that CSN6 knockout could significantly inhibit pancreatic tumor formation. Mechanism studies showed that CSN6 up-regulated the ribosome biogenesis pathway by promoting the transcription of ribosomal RNA and maintaining the homeostasis of ribosomal proteins, and promoted protein synthesis. CSN6 reduced the ubiquitination modification of K48-linked NPM1 to enhance its protein stability, and the stabilized NPM1 participated in mediating the ribosome biogenesis process and tumor malignant progression regulated by CSN6. DCAF1 mediates the ubiquitination and degradation of NPM1 as an E3 ubiquitin ligase. CSN6 promotes the autoubiquitination modification of DCAF1, resulting in a decrease in its protein stability, and thus weakening the ubiquitination and degradation of NPM1. Drug resistance and targeted therapy experiments showed that CSN6 was significantly overexpressed in gemcitabine-resistant pancreatic cancer cell lines, accompanied by abnormal activation of the ribosome biogenesis pathway. Targeting CSN6-NPM1 can effectively inhibit tumor malignant progression and enhance the therapeutic effect of gemcitabine.

[0005] The present application proposes that CSN6 can enhance ribosome biogenesis through NPM1 to promote the malignant progression of pancreatic cancer, and that the pathway-related inhibitor NSC348884 can be used for targeted therapy of pancreatic cancer, providing a reference for new strategies for treating pancreatic cancer and improving gemcitabine resistance, and having certain transformation application value in clinical treatment and drug research and development. BRIEF DESCRIPTION OF DRAWINGS

[0006] Figure 1 The mRNA levels of CSN6 in normal tissues and tumor tissues in different pancreatic ductal carcinoma data sets (GSE15471, GSE28735, GSE6245).

[0007] Figure 2 K-M survival curves between CSN6 expression levels and patient prognosis in different pancreatic ductal carcinoma data sets.

[0008] Figure 3 The results of silencing CSN6 to inhibit the in vitro growth of pancreatic cancer cells; A. RT-qPCR detects the knockdown efficiency of CSN6 in three pancreatic cancer cell lines; B. CCK8 detects the growth curve of pancreatic cancer cells with CSN6 knockdown; C. Representative pictures of colony formation of pancreatic cancer cells with CSN6 knockdown.

[0009] Figure 4Figure 6. Results of silencing CSN6 to inhibit the growth of pancreatic cancer cells in vivo. A-C. Pictures of subcutaneous tumors (A), growth curve of subcutaneous tumors (B), and weight of subcutaneous tumors (C) of pancreatic cancer cell MiaPaCa-2 derived from the control group and the CSN6 knockdown group. D. Representative pictures of immunohistochemical staining of CSN6, Ki67, and Cleaved-caspase3 of subcutaneous tumors of the control group and the CSN6 knockdown group (left) and quantitative analysis of the relative staining intensity or positive rate of the above by Image J (right).

[0010] Figure 5 Figure 7. Diagram of the construction strategy and verification results of the pancreatic spontaneous tumor and pancreatic specific knockout CSN6 mouse model. A. Kras G12D mutation, Tp53 R172H mutation, CSN6 knockout, and pancreatic specific conditional expression of Cre small gene mode diagram. B. Breeding scheme mode diagram of KPP (left) and KPPC (right) mice based on KPP, which is a pancreatic specific conditional knockout CSN6 mouse model. C. Genotype identification results of KPP mice (left) and KPPC mice (right). KI: knock-in; WT: wild type; P: positive control.

[0011] Figure 6 Figure 8. Experimental results of the pancreatic tissue specific knockout CSN6 mouse model based on spontaneous pancreatic cancer. A. Ptf1a-Cre ERT2 mediated pancreatic specific Kras G12 D mutation, Tp53 R172H mutation and Csn6 knockout and time axis leading to tumor formation. B. Gross morphology of pancreas of KPP and KPPC mice (left), and the tumor boundary is circled by a red dashed line. Subsequently, the number and area of pancreatic tumors were quantitatively analyzed (right). C. Representative hematoxylin-eosin (HE) staining images of KPP and KPPC. The tumor boundary is circled by a red dashed line. D. Representative immunohistochemical staining images of CSN6 and Ki67 in KPP tumor and KPPC tissue (left). Quantitative analysis of staining intensity and positive proportion by Image J (right).

[0012] Figure 7 Figure 9. Results of CSN6 regulating its level by regulating the synthesis of ribosomal RNA. A. RT-qPCR detection of ribosomal RNA level expression after knocking out CSN6. B. RT-qPCR detection of changes in ribosomal RNA content after overexpressing CSN6. C. RT-qPCR verification of the expression levels of CSN6 mRNA and rRNAs in KPP and KPPC mouse spontaneous pancreatic tumors and normal pancreatic tissues. D. Western blotting experiment to detect the protein level of UBTF1 in PDAC cell lines after knocking down CSN6. The relative protein expression was quantitatively analyzed by Image J.

[0013] Figure 8 Ribosomal profile of pancreatic cancer cells overexpressing CSN6; Cell lysates of pancreatic cancer were separated in sucrose gradient centrifugation, followed by the determination of each fraction at A254 and the plot. The positions of 40S, 60S, 80S and polysomes in sucrose gradient were labeled in the figure.

[0014] Figure 9 Results of the correlation of CSN6 with global protein synthesis of cells; A. The level of protein synthesis of cells overexpressing CSN6 was detected by puromycin incorporation assay. B. The level of global protein synthesis in PDAC cells with knockdown of CSN6 was detected by puromycin incorporation assay.

[0015] Figure 10 Results of the correlation of NPM1 with CSN6; A. The representative results of CSN6 interacting proteins in MiaPaCa-2 cells were reported by immunoprecipitation-mass spectrometry. B. The combination between CSN6 and NPM1 was demonstrated by semi-exogenous (left) and endogenous (right) immunoprecipitation experiments in pancreatic cancer cell lines. Flag-EV and IgG were used as negative controls. C. The effect of CSN6 overexpression on NPM1 expression was shown by immunoblotting (left) and immunohistochemistry (middle, right) experiments. D. The correlation analysis of CSN6 and NPM1 protein abundance (left) and mRNA level (right) in CPTAC_PDAC dataset. E. The protein expression and mRNA level of NPM1 in pancreatic cancer cell lines with silenced CSN6 were analyzed by immunoblotting (left) and RT-qPCR (right).

[0016] Figure 11 Results of CSN6 regulating the protein level of NPM1 by affecting its ubiquitination; A. The effect of MG132 treatment on the downregulation of NPM1 protein in CSN6 knockdown was detected by immunoblotting experiment. B. The protein turnover rate of NPM1 in control and CSN6 overexpressing cells was detected by CHX treatment combined with immunoblotting experiment (upper). The protein immunoblotting was quantitatively analyzed and plotted by ImageJ (lower). C. The effect of gradient concentration of overexpressing CSN6 on the ubiquitination of NPM1 protein was explored by immunoblotting experiment. D. Whether CSN6 could regulate the ubiquitination modification of K48-linked NPM1 was detected by immunoblotting experiment.

[0017] Figure 12 CSN6 regulates the proliferation of pancreatic cancer cells through NPM1; A. The cell growth curves of two pancreatic cancer cell lines with silenced CSN6 or (and) overexpressed NPM1 were determined by CCK8 method. B. The proliferation ability of two pancreatic cancer cell lines with overexpressed CSN6 or (and) knocked down NPM1 was evaluated by colony formation assay. The pictures showed the colonies formed by each group (upper), followed by quantification by Image J (lower).

[0018] Figure 13 Figure for the correlation between CSN6 and gemcitabine resistance; A. CCK8 assay and IC50 curve of gemcitabine concentration-cell viability were drawn. B. Western blotting analysis showed the expression level of CSN6 and its downstream proteins in gemcitabine-resistant pancreatic cancer cells. In addition, the expression level of downstream targets in gemcitabine-resistant pancreatic cancer cells was detected after silencing CSN6. C. RT-qPCR detected the mRNA level in CSN6-DCAF1-NPM1 axis and the level of ribosomal RNA (rRNA) in gemcitabine-resistant pancreatic cancer cells. D. Puromycin incorporation assay detected the protein synthesis level in gemcitabine-resistant cells.

[0019] Figure 14 Figure for the relationship between CSN6 knockdown and sensitivity of pancreatic cancer cell lines to gemcitabine; A. IC50 curve of pancreatic cancer cell lines under the action of different concentrations of gemcitabine, including two cell lines and two CSN6 knockdown sequences. B. Bar chart showing the difference between cell survival rates of the two groups under the same gemcitabine concentration in Figure (A). C. Flow cytometry based on Annexin-V / PI staining detected the apoptosis of two pancreatic cancer cells when CSN6 was silenced or (and) treated with gemcitabine. D. Quantitative results showed that CSN6 silencing and gemcitabine treatment had a synergistic effect on cell apoptosis.

[0020] Figure 15 Figure for the correlation between CSN6 overexpression and gemcitabine resistance of pancreatic cancer cells; A. IC50 curve of two pancreatic cancer cell lines under the action of different concentrations of gemcitabine. B. Bar chart showing that there is a significant difference in cell survival rate between the two groups under the same gemcitabine concentration in Figure (A). C. After the components of ribosome profiling analysis were divided into monomers and multimers, RT-qPCR was used to analyze and evaluate the proportion of mRNA in multimeric ribosomes in pLVX SC and pLVX CSN6 groups. β-actin is the control of translation rate.

[0021] Figure 16 Figure for the effect of CSN6 knockdown on the effect of gemcitabine treatment on pancreatic cancer tumors; A. Schematic diagram and treatment strategy of subcutaneous tumor model derived from doxycycline-induced CSN6 knockdown cell lines. B. Tumors were removed after the experiment, and tumor masses in each group are shown in the figure. C. Tumor volume (top) and tumor weight (bottom) were measured during the experiment or at the end of the experiment. D. Representative immunohistochemical images show CSN6, Ki67 and γ-H2AX staining in subcutaneous tumor tissue. E. Image J was used for quantification of immunohistochemical staining.

[0022] Figure 17Figure 1 shows the effect of NSC348884 on pancreatic cancer cells and its resistance to gemcitabine. A. Effect of NSC348884 on the proliferation ability of pancreatic cancer cells detected by CCK8 assay. B. Viability of PDAC cells under different concentrations of gemcitabine detected by CCK8 assay, and IC50 curves of the control group and the NSC348884 group were plotted.

[0023] Figure 18 Figure 1 shows the effect of NSC348884 on the efficacy of gemcitabine in treating pancreatic cancer. A. Schematic diagram of the subcutaneous tumor model derived from CSN6-overexpressing pancreatic cancer cell lines and treatment strategies. B. Tumors were removed after the experiment; tumor masses in each group are shown in the figure. C. Tumor volume (top) and tumor weight (bottom) were measured and recorded during or at the end of the experiment.

[0024] Figure 19 Results showing the effects of NSC348884 on ribosomal biogenesis and the cytotoxic effect of gemcitabine; A. RT-qPCR results showing the levels of rRNAs in subcutaneous tumors derived from BXPC-3 cells overexpressing CSN6 after treatment with gemcitabine and / or NSC348884. B. Representative immunohistochemical staining images of CSN6, DCAF1, NPM1, UBTF1, Ki67, and γ-H2AX in CSN6-overexpressing subcutaneous tumor tissues. Image J was used for quantification of the immunohistochemical staining. Detailed Implementation

[0025] To enable those skilled in the art to understand the present invention more clearly and intuitively, the present invention will be further described below with reference to the accompanying drawings.

[0026] Process and Results

[0027] 1. CSN6 is highly expressed in pancreatic tumors and promotes tumor progression.

[0028] 1.1 CSN6 is significantly highly expressed in pancreatic tumor tissues.

[0029] This invention integrates transcriptome data from three independent cohorts in the GEO database (GSE15471: n=36; GSE28735: n=45; GSE62452: n=69). Normalized analysis showed a consistent and significant upregulation of CSN6 mRNA expression levels in PDAC samples compared to paired normal pancreatic tissue. Figure 1 The differences were statistically significant. These cross-dataset validation results suggest that CSN6 is highly expressed in PDAC and may act as a potential regulator in the malignant biological processes of PDAC. Therefore, we hypothesize that CSN6 overexpression may be potentially associated with oncogenic properties such as tumor cell proliferation.

[0030] 1.2CSN6 high expression is associated with poor prognosis of pancreatic cancer patients

[0031] To explore the correlation between the expression level of CSN6 and the prognosis of PDAC patients, the survival analysis of pancreatic cancer patients was performed using the public bioinformatics platform Kaplan-Meier Plotter. This platform integrates 12 PDAC cohorts (GSE84219, GSE78229, GSE179351, GSE172356, GSE57495, GSE79668, GSE85916, GSE28735, GSE124230, GSE102238, GSE62452 and GSE71729) with complete prognosis information in the GEO database (total sample size n=1189). Survival analysis by Log-rank test showed that the overall survival of patients with high expression of CSN6 was significantly shorter than that of the control group (HR=1.22, 95% CI: 1.05-1.42, P<0.01). It is suggested that overexpression of CSN6 is associated with poor prognosis of pancreatic cancer patients, and may be an independent risk factor for poor prognosis of PDAC Figure 2 ).

[0032] 1.3Silencing CSN6 inhibits the growth of pancreatic cancer cells in vitro and in vivo

[0033] Based on the clinical evidence that CSN6 is highly expressed in PDAC and is associated with poor prognosis of patients, it is hypothesized that CSN6 can drive the malignant progression of pancreatic cancer through its oncogene characteristics. To elucidate the biological functions of pancreatic cancer cells regulated by CSN6, a gene expression down-regulated pancreatic cancer cell model was constructed using shRNA interference technology, and the regulatory effect of CSN6 on the proliferation phenotype of pancreatic tumor cells was explored.

[0034] pLKO.1 contains human U6 and H1 promoters, as well as markers such as EGFP or RFP. It is a classic RNAi tool that can be used for gene knockout and RNAi research. The present application uses lentivirus pLKO.1 mediated shRNA to establish a CSN6 gene silencing model in three PDAC cell lines BXPC-3, MiaPaCa-2 and PANC-1. shRNA sequence design:

[0035] shSC-F: CCGGCTTCTAACACCGGAGGTCTTCTCGAGAAGACCTCCGGTGTTAGAAGTTTTTG (SEQ ID NO. 1);

[0036] shSC-R: GAAGATTGTGGCCTCCAGAAGAGCTCTTCTGGAGGCCACAATCTTCTTAA (SEQ ID NO. 2);

[0037] shCSN6-1-F: CCGGCTTGAGAGAAAACCGCTGTCATCTCGAGATGACAGCGGTTTCTCTCAAGTTTTTG (SEQ ID NO. 3);

[0038] shCSN6-1-R:GAACTCTCTTTGGCGACAGTAGAGCTCTACTGTCGCCAAAGAGAGTTCTTAA (SEQ ID NO.4);

[0039] shCSN6-2-F: CCGGCAGTTTGTGAACAAGTTCAATCTCGAGATTGAACTTGTTCACAAACTGTTTTTG (SEQ ID NO.5);

[0040] shCSN6-2-R:GTCAAACACTTGTTCAAGTTAGAGCTCTAACTTGAACAAGTGTTTGACTTAA (SEQ ID NO. 6).

[0041] RT-qPCR validation 48 h after lentiviral infection showed that, compared with the control sh scramble group (sh SC, target sequence: CTTCTAACACCGGAGGTCTT (SEQ ID NO.7)), the shCSN6-1 group (target sequence: CTTGAGAGAAACCGCTGTCAT (SEQ ID NO.8)) and the shCSN6-2 group (target sequence: CAGTTTGTGAACAAGTTCAAT (SEQ ID NO.9)) inhibited the expression level of CSN6 mRNA by more than 90% in three pancreatic cancer cell lines (P<0.01). Figure 3 A). Cell viability was then assessed using CCK8 reagent at 0, 24, 48, 72, and 96 h. Cell proliferation curves showed that silencing CSN6 significantly inhibited the proliferation of the three pancreatic cancer cell lines. Figure 3 B). Further verification using a plate colony formation assay showed that after 10 days of culture, the number of colonies formed in the CSN6 knockdown group was significantly reduced compared to the control group. Figure 3 C). The above data indicate that silencing the CSN6 gene can significantly inhibit the in vitro proliferation ability of PDAC cells.

[0042] To verify the role of CSN6 in promoting pancreatic tumor development in vivo, a subcutaneous xenograft model was established in BALB / c nude mice. MiaPaCa-2 cell lines stably expressing sh SC or sh CSN6, infected with lentivirus and selected with puromycin, were used at a rate of 5 × 10⁻⁶ cells / cells. 6Individual / multiple inoculation was performed on the right flank of nude mice (n = 5 per group). Tumor volume was measured twice a week using a vernier caliper for about 1 month. The experimental results showed that compared with the sh SC group, the tumor volume growth curve of the sh CSN6 group was significantly flattened, and the final tumor size and tumor wet weight were significantly reduced Figure 4 A, Figure 4 B, Figure 4 C). The research results show that CSN6 silencing can significantly inhibit the in vivo tumorigenicity of PDAC cells.

[0043] To verify the gene silencing efficiency of CSN6 in the above in vivo model and the biological effects caused thereby, pathological analysis was performed on the transplanted tumor tissue. After the terminal tumor tissue was fixed with 4% paraformaldehyde for 48 h, it was paraffin-embedded and 4 μm serial sections were prepared. Immunohistochemical staining (IHC) was used to analyze the expression of CSN6, Ki-67 and Cleaved caspase-3 proteins. Image J quantitative analysis showed that the relative expression level of CSN6 protein in the tumor tissue of the sh CSN6 group was significantly lower than that of the control group, confirming the effectiveness of gene silencing in the in vivo model Figure 4 D, left panel). Pathological analysis further showed that the positive cell rate of the proliferation marker Ki-67 in the sh CSN6 group was significantly lower than that in the control group sh SC; while the relative expression amount of the apoptosis marker Cleaved caspase-3 was significantly increased. These results show that silencing CSN6 promotes PDAC progression by promoting cell proliferation and inhibiting apoptosis Figure 4 D, right panel).

[0044] 1.4 Pancreatic-specific knockout of CSN6 can inhibit spontaneous pancreatic tumor formation in mice

[0045] To simulate the multi-stage occurrence process of PDAC and systematically explore the molecular regulatory role of CSN6 in the evolution of PDAC, a conditional genetic engineering mouse model was constructed. The following transgenic mice were purchased from Jiangsu Jizhu Yaoke Pharmaceutical Co., Ltd.: conditional oncogene double-knockin mice (LSL-Kras G12D / + ; LSL-Trp53 R172H / + ); CSN6 conditional knockout mice (Csn6 flox / flox ); and pancreas-specific inducible Cre tool mice (Ptf1a-Cre ERT2 ). The gene patterns of the above mice are shown as follows Figure 5 A).

[0046] Based on the above transgenic mice, the following mating strategy was used to establish a pancreatic cancer experimental animal model: the KP mice with conditional oncogene double-knockin were mated with the pancreas-specific inducible Cre tool mice to obtain the KPP mouse model (LSL-Kras G12D / +; LSL-Trp53 R172H / + ; Ptf1a-Cre ERT2 ); and synchronously crossing the above two strains of mice with Csn6 flox / flox mice to finally obtain KPPC mice model with four genetic modifications (LSL-Kras G12D / + ; LSL-Trp53 R172H / + ; Ptf1a-Cre ERT2 ; Csn6 flox / flox ( Figure 5 B).

[0047] According to the above genetic cross scheme, the newborn pups were ear-tagged on the 7th day after birth, and the hind toe tissues were taken for genotype identification by using multiple PCR reactions. Four sets of specific primers were used to detect: LSL-Kras G12D knock-in site, LSL-Tp53 R172H knock-in site (481 bp), Csn6 genotype (wild type 127 bp, flox allele 222 bp), and Ptf1a-Cre ERT2 recombinase sequence (432 bp). Subsequently, 1% agarose gel electrophoresis was used for separation (120 V, 35 min), and finally the Bio-Rad imaging system was used to collect the electrophoretogram. It can be seen that KPP3, KPP4, KPP8 and KPPC16-KPPC19 are the target mice that meet the above genotype conditions Figure 5 C).

[0048] The KPP (n=3) and KPPC (n=4) mice that passed the genotype verification were given intraperitoneal injection of tamoxifen for 5 consecutive days at the age of 5 weeks to activate the Cre recombinase-mediated gene mutation and knockout. The body weight changes and ascites formation of the mice were monitored every week Figure 6 A). After 30 weeks of induction, the KPP group of mice showed progressive weight loss and ascites, while the KPPC group of mice maintained stable weight. After euthanizing the mice by progressive asphyxiation in carbon dioxide, the pancreatic tissues were taken, and it was found that the pancreatic tissues of the KPP group of mice appeared hard lumps, while the pancreatic tissues of the KPPC group of mice were soft and no obvious nodules or hard lumps were palpable Figure 6 B). Histopathological analysis showed that the KPP group of mice had extensive intraepithelial neoplasia, with abnormal glandular structures and nuclear atypia, while the KPPC group of mice had intact exocrine pancreas and clear islet structure Figure 6 C).

[0049] Further immunohistochemistry quantitative analysis showed that the expression level of CSN6 protein in pancreatic tissues of KPPC group was significantly lower than that of KPP group. And the positive cell rate of Ki-67, an index of proliferation activity, in KPPC group was also significantly lower than that in KPP group. These results showed that specific knockout of CSN6 in pancreas could significantly inhibit the development of Kras G12D and Trp53 R172H double-mutation driven PDAC Figure 6 D).

[0050] 2. Proteomics reveals that CSN6 regulates ribosome biogenesis pathway

[0051] 2.1 CSN6 regulates ribosome-related pathway

[0052] Control sh SC and sh CSN6 lentivirus infected PANC-1 pancreatic cancer cells were divided into two groups, and three biological replicates were set in each group. 10 7 PANC-1 cells were collected by cell lysis solution and sent to Zhongke Xinsheng Company for quantitative proteomics analysis. According to the experimental procedure shown, after the intracellular proteins were digested, liquid chromatography-mass spectrometry was used for proteomics analysis and quantification. Principal component analysis (PCA) based on the quantitative analysis results showed that the protein expression profiles of the two groups of samples showed a separation trend, indicating that CSN6 knockdown changed the protein expression of pancreatic cancer cells.

[0053] Further gene set enrichment analysis (GSEA) was used for functional annotation analysis of peptide segment data, and the results showed that multiple ribosome-related biological processes were significantly enriched in the control group, such as ribosome structure composition, ribosome large / small subunit biosynthesis, and ribosome precursor. GSEA visualization analysis showed that CSN6 silencing could affect the core functions of ribosome size subunit and its assembly. Volcano plot analysis (|Fold Change|>1.5, P<0.05) showed that in addition to the significant down-regulation of target protein CSN6, ribosome large subunit protein RPL34 and RNA polymerase I complex subunit POLR1F also showed a significant down-regulation trend in the CSN6 knockdown group (shCSN6-1). Since ribosomes are mainly composed of ribosomal RNA (rRNAs) and ribosomal proteins (RPs), it was observed that CSN6 knockdown could cause abnormal expression of ribosomal proteins including RPL34 and transcriptional regulator of ribosomal DNA (rDNA) POLR1F. And the peptide annotation and enrichment results suggest that CSN6 may be involved in the regulation of ribosome composition and structure. Based on this, it is speculated that CSN6 may regulate ribosome function by coordinating rRNA synthesis and RP homeostasis in two dimensions.

[0054] 2.2 CSN6 regulates ribosome RNA transcription

[0055] Validation experiment: shRNA-mediated CSN6 knockdown and pLVX lentivirus infection-mediated CSN6 overexpression cell lines were established in pancreatic cancer cells, and the expression changes of each subtype of rRNAs were detected by RT-qPCR. The results show that CSN6 knockdown can significantly reduce the expression levels of pre-rRNA and mature rRNAs (5.8S rRNA, 18S rRNA and 28S rRNA) P<0.05 Figure 7 A); on the contrary, the expression of each rRNAs subtype in the CSN6 overexpression group is significantly increased Figure 7 B). To further verify the regulatory effect of CSN6 in vivo, the pancreatic tissues of the pancreatic-specific oncogene double-knock-in KPP and KPPC transgenic mouse model of conditional knockout of CSN6 under the KPP background were used, total RNA was extracted from the pancreatic tumor and normal tissue, and RT-qPCR analysis was performed. The results show that compared with KPP group mice with spontaneous pancreatic tumor phenotype, the abundance of each type of rRNAs in the pancreatic tissues of KPPC group mice is significantly reduced Figure 7 C). Based on the above regulatory mechanism, it is further explored whether CSN6 is involved in the regulation of UBTF1 protein level. CSN6 knockdown and Western blot analysis were performed in three independent pancreatic cancer cell lines, and the results show that down-regulation of CSN6 expression can significantly reduce the UBTF1 protein level Figure 7 D). This phenomenon suggests that CSN6 may affect rDNA transcription activity by regulating UBTF1 protein level to affect the content of rRNAs. This result provides experimental evidence for verifying that CSN6 regulates ribosome function and affects rRNAs synthesis.

[0056] 2.3 CSN6 affects translation activity and protein synthesis

[0057] The present application adopts ribosome profiling technology, RNase A selective digestion of mRNA regions not protected by ribosomes after CHX treatment of cells, followed by separation of monoribosome and polysome components by sucrose density gradient ultracentrifugation (36000 rpm, SW41 rotor, 4°C, 3h). Finally, the content of RNA is quantified by Nanodrop, and the results show that the mRNA binding in the 80S ribosome and polysome components in the CSN6 high expression group is significantly increased compared with the control group Figure 8 ). It is shown that CSN6 overexpression can significantly increase the occupancy density of mRNA on ribosomes, and ultimately improve the protein translation flux in cells.

[0058] The present application uses puromycin to treat logarithmic growth period pancreatic cancer cells for 30 min, and the immunoblotting experiment combined with anti-puromycin monoclonal antibody is used to detect and quantitatively analyze the rate of nascent peptide chain synthesis. For example,Figure 9 As shown, the incorporation of puromycin was significantly increased in CSN6-overexpressing HEK293T and MiaPaCa-2 cells. Figure 9 A). Conversely, the puromycin incorporation in the CSN6 knockdown group was significantly lower than that in the control group ( Figure 9 B) indicates that CSN6 expression level is related to protein synthesis flux.

[0059] 3. CSN6 affects ribosome biogenesis and tumor cell growth through NPM1.

[0060] 3.1 NPM1 is an interacting protein of CSN6, regulated post-transcriptionally by CSN6.

[0061] Based on the previously discovered dual regulatory role of CSN6 in rRNA synthesis, processing, and ribosomal protein levels, this study focuses on nucleolar phosphatase NPM1 (NPM1). Figure 10 A). To verify the interaction between CSN6 and NPM1, immunoprecipitation (IP) experiments were performed on exogenous Flag-NPM1 overexpression and on endogenous IP in pancreatic cancer cell lines. Western blot analysis confirmed that both proteins specifically bound to the pancreatic cancer PANC-1 and MiaPaCa-2 cell lines. Figure 10 B). Further, a gradient concentration CSN6 overexpression system was constructed in HEK293T cells, showing a dose-dependent upregulation trend in NPM1 protein levels. IHC analysis of CSN6 knockdown xenograft tissues indicated a significant decrease in NPM1 expression intensity. Figure 10 C). The above multidimensional experiments confirmed that CSN6 and NPM1 directly interact and regulate their protein expression levels.

[0062] Mining results based on the CPTAC_PDA database showed a significant positive correlation between CSN6 and NPM1 protein expression levels (r = 0.29, P < 0.01), while transcriptome data showed no significant correlation between their mRNA expression (r = 0.01, P > 0.05). Figure 10 D). To further verify this phenomenon, this study established a CSN6 knockdown model in three pancreatic cancer cell lines: MiaPaCa-2, BXPC-3, and PANC-1. Western blot quantitative analysis showed that the NPM1 protein expression level was significantly decreased in the CSN6 knockdown group, while RT-qPCR showed no significant change in NPM1 mRNA level. Figure 10 E). These results suggest that CSN6 regulates NPM1 protein levels at the post-transcriptional level.

[0063] 3.2 CSN6 affects NPM1 protein homeostasis through ubiquitination modification.

[0064] CSN6 knockdown pancreatic cancer cell lines were treated with the proteasome inhibitor MG132 for 6 hours. Subsequent Western blot analysis showed that MG132 treatment significantly reversed the decrease in NPM1 protein levels caused by CSN6 knockdown. Figure 11 A) suggests that CSN6-regulated NPM1 degradation occurs via the proteasome pathway. Further Western blot and quantitative experiments on cells treated with CHX showed that overexpression of CSN6 significantly prolonged the NPM1 protein half-life and reduced its turnover rate. Figure 11 B). Ubiquitination analysis showed that gradient concentration transfection with HA-CSN6 dose-dependently reduced the polyubiquitination level of NPM1. Figure 11 C). Further confirmatory experiments on ubiquitination linkage sites showed that the mutation of lysine at position 48 of the ubiquitin molecule to arginine (K48R) resulted in a decrease in NPM1 ubiquitination levels, and the increase in NPM1 ubiquitination levels caused by CSN6 knockdown was significantly reduced, suggesting that CSN6 can regulate K48-linked NPM1 polyubiquitination modification. Figure 11 D).

[0065] 3.3 CSN6 regulates pancreatic cancer cell proliferation through NPM1

[0066] CCK-8 proliferation assays showed that exogenous NPM1 overexpression could alleviate the inhibition of pancreatic cancer cell proliferation caused by CSN6 knockdown. Figure 12 A). In clonogenic experiments, knocking down NPM1 in the CSN6 overexpression model completely eliminated the CSN6-induced clonogenic effect. Figure 12 B) suggests that this regulatory axis specifically regulates the proliferation capacity of tumor cells. The above complementation and blockade experiments together demonstrate that CSN6 positively regulates the proliferative activity of pancreatic cancer cells through an NPM1-dependent mechanism.

[0067] 4. CSN6 is associated with gemcitabine resistance; silencing CSN6 can increase chemosensitivity.

[0068] 4.1 High expression of CSN6 and enhanced ribosome biogenesis in gemcitabine-resistant strains

[0069] A gemcitabine-resistant pancreatic cancer cell model was established by continuously inducing MiaPaCa-2 and BXPC-3 pancreatic cancer cells with a low concentration of 50 nM gemcitabine for six months. The gemcitabine IC50 values ​​of the parental cell line and the resistant cell line were compared. 50 The value measurement results showed a significant difference between the two. Figure 13A), indicating the successful establishment of drug resistance model. Further Western blot analysis showed that the expression of CSN6 protein was significantly up-regulated in drug-resistant strains, and the simultaneously increased molecules also included NPM1, upstream binding transcription factor 1 (UBTF1) and ribosomal large subunit protein 11 (RPL11), while the protein expression level of DCAF1 showed a downward trend. Knockdown of CSN6 by shRNA interference technology can reverse the abnormal expression of the above molecules in drug-resistant strains. These results suggest that the CSN6-DCAF1-NPM1 signaling axis may be involved in the formation of gemcitabine resistance mechanism by regulating the ribosome biogenesis pathway Figure 13 B).

[0070] RT-qPCR was used to detect the parental cell line of pancreatic cancer (Parental) and two independently constructed gemcitabine-resistant strains (GEM-R), and the results showed that the expression of CSN6 mRNA in drug-resistant strains was significantly up-regulated compared with parental cells, while the mRNA expression levels of NPM1 and DCAF1 did not change significantly Figure 13 C). Notably, the above results are highly consistent with the "mRNA-protein expression decoupling phenomenon" of NPM1 protein accumulation and DCAF1 protein down-regulation presented in Figure 13 B.

[0071] Further RT-qPCR detection showed that the expression levels of rRNA precursors (pre-rRNA) and cleavage bodies (5.8S rRNA, 18S rRNA, 28S rRNA) downstream of the CSN6-NPM1 signaling axis in drug-resistant strains were significantly increased, and puromycin incorporation experiments showed that the rate of nascent protein synthesis was significantly increased Figure 13 C, Figure 13 D). These data all suggest that gemcitabine-resistant cells may obtain a survival advantage by activating the CSN6-NPM1-regulated ribosome biogenesis and protein translation pathways.

[0072] 4.2 Silencing CSN6 increases the sensitivity of pancreatic cancer cells to gemcitabine

[0073] Two CSN6-specific shRNA sequences were transfected into two pancreatic cancer cell lines, respectively, and then treated with different concentration gradients of gemcitabine. IC50 curve and statistical analysis showed that CSN6 knockout can significantly enhance the chemosensitivity of pancreatic cancer cells to gemcitabine Figure 14 A), especially at a specific gemcitabine concentration Figure 14 B). Annexin V-FITC / PI double staining flow cytometry detection showed that both the CSN6 silenced group and the gemcitabine single drug group could induce apoptosis, and the combined intervention group showed a synergistic pro-apoptotic effect Figure 14C, Figure 14 D) The above results show that silencing CSN6 can enhance the cell-killing effect of gemcitabine and improve the drug sensitivity of pancreatic cancer cells.

[0074] 4.3 CSN6 overexpression promotes gemcitabine resistance of pancreatic cancer cells

[0075] To explore the regulatory role of CSN6 in gemcitabine resistance, this study established a pancreatic cancer cell line stably overexpressing CSN6 by lentivirus transfection. The gemcitabine dose-response curve showed that the IC 50 curve of the CSN6 overexpression group was significantly right-shifted compared with the control group ( Figure 15 A), and the cell survival rate was significantly improved at a concentration of 500 nM ( Figure 15 B), indicating that CSN6 overexpression can enhance the gemcitabine resistance of pancreatic cancer cells. Based on the previous ribosome profiling analysis ( Figure 8 ), ribosome monomer subunits and polymeric subunits were separated by sucrose density gradient centrifugation, and RT-qPCR analysis of ribosome-bound mRNA showed that the transcript abundance of gemcitabine resistance genes such as CDA and RRM1 in the polymeric ribosome subunit was significantly increased compared with the control group ( Figure 15 C), suggesting that CSN6 may activate the translation of drug resistance mRNA by ribosomes, leading to gemcitabine resistance of pancreatic cancer cells.

[0076] 4.4 Targeting CSN6 inhibits pancreatic tumor growth and enhances the therapeutic effect of gemcitabine

[0077] To evaluate the effect of CSN6 on the in vivo efficacy of gemcitabine, a Tet-On inducible CSN6 knockdown pancreatic cancer mouse model was constructed. MiaPaCa-2 cells were infected with a lentivirus-mediated doxycycline-induced knockdown shRNA system, and after 7 days of 5 μg / mL puromycin pressure screening, a stable cell line was obtained, and then a human cell tumor xenograft model (CDX) was established. When the tumor volume reached 80 mm 3 , the tumor-bearing mice were randomly divided into four groups (n = 5 per group): blank control group (normal saline), gemcitabine monotherapy group (GEM, 50 mg / kg), doxycycline-induced knockdown group (Dox, 50 mg / kg), and combination therapy group (GEM + Dox, same doses), intraperitoneal injection of drugs every other day ( Figure 16 A). At the end of the experiment, the mice were euthanized by progressive asphyxiation with carbon dioxide, and anatomical analysis showed that the tumor volume of the gemcitabine monotherapy group (GEM) and the CSN6 knockdown group (Dox) showed a decreasing trend, and the tumor volume of the combination therapy group was significantly reduced compared with the control group ( Figure 16 B). Terminal tumor weight analysis showed that the average tumor weight of the combination group was significantly reduced compared with the monotherapy group, consistent with the trend of tumor volume changeFigure 16 C) Pathological analysis showed that the Ki67 positive cell rate tended to decrease in gemcitabine monotherapy group and CSN6 knockdown group, while the decrease was more significant in combination therapy group Figure 16 D, Figure 16 E) DNA damage response analysis showed that the number of γ-H2AX foci increased significantly in combination therapy group compared with control group and two monotherapy groups Figure 16 D, Figure 16 E) Notably, the staining intensity of CSN6 was higher in gemcitabine monotherapy group than in control group, which was consistent with the Western blot results of gemcitabine-resistant pancreatic cancer cell lines. The present application verified that conditional knockdown of CSN6 could significantly enhance the in vivo anti-tumor effect of gemcitabine through CDX model, suggesting that targeting CSN6 might become a new strategy to improve gemcitabine resistance in pancreatic cancer.

[0078] 5. NPM1 inhibitor NSC348884 inhibits pancreatic tumor growth and improves gemcitabine resistance

[0079] The present application aims to systematically evaluate the inhibitory effect of NPM1 specific inhibitor NSC348884 on the proliferation of pancreatic cancer and its potential mechanism for reversing gemcitabine resistance. Through in vitro and in vivo experiments, it is confirmed that NPM1 inhibitor NSC348884 can significantly inhibit the proliferation of pancreatic cancer cells and show synergistic anti-tumor effect when combined with gemcitabine. Mechanism studies show that this combination therapy may inhibit tumor cell proliferation and exacerbate DNA damage by blocking the activation of ribosome biogenesis pathway to achieve therapeutic synergistic effect.

[0080] 5.1 NSC348884 inhibits pancreatic cancer cell growth and enhances the killing effect of gemcitabine

[0081] To clarify the anti-tumor effect of NPM1 inhibitor, the present study first evaluated the effect of NSC348884 on the proliferation capacity of pancreatic cancer cells. The cell growth curve obtained by CCK-8 detection showed that the proliferation rate of cells in NSC348884 treatment group was significantly reduced Figure 17 A) Subsequent drug sensitivity experiments showed that the IC 50 curve of the inhibitor treatment group showed a characteristic left shift, indicating that NSC348884 can significantly enhance the chemosensitivity of pancreatic cancer cells to gemcitabine Figure 17 B) The above in vitro experimental data confirmed that targeting NPM1 not only effectively inhibited the proliferation of pancreatic cancer cells, but also significantly enhanced the chemosensitivity of gemcitabine.

[0082] 5.2 NSC348884 inhibits pancreatic tumor growth and enhances the therapeutic effect of gemcitabine

[0083] To evaluate the pharmacodynamic characteristics of NSC348884 in inhibiting pancreatic cancer growth in vivo and its synergistic effect with gemcitabine, a BXPC-3 cell line overexpressing CSN6 was constructed, and a BALB / c nude mouse xenograft model was established. The BXPC-3 cell line stably overexpressing CSN6 was obtained by pLVX_CSN6 lentivirus infection combined with puromycin screening. Subsequently, 10 7 μL of stable cell suspension was inoculated subcutaneously in nude mice to establish a human cell tumor xenograft model. When the tumor volume reached 80 mm 3 , the mice were randomly divided into four groups (n = 5 per group): control group (normal saline), gemcitabine group (50 mg / kg), NSC348884 group (5 mg / kg), and combination therapy group (GEM + NSC348884), with a every-other-day dosing regimen implemented by intraperitoneal injection Figure 18 . After euthanasia at the end of the experiment, tumor tissue was obtained, and morphological analysis showed that the single-agent treatment groups had significantly reduced tumor volume, while the tumor reduction effect was most significant in the combination therapy group Figure 18 . Tumor growth curves and terminal tumor weight analysis showed significant differences between the combination therapy group and the single-agent groups Figure 18 . This result suggests that NSC348884 not only has in vivo anti-tumor activity, but also enhances the therapeutic response of gemcitabine through a pharmacodynamic synergistic mechanism.

[0084] 5.3 Combined use of NSC348884 and gemcitabine can inhibit tumor ribosome biogenesis

[0085] Molecular mechanism research was conducted on the transplanted tumor tissue derived from BXPC-3 cells. RT-qPCR analysis showed that NSC348884 significantly reduced the content of pre-rRNA and mature rRNAs (5.8S rRNA, 18S rRNA, and 28S rRNA) in tumor tissue. Notably, the expression of the above ribosome biogenesis-related mRNAs was significantly upregulated in the gemcitabine single-agent group, while the combination therapy group could antagonize this effect Figure 19 A), suggesting that NSC348884 may exert a synergistic therapeutic effect by regulating key nodes of ribosome biogenesis. The above results explain the biological basis of NSC348884 in inhibiting tumor proliferation and enhancing the therapeutic response of gemcitabine from the molecular mechanism level.

[0086] Immunohistochemical analysis showed that all experimental group tumor tissues maintained the characteristics of high expression of CSN6 protein and low expression of DCAF1, indicating that the tumor model derived from stable cell line was successfully constructed. Further quantitative analysis showed that the expression intensity of NPM1 protein and its downstream transcriptional regulator UBTF1 in the NSC348884 treatment group was significantly down-regulated, suggesting that NSC348884 produced a pathway inhibition effect Figure 19 B). In addition, in the combination therapy group, the positive rate of proliferation marker Ki67 was significantly reduced, while the number of DNA damage marker γ-H2AX foci was significantly increased, suggesting that synergistic therapy can produce stronger proliferation inhibition and DNA damage induction effects.

[0087] The above experimental data suggests that the synergistic effect of NSC348884 and gemcitabine may involve a dual action mode: one is to inhibit the basic ribosome biogenesis; two is to target the blockage of compensatory activation of ribosome pathway induced by gemcitabine. This dual regulation strategy of steady-state inhibition and stress compensation blockage may destroy the biological homeostasis and compensatory potential of tumor cells, forming the molecular basis for synergistic inhibition of tumors.

Claims

1. Application of CSN6 inhibitors or NPM1 inhibitors in the preparation of drugs for treating pancreatic cancer.

2. The application as described in claim 1, characterized in that, The pancreatic cancer mentioned is pancreatic ductal carcinoma.

3. The application as described in claim 1, characterized in that, The NPM1 inhibitor is NSC348884, which is used to inhibit NPM1 polymerization.

4. The application as described in claim 1, characterized in that, The CSN6 inhibitor includes shRNA that interferes with the expression of the CSN6 gene.

5. Application of NPM1 inhibitors in combination with gemcitabine in the preparation of drugs for the treatment of pancreatic cancer.

6. Application of NPM1 inhibitors in the preparation of formulations that improve gemcitabine resistance in pancreatic cancer.

7. The application as described in claim 5 or 6, characterized in that, The NPM1 inhibitor is NSC348884.

8. A drug for treating pancreatic cancer, characterized in that, Including NPM1 inhibitors and gemcitabine.

9. The medicament as described in claim 8, characterized in that, The NPM1 inhibitor is NSC348884.

10. The medicament as claimed in claim 8, characterized in that, The pancreatic cancer mentioned is pancreatic ductal carcinoma.

Images