Application of GBP6 target in reversing gemcitabine resistance of cholangiocarcinoma cells

Abstract

The application discloses application of a GBP6 target in reversing gemcitabine drug resistance of cholangiocarcinoma cells, belongs to the technical field of tumor drugs, and particularly relates to a preparation method of a drug composition, which comprises the following steps: mixing a GBP6 inhibitor and gemcitabine to prepare a drug composition; the medicinal concentration of gemcitabine is 68.94-900 muM, and the GBP6 inhibitor comprises at least one of siRNA, shRNA, a small-molecule compound and a neutralizing antibody. The drug composition disclosed by the application can reduce the activity of gemcitabine drug-resistant cholangiocarcinoma cells, and the GBP6 disclosed in the application can be used as a marker of gemcitabine drug-resistant cholangiocarcinoma and can be used for predicting the treatment effect or the prognosis effect of gemcitabine drug-resistant cholangiocarcinoma.

Description

Technical Field

[0001] This invention belongs to the field of tumor drug technology, specifically relating to the application of the GBP6 target in reversing gemcitabine resistance in cholangiocarcinoma cells. Background Technology

[0002] Gemcitabine (GEM) is a first-line chemotherapy drug for the treatment of cholangiocarcinoma, but acquired resistance is the main cause of treatment failure. Currently, strategies to overcome gemcitabine resistance mainly focus on broad-spectrum chemosensitizers or targeting known pathways (such as EGFR, MEK, etc.), which have problems such as poor specificity and significant toxic side effects.

[0003] In existing technologies, research explores specific targets. Patent CN116870138A discloses a scheme to sensitize gemcitabine by upregulating the RNF152 protein. However, it mainly uses upstream regulation through methods such as "fasting simulation", which poses challenges to clinical feasibility and controllability. Moreover, RNF152 has a wide range of functions and is not specifically targeting drug resistance mechanisms. The intervention process may introduce unpredictable off-target risks.

[0004] Therefore, there is an urgent need in this field to discover and validate key genes that directly and specifically mediate gemcitabine resistance in cholangiocarcinoma, and to develop efficient and safe new strategies to reverse resistance by targeting these genes. Summary of the Invention

[0005] The purpose of this invention is to provide an application of the GBP6 target, which can reduce the activity of gemcitabine-resistant cholangiocarcinoma cells, serve as a marker for gemcitabine-resistant cholangiocarcinoma, and predict the treatment effect or prognosis of gemcitabine-resistant cholangiocarcinoma, in reversing gemcitabine resistance in cholangiocarcinoma cells.

[0006] The technical solution adopted by the present invention to achieve the above objectives is as follows:

[0007] A method for preparing a pharmaceutical composition includes: mixing a GBP6 inhibitor and gemcitabine to obtain the pharmaceutical composition; the pharmaceutical concentration of gemcitabine is 68.94-900 μM. This invention discloses that GBP6 has the advantage of strong target novelty, and its function in cholangiocarcinoma drug resistance is the first of its kind revealed globally. This invention has the advantages of a clear mechanism and a clear causal relationship. Through multi-omics screening, and verification through a complete functional experimental chain of "expression verification," "overexpression-induced drug resistance," and "knockdown-reversed drug resistance," the direct causal relationship between GBP6 and drug resistance has been demonstrated, with solid scientific evidence. This invention has the advantages of high efficiency and specificity; targeting GBP6 can specifically reverse the drug resistance pathway mediated by it, and the expected toxic side effects are less than those of broad-spectrum inhibitors. Experimental data show that knockdown of GBP6 can significantly reduce the survival rate of drug-resistant cells.

[0008] Preferably, the GBP6 inhibitor includes at least one of siRNA, shRNA, small molecule compounds, and neutralizing antibodies.

[0009] Preferably, a pharmaceutical solvent is also added to the pharmaceutical composition.

[0010] Preferably, the GBP6 inhibitor includes a feruloyl folin ester derivative. This invention prepares a feruloyl folin ester derivative by reacting feruloyl chloride hydrochloride and folin alcohol. When applied to gemcitabine-resistant cholangiocarcinoma cells, it can inhibit the expression of GBP6 in these cells, indicating that the feruloyl folin ester derivative can act as a GBP6 inhibitor. However, the feruloyl folin ester derivative needs to be used at a certain dosage; if the dosage is too low, it will not effectively reduce the activity of gemcitabine-resistant cholangiocarcinoma cells when used in combination with gemcitabine.

[0011] More preferably, the feruloyl leaf alcohol ester derivative is prepared by reacting feruloyl chloride hydrochloride and leaf alcohol, and the feruloyl chloride hydrochloride is prepared by reacting ferulic acid and thionyl chloride.

[0012] Preferably, in the preparation of feruloyl chloride hydrochloride, the temperature is controlled at 0-5℃, thionyl chloride is mixed with ferulic acid, then DMF is added, and the mixture is stirred at 60-75℃ for 2-12 hours. After the reaction is completed, the mixture is concentrated under reduced pressure to remove thionyl chloride, then dichloromethane is added, and the mixture is stirred and filtered at 20-40℃ to obtain feruloyl chloride hydrochloride.

[0013] More preferably, in the preparation of ferulic acid hydrochloride, the amount of ferulic acid used is 10-30 wt% of thionyl chloride.

[0014] More preferably, in the preparation of feruloyl chloride hydrochloride, the amount of DMF used is 5-20 wt% of thionyl chloride.

[0015] More preferably, in the preparation of feruloyl chloride hydrochloride, an appropriate amount of dichloromethane can be used.

[0016] Preferably, in the preparation of the feruloyl leaf alcohol ester derivative, feruloyl chloride hydrochloride is mixed with acetone, then triethylamine and leaf alcohol are added, and the mixture is reacted at 20-40°C for 6-24 hours. After the reaction is completed, the mixture is filtered, the filtrate is concentrated, and then dissolved in dichloromethane. The mixture is washed successively with saturated sodium bicarbonate solution and saturated sodium chloride solution, dried with anhydrous magnesium sulfate, filtered, the filtrate is concentrated, and the product is purified by silica gel column chromatography to obtain the feruloyl leaf alcohol ester derivative.

[0017] More preferably, in the preparation of the feruloyl leaf ester derivative, the amount of feruloyl chloride hydrochloride used is 2-6 wt% of acetone.

[0018] More preferably, in the preparation of the feruloyl leaf ester derivative, the amount of triethylamine used is 1000-2000 wt% of feruloyl chloride hydrochloride.

[0019] More preferably, in the preparation of the feruloyl leaf alcohol ester derivative, the amount of leaf alcohol used is 50-100 wt% of feruloyl chloride hydrochloride.

[0020] More preferably, in the preparation of the feruloyl ester derivative, dichloromethane, saturated sodium bicarbonate solution and saturated sodium chloride solution are used in appropriate amounts.

[0021] More preferably, the mass ratio of GBP6 inhibitor to gemcitabine is 1:5-50.

[0022] More preferably, the mass ratio of feruloyl folin ester derivative to gemcitabine is 1:5-50.

[0023] This invention discloses the use of GBP6 inhibitors in the preparation of drugs for reversing gemcitabine resistance in cholangiocarcinoma cells.

[0024] This invention discloses the application of GBP6 as a biomarker in predicting gemcitabine sensitivity or patient prognosis in cholangiocarcinoma.

[0025] Preferably, GBP6 is highly expressed.

[0026] Preferably, GBP6 is highly expressed, and the prediction result of high GBP6 expression includes any of the following:

[0027] Result (1): Cholangiocarcinoma has low sensitivity to gemcitabine;

[0028] Result (2) Bile duct cancer has a poor prognosis for patients.

[0029] Preferably, nicotinic acid glycine may also be added to the pharmaceutical composition, with the mass ratio of nicotinic acid glycine to gemcitabine being 1:10-100. When using ferulic acid leaf ester derivatives and gemcitabine as the pharmaceutical composition, the present invention may further add nicotinic acid glycine. Using ferulic acid leaf ester derivatives, nicotinic acid glycine, and gemcitabine as the pharmaceutical composition can further reduce the activity of gemcitabine-resistant cholangiocarcinoma cells.

[0030] This invention is the first to discover and confirm, through multi-omics analysis, that GBP6 is a key gene driving gemcitabine resistance in cholangiocarcinoma.

[0031] This invention provides a novel treatment method to reverse gemcitabine resistance in cholangiocarcinoma by inhibiting GBP6 expression.

[0032] This invention discloses the application of GBP6 as a biomarker in predicting gemcitabine sensitivity or patient prognosis in cholangiocarcinoma.

[0033] This invention discloses the use of GBP6 inhibitors in the preparation of drugs for reversing gemcitabine resistance in cholangiocarcinoma cells.

[0034] This invention discloses a pharmaceutical composition for treating cholangiocarcinoma, comprising gemcitabine and a GBP6 inhibitor.

[0035] This invention discloses a GBP6 inhibitor selected from siRNA, shRNA, small molecule compounds, and neutralizing antibodies. For example, shRNA includes CMV-F and WPRE-R, where the sequence of CMV-F is CGCAAATGGGCGGTAGGCGTG, as shown in SEQ ID NO.1; and the sequence of WPRE-R is CATAGCGTAAAAGGAGCAACA, as shown in SEQ ID NO.2.

[0036] This invention discloses a kit for detecting GBP6 expression levels, which can be used to predict chemotherapy sensitivity or prognosis.

[0037] This invention has the advantage of great potential for clinical translation. The expression level of GBP6 is significantly correlated with patient prognosis, making it not only a therapeutic target but also a biomarker for companion diagnostics to guide personalized treatment, with broad market application prospects.

[0038] This invention discloses different molecular strategies for targeting GBP6. In addition to using shRNA / siRNA, small molecule inhibitors, peptide inhibitors, or neutralizing monoclonal antibodies that target specific functional domains of the GBP6 protein (such as the GTP binding domain) can also be developed.

[0039] This invention discloses an expansion of combination therapy. The GBP6 inhibitor in this invention can not only be used in combination with gemcitabine, but also in combination with other first-line chemotherapy drugs such as cisplatin, albumin-bound paclitaxel, or immune checkpoint inhibitors to overcome a wider range of drug resistance types.

[0040] This invention discloses gene editing therapy, which, in addition to transient knockdown, can also use technologies such as CRISPR-Cas9 to permanently knock out the GBP6 gene in vitro or in vivo as a potential therapy.

[0041] This invention verifies the high expression of GBP6 in gemcitabine-resistant cholangiocarcinoma cells, and demonstrates that knocking down the high expression of GBP6 followed by using gemcitabine at an IC50 concentration can inhibit the activity of gemcitabine-resistant cholangiocarcinoma cells, indicating that reducing GBP6 expression can improve the efficacy of gemcitabine. This invention is derived from the reaction of feruloyl chloride hydrochloride and ferulin. Feruloyl chloride hydrochloride is a feruloyl ferulin ester derivative obtained by reacting ferulic acid and sulfoxide. The feruloyl ferulin ester derivative can reduce GBP6 expression. Using the feruloyl ferulin ester derivative in combination with gemcitabine as a pharmaceutical composition can also reduce the activity of gemcitabine-resistant cholangiocarcinoma cells, thus having the following beneficial effects: The pharmaceutical composition of this invention can reduce the activity of gemcitabine-resistant cholangiocarcinoma cells. Therefore, this invention relates to the application of the GBP6 target, which can reduce the activity of gemcitabine-resistant cholangiocarcinoma cells, serve as a marker for gemcitabine-resistant cholangiocarcinoma, and predict the treatment effect or prognosis of gemcitabine-resistant cholangiocarcinoma, in reversing gemcitabine resistance in cholangiocarcinoma cells. Attached Figure Description

[0042] Figure 1 Cell survival curves for HUCCT1 and HUCCT-1 / GEM.

[0043] Figure 2 Cell survival curves for RBE and RBE / GEM.

[0044] Figure 3 Venn diagram of the intersection of RNA-seq and proteomics.

[0045] Figure 4 This volcano plot illustrates the differential expression of intersecting genes at the mRNA and protein levels.

[0046] Figure 5 This is a heatmap of candidate gene expression in proteomics and a graph showing transcriptional level analysis in the TCGA-CHOL database.

[0047] Figure 6 Survival curves showing the relationship between high GBP6 expression and shortened overall survival in patients with cholangiocarcinoma.

[0048] Figure 7 This is a validation diagram showing the significant upregulation of GBP6 mRNA and protein expression levels in gemcitabine-resistant cell lines.

[0049] Figure 8 This is a functional validation plot for GBP6 overexpression and knockdown in the HUCCT1 / GEM model.

[0050] Figure 9 A functional validation plot for GBP6 overexpression and knockdown in the RBE / GEM model.

[0051] Figure 10 This is a representation diagram of GBP6.

[0052] Figure 11 This is a graph showing the cell viability of HUCCT1 / GEM cells.

[0053] Figure 12 This is a cell viability graph from RBE / GEM. Detailed Implementation

[0054] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0055] The concepts involved in this application will first be described with reference to the accompanying drawings. It should be noted that the following descriptions of various concepts are only for the purpose of making the content of this application easier to understand and do not constitute a limitation on the scope of protection of this application; furthermore, the embodiments and features in the embodiments of this application can be combined with each other unless otherwise specified. This application will now be described in detail with reference to the accompanying drawings and embodiments.

[0056] This invention, through multi-omics analysis (RNA-seq and proteomics) and functional experiments, has for the first time discovered and confirmed that guanylate-binding protein 6 (GBP6) is a key gene driving gemcitabine resistance in cholangiocarcinoma. Inhibiting GBP6 expression can significantly reverse gemcitabine resistance in cholangiocarcinoma cells.

[0057] The research content of this invention is based on the following:

[0058] I. Methods Used in the Research

[0059] 1. CCK-8 assay: HUCCT1 cells, HUCCT1 / GEM cells, RBE cells, and RBE / GEM cells in logarithmic growth phase were cultured at 5 × 10⁶ cells per well. 3Cells were seeded at a rate of [number] cells / well in 96-well plates and cultured overnight or for 24 hours to ensure cell adhesion or stable growth. Negative and positive control groups were set up, and gemcitabine drug solutions were prepared at different concentration gradients of 0, 12.5, 25, 50, 100, 200, 400, and 800 μM, with three replicates for each concentration. The old culture medium was removed from the 96-well plates, and fresh culture medium containing different drug concentrations was added to each well (100 μL). The drug-treated cells were incubated at 37°C in a 5% CO2 incubator for 24 hours. After incubation, 10 μL of CCK-8 reagent was added to each well, the 96-well plate was gently shaken to mix, and then incubated at 37°C for 2 hours. After incubation, the absorbance (OD value) of each well was measured using a microplate reader at a wavelength of 450 nm.

[0060] 2. RNA Sequencing Methods: Following the instructions, total RNA extraction reagent (TRIzol) was used to isolate and purify RNA from non-drug-resistant HUCCT1 cholangiocarcinoma cells and drug-resistant HUCCT1-GEM cells, respectively. After determining the concentration, the RNA was denatured. mRNA was enriched using oligo(dT) magnetic beads (Dynabeads Oligo(dT), Thermo Fisher), and then fragmented under high temperature conditions using a magnesium fragmentation kit (NEBNext® Magnesium RNA Fragmentation Module) at 86°C for 7 minutes. A one-strand reaction system was set up to synthesize one-stranded cDNA. A two-strand reaction system was set up to synthesize two-stranded cDNA. End repair, addition of an "A" base, and adapter ligation were performed. The reaction program was set to add an "A" base to the 3' end and repair the double-stranded cDNA ends, allowing the adapter to ligate to the cDNA. PCR was then performed to form a sequencing library. The program was as follows: pre-denaturation at 95°C for 3 minutes, followed by 8 cycles of 15-second denaturation at 98°C, annealing at 60°C for 15 seconds, extension at 72°C for 30 seconds, and a final extension at 72°C for 5 minutes. Finally, paired-end sequencing was performed using an Illumina Novaseq™ 6000 according to standard procedures in PE150 mode.

[0061] 3. Proteomics sequencing:

[0062] Denaturation & Reduction & Alkylation: Using the Barocycler high-pressure sample pretreatment system, add 30 μL of lysis buffer (6 M urea, 2 M thiourea) to each tube, then add 5 μL of 0.2 M TCEP and 2.5 μL of 0.8 M IAA, and make up to 12.5 μL of 0.1 M TEAB; parameters are set to 45 psi, 30 seconds of high pressure; 10 seconds of atmospheric pressure, 90 pressure cycles, 30°C.

[0063] Enzymatic digestion: Using the Barocycler high-pressure sample pretreatment system, 100 μg / vial of trypsin was dissolved in 200 μL of 1 mM HCl or 50 mM HAC (trypsin concentration 0.5 μg / μL); 50 μg of rLys-C protease was dissolved in 100 μL of 1 mM HCl or 50 mM HAC (trypsin concentration 0.5 μg / μL). 75 μL of 0.1 M TEAB was added to each tube, followed by 5 μg (10 μL) of trypsin and 1.25 μg (2.5 μL) of rLys-C protease. The volume was then brought to the final volume with 0.1 M TEAB. The pH was set to 8. The parameters were set to 20 psi, 50 seconds of high-pressure treatment, 10 seconds of atmospheric pressure, 120 pressure cycles, and 30°C.

[0064] Termination of enzymatic digestion: Using a 1.5 mL centrifuge tube, transfer the sample to a 1.5 mL EP tube, add 15 μL of 10% TFA solution to each tube to make the final TFA concentration 1%; set the parameters to check the pH 2-3.

[0065] Desalting: SOLAμ solid-phase extraction was performed using SPE plates (Thermo Fisher Scientific™, San Jose, USA). The desalting column was activated with 200 μL MeOH × 2 times; equilibrated with 200 μL 80% ACN and 0.1% TFA × 2 times; washed with 200 μL 2% ACN and 0.1% TFA × 2 times; after sample loading, desalted with 200 μL 2% ACN and 0.1% TFA × 10 times; the sample was collected with 100 μL 40% ACN and 0.1% TFA × 2 times, centrifuged at 40°C and below 10 mBar until dry, reconstituted, and peptide content was measured at A280 wavelength. Parameter settings are detailed in the manufacturer's (Thermo Fisher Scientific™, San Jose, USA) operating instructions.

[0066] TMT labeling: Using 0.6 mL EP tubes / TMTpro 16plex labeling reagent kit, take an equal amount of 7 μg peptide from each sample, centrifuge and concentrate until dry, reconstitute, and add 42 μg TMT reagent (2.1 μL, 20 μg / μL) to label the sample. The sample to TMT ratio is 1:6. The parameters are set to 25℃, 90 min, and 1200 rpm.

[0067] Stop mark: Using a 0.6 mL EP tube, add 0.5 μL of 5% hydroxylamine; parameters set to 25℃, 15 min, 600 rpm.

[0068] Fractionation: Using a DIONX UltiMate 3000 analysis system (Thermo Scientific™, San Jose, USA) and an XBridge Peptide BEH C18 column (300 Å, 5 μm × 4.6 mm × 250 mm, Waters, Milford, MA, USA), TMT-labeled samples were pooled according to a batch design and then fractionated using 10 mM ammonium hydroxide solution (pH=10.0) in acetonitrile. The parameters were set to fractionate the peptides into 60 fractions in 10 mM ammonium hydroxide solution (pH=10.0) at a flow rate of 0.5 mL / min with 5% to 35% acetonitrile. These fractions were then combined into 15 fractions, dried, and reconstituted with 98% H2O, 2% ACN, and 0.1% formic acid before mass spectrometry acquisition.

[0069] 4. Protein Immunoblotting Method: After collecting cells, RIPA lysis buffer was added, and the cells were lysed on ice for 30 min. The cells were then centrifuged at 16000 g at 4°C for 15 min. The supernatant was collected, and the protein content was determined by BCA. Equal amounts of protein from different samples were used to separate proteins by SDS-PAGE. After electrophoresis, the proteins were transferred to a PVDF membrane, blocked with 5% skim milk powder, and then blocked overnight with primary antibodies (GBP6 protein, GAPDH protein). The membrane was then blocked for 2 h with horseradish peroxidase-labeled secondary antibody blocking buffer, and developed with diaminobenzidine (DAB) solution for color development and scanning analysis.

[0070] II. Research on GBP6

[0071] 1. Construction of drug resistance models and screening of key genes:

[0072] Using a concentration gradient escalation method, gemcitabine-resistant human cholangiocarcinoma cell lines HUCCT1 / GEM and RBE / GEM were successfully constructed over a period of 12 months. Both HUCCT1 / GEM and RBE / GEM cells were maintained in 10 μmol / L GEM medium. CCK-8 assays were performed on HUCCT1, HUCCT1 / GEM, RBE, and RBE / GEM human cholangiocarcinoma gemcitabine-resistant cells. The CCK-8 assay results are as follows: Figure 1-2 As shown in Table 1-2, the IC50 of the drug-resistant strains was confirmed. 50 The drug resistance index (RI) was significantly higher than that of the parent cells. Figure 1 In Figure A, the IC50 value of HUCCT1 cells against GEM drug was detected by the CCK-8 assay. Figure 1 In Figure B, the IC50 value of HUCCT1 / GEM resistant cells against GEM drug was detected by the CCK-8 assay. Figure 2In Figure A, the IC50 value of RBE cells to GEM drug was detected by the CCK-8 assay. Figure 2 In Figure B, the IC50 value of RBE / GEM resistant cells against GEM drug was detected by the CCK-8 assay.

[0073] Table 1. IC50 of drug-resistant cholangiocarcinoma cells HUCCT1 / GEM 50 and RI value

[0074]

[0075] Table 2. IC50 of drug-resistant cholangiocarcinoma cells RBE / GEM 50 and RI value

[0076]

[0077] RNA sequencing and proteomics analysis were performed on HUCCT1 and HUCCT1 / GEM cells. Five key candidate genes were screened using Venn diagram intersection analysis: GBP6, CLYBL, SERPINB3, H1-5, and LAMA2. The results are as follows: Figure 3 As shown in the diagram. The volcano plot illustrates the differences in expression of intersecting genes at the mRNA and protein levels, as shown in the diagram. Figure 4 As shown, Figure 4 In the middle, A represents a volcano plot showing differentially varied RNA sequences in the RNA sequencing results; Figure 4 The volcano plot in section B shows proteins with differential changes in the proteomics analysis results.

[0078] Comprehensive protein expression heatmap as follows Figure 5 As shown in Figure A, the abundance of five key candidate genes in proteomics analysis results is presented; transcriptomics analysis from the TCGA-CHOL database is shown below. Figure 5 Figure B shows the RNA expression levels of five key candidate genes in the TCGA-CHOL database. GBP6 was found to be significantly highly expressed in both drug-resistant cells and cholangiocarcinoma tissues, and its high expression was significantly associated with poor patient prognosis. Figure 6 As shown, GBP6 was therefore identified as the core key gene.

[0079] 2. Verification of GBP6 upregulation in drug-resistant cells:

[0080] At both the mRNA and protein levels, it was confirmed that the expression level of GBP6 in gemcitabine-resistant cell lines (HUCCT1 / GEM and RBE / GEM) was significantly higher than that in their parental cells. Figure 7 As shown, the positive correlation between GBP6 and drug resistance is clearly established at the expression level. Figure 7 In the middle A, the mRNA expression level of GBP6 in HUCCT-1 and HUCCT-1 / GEM cells is represented. Figure 7B represents the mRNA expression level of GBP6 in RBE and RBE / GEM cells; Figure 7 In the middle C, Western blotting was used to show the protein expression level of GBP6 in HUCCT-1 and HUCCT-1 / GEM cells; Figure 7 Western blot analysis was used to visualize the protein expression level of GBP6 in RBE and RBE / GEM cells.

[0081] 3. GBP6 Functional Verification (Core Experimental Evidence):

[0082] Overexpression induces drug resistance: After overexpressing GBP6 in parental cells (HUCCT1 and RBE), IC50 was used to induce drug resistance. 50 Treatment with high concentrations of GEM significantly increased cell viability compared to the control group. Figure 8-9 As shown, GBP6 overexpression is sufficient to induce gemcitabine resistance phenotype. Figure 8 In section A, Western blotting was used to verify the overexpression of GBP6 protein in HUCCT-1 cells. Figure 8 The bar chart in section B shows the cell viability of the GEM-treated control and the HUCCT-1 cells overexpressing GBP6. Figure 9 In section A, Western blotting was used to verify the overexpression of GBP6 protein in RBE cells; Figure 9 The B-bar chart shows the cell survival rate of the GEM-treated control and the RBE cells overexpressing GBP6.

[0083] Knockdown reverses drug resistance: After knocking down GBP6 with shRNA in drug-resistant cells (HUCCT1 / GEM and RBE / GEM), IC50 was used to reverse the drug resistance. 50 Treatment with high concentrations of GEM significantly reduced cell viability, such as Figure 8-9 As shown, inhibiting GBP6 can effectively reverse drug resistance and restore cell sensitivity to gemcitabine. Figure 8 In the middle C, Western blot was used to verify the knockdown of GBP6 protein in HUCCT-1 / GEM drug-resistant cells. Figure 8 The bar chart in section D shows the cell survival rate of GEM-treated control cells and GBP6-knockdown HUCCT-1 / GEM-resistant cells. Figure 9 In the middle C, the knockdown of GBP6 protein in RBE / GEM resistant cells was verified by Western blotting. Figure 9 The bar chart in section D shows the cell survival rate of the GEM-treated control and the RBE / GEM-resistant cells with GBP6 knockdown.

[0084] 4. Strategies targeting GBP6:

[0085] This invention provides a method and composition for reversing gemcitabine resistance in cholangiocarcinoma targeting GBP6.

[0086] Treatment Implementation Plan: To provide a GBP6 inhibitor for use in combination with gemcitabine to treat cholangiocarcinoma. The inhibitor is selected from: siRNA, shRNA, antisense oligonucleotides, CRISPR-Cas9 gene editing systems, or small molecule compounds, peptides, or antibodies that can bind to and inhibit the function of the GBP6 protein targeting GBP6.

[0087] Diagnostic or predictive implementation plan: Detect the expression level of GBP6 in cholangiocarcinoma tissues or cells. High expression can serve as a biomarker for predicting gemcitabine resistance and poor patient prognosis.

[0088] Example 1: A GBP6 inhibitor

[0089] GBP6 inhibitors: siRNAs that target GBP6.

[0090] Example 2: A GBP6 inhibitor

[0091] GBP6 inhibitors: shRNAs that target GBP6, including CMV-F: CGCAAATGGGCGGTAGGCGTG and WPRE-R: CATAGCGTAAAAGGAGCAACA.

[0092] Example 3: A GBP6 inhibitor

[0093] GBP6 inhibitors: antisense oligonucleotides that target GBP6.

[0094] Example 4: A GBP6 inhibitor

[0095] GBP6 inhibitors: CRISPR-Cas9 gene editing systems that target GBP6.

[0096] Example 5: A GBP6 inhibitor

[0097] GBP6 inhibitors: peptides that can bind to and inhibit the function of the GBP6 protein.

[0098] Example 6: A GBP6 inhibitor

[0099] GBP6 inhibitors: Antibodies that can bind to and inhibit the function of the GBP6 protein.

[0100] Example 7: A pharmaceutical composition

[0101] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is the siRNA targeting GBP6 described in Example 1.

[0102] Example 8: A pharmaceutical composition

[0103] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is the shRNA targeting GBP6 described in Example 2.

[0104] Example 9: A pharmaceutical composition

[0105] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is the antisense oligonucleotide targeting GBP6 described in Example 3.

[0106] Example 10: A pharmaceutical composition

[0107] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is the GBP6-targeting CRISPR-Cas9 gene editing system described in Example 4.

[0108] Example 11: A pharmaceutical composition

[0109] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is the polypeptide in Example 5 that can bind to and inhibit the function of the GBP6 protein.

[0110] Example 12: A pharmaceutical composition

[0111] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is the antibody described in Example 6 that can bind to and inhibit the function of the GBP6 protein.

[0112] Example 13: A pharmaceutical composition

[0113] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is a ferulic acid ester derivative. The mass ratio of GBP6 inhibitor to gemcitabine is 1:10.

[0114] Preparation of feruloyl chloride hydrochloride: At 0°C, thionyl chloride and ferulic acid were mixed, then DMF was added. The mixture was stirred at 70°C for 6 hours. After the reaction was complete, the mixture was concentrated under reduced pressure to remove thionyl chloride. Then, dichloromethane was added, and the mixture was stirred and filtered at 30°C to obtain feruloyl chloride hydrochloride. The amount of ferulic acid used was 20 wt% of thionyl chloride, the amount of DMF used was 10 wt% of thionyl chloride, and an appropriate amount of dichloromethane was used.

[0115] Preparation of feruloyl leaf alcohol ester derivative: Feruloyl chloride hydrochloride was mixed with acetone, then triethylamine and leaf alcohol were added, and the mixture was reacted at 30°C for 12 h. After the reaction was completed, the mixture was filtered, the filtrate was concentrated, and then dissolved in dichloromethane. The solution was washed successively with saturated sodium bicarbonate solution and saturated sodium chloride solution, dried over anhydrous magnesium sulfate, filtered, and the filtrate was concentrated. The product was purified by silica gel column chromatography to obtain the feruloyl leaf alcohol ester derivative. The amount of feruloyl chloride hydrochloride used was 4 wt% of acetone, the amount of triethylamine used was 1600 wt% of feruloyl chloride hydrochloride, and the amount of leaf alcohol used was 80 wt% of feruloyl chloride hydrochloride. Dichloromethane, saturated sodium bicarbonate solution, and saturated sodium chloride solution were all used in appropriate amounts.

[0116] Example 14: A pharmaceutical composition

[0117] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is a ferulic acid ester derivative. The mass ratio of GBP6 inhibitor to gemcitabine is 1:40.

[0118] Preparation of feruloyl chloride hydrochloride: At 0°C, thionyl chloride and ferulic acid were mixed, then DMF was added. The mixture was stirred at 70°C for 6 hours. After the reaction was complete, the mixture was concentrated under reduced pressure to remove thionyl chloride. Then, dichloromethane was added, and the mixture was stirred and filtered at 30°C to obtain feruloyl chloride hydrochloride. The amount of ferulic acid used was 20 wt% of thionyl chloride, the amount of DMF used was 10 wt% of thionyl chloride, and an appropriate amount of dichloromethane was used.

[0119] Preparation of feruloyl leaf alcohol ester derivative: Feruloyl chloride hydrochloride was mixed with acetone, then triethylamine and leaf alcohol were added, and the mixture was reacted at 30°C for 12 h. After the reaction was completed, the mixture was filtered, the filtrate was concentrated, and then dissolved in dichloromethane. The solution was washed successively with saturated sodium bicarbonate solution and saturated sodium chloride solution, dried over anhydrous magnesium sulfate, filtered, and the filtrate was concentrated. The product was purified by silica gel column chromatography to obtain the feruloyl leaf alcohol ester derivative. The amount of feruloyl chloride hydrochloride used was 4 wt% of acetone, the amount of triethylamine used was 1600 wt% of feruloyl chloride hydrochloride, and the amount of leaf alcohol used was 80 wt% of feruloyl chloride hydrochloride. Dichloromethane, saturated sodium bicarbonate solution, and saturated sodium chloride solution were all used in appropriate amounts.

[0120] Example 15: A pharmaceutical composition

[0121] Pharmaceutical composition: GBP6 inhibitor, nicotinic acid glycine, and gemcitabine. The GBP6 inhibitor is a ferulic acid ester derivative. The mass ratio of GBP6 inhibitor to gemcitabine is 1:10, and the mass ratio of nicotinic acid glycine to gemcitabine is 1:20.

[0122] Preparation of feruloyl chloride hydrochloride: At 0°C, thionyl chloride and ferulic acid were mixed, then DMF was added. The mixture was stirred at 70°C for 6 hours. After the reaction was complete, the mixture was concentrated under reduced pressure to remove thionyl chloride. Then, dichloromethane was added, and the mixture was stirred and filtered at 30°C to obtain feruloyl chloride hydrochloride. The amount of ferulic acid used was 20 wt% of thionyl chloride, the amount of DMF used was 10 wt% of thionyl chloride, and an appropriate amount of dichloromethane was used.

[0123] Preparation of feruloyl leaf alcohol ester derivative: Feruloyl chloride hydrochloride was mixed with acetone, then triethylamine and leaf alcohol were added, and the mixture was reacted at 30°C for 12 h. After the reaction was completed, the mixture was filtered, the filtrate was concentrated, and then dissolved in dichloromethane. The solution was washed successively with saturated sodium bicarbonate solution and saturated sodium chloride solution, dried over anhydrous magnesium sulfate, filtered, and the filtrate was concentrated. The product was purified by silica gel column chromatography to obtain the feruloyl leaf alcohol ester derivative. The amount of feruloyl chloride hydrochloride used was 4 wt% of acetone, the amount of triethylamine used was 1600 wt% of feruloyl chloride hydrochloride, and the amount of leaf alcohol used was 80 wt% of feruloyl chloride hydrochloride. Dichloromethane, saturated sodium bicarbonate solution, and saturated sodium chloride solution were all used in appropriate amounts.

[0124] Example 16: A pharmaceutical composition

[0125] Pharmaceutical composition: GBP6 inhibitor, nicotinic acid glycine, and gemcitabine. The GBP6 inhibitor is a ferulic acid ester derivative. The mass ratio of GBP6 inhibitor to gemcitabine is 1:10, and the mass ratio of nicotinic acid glycine to gemcitabine is 1:90.

[0126] Preparation of feruloyl chloride hydrochloride: At 0°C, thionyl chloride and ferulic acid were mixed, then DMF was added. The mixture was stirred at 70°C for 6 hours. After the reaction was complete, the mixture was concentrated under reduced pressure to remove thionyl chloride. Then, dichloromethane was added, and the mixture was stirred and filtered at 30°C to obtain feruloyl chloride hydrochloride. The amount of ferulic acid used was 20 wt% of thionyl chloride, the amount of DMF used was 10 wt% of thionyl chloride, and an appropriate amount of dichloromethane was used.

[0127] Preparation of feruloyl leaf alcohol ester derivative: Feruloyl chloride hydrochloride was mixed with acetone, then triethylamine and leaf alcohol were added, and the mixture was reacted at 30°C for 12 h. After the reaction was completed, the mixture was filtered, the filtrate was concentrated, and then dissolved in dichloromethane. The solution was washed successively with saturated sodium bicarbonate solution and saturated sodium chloride solution, dried over anhydrous magnesium sulfate, filtered, and the filtrate was concentrated. The product was purified by silica gel column chromatography to obtain the feruloyl leaf alcohol ester derivative. The amount of feruloyl chloride hydrochloride used was 4 wt% of acetone, the amount of triethylamine used was 1600 wt% of feruloyl chloride hydrochloride, and the amount of leaf alcohol used was 80 wt% of feruloyl chloride hydrochloride. Dichloromethane, saturated sodium bicarbonate solution, and saturated sodium chloride solution were all used in appropriate amounts.

[0128] Comparative Example 1: A pharmaceutical composition

[0129] Pharmaceutical composition: GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is a ferulic acid ester derivative. The mass ratio of GBP6 inhibitor to gemcitabine is 1:1000.

[0130] Preparation of feruloyl chloride hydrochloride: At 0°C, thionyl chloride and ferulic acid were mixed, then DMF was added. The mixture was stirred at 70°C for 6 hours. After the reaction was complete, the mixture was concentrated under reduced pressure to remove thionyl chloride. Then, dichloromethane was added, and the mixture was stirred and filtered at 30°C to obtain feruloyl chloride hydrochloride. The amount of ferulic acid used was 20 wt% of thionyl chloride, the amount of DMF used was 10 wt% of thionyl chloride, and an appropriate amount of dichloromethane was used.

[0131] Preparation of feruloyl leaf alcohol ester derivative: Feruloyl chloride hydrochloride was mixed with acetone, then triethylamine and leaf alcohol were added, and the mixture was reacted at 30°C for 12 h. After the reaction was completed, the mixture was filtered, the filtrate was concentrated, and then dissolved in dichloromethane. The solution was washed successively with saturated sodium bicarbonate solution and saturated sodium chloride solution, dried over anhydrous magnesium sulfate, filtered, and the filtrate was concentrated. The product was purified by silica gel column chromatography to obtain the feruloyl leaf alcohol ester derivative. The amount of feruloyl chloride hydrochloride used was 4 wt% of acetone, the amount of triethylamine used was 1600 wt% of feruloyl chloride hydrochloride, and the amount of leaf alcohol used was 80 wt% of feruloyl chloride hydrochloride. Dichloromethane, saturated sodium bicarbonate solution, and saturated sodium chloride solution were all used in appropriate amounts.

[0132] Experimental example:

[0133] This invention tested the inhibition of GBP6 in gemcitabine-resistant human cholangiocarcinoma cells by the feruloyl folin ester derivative prepared in Example 13. RBE / GEM cells were selected as the human cholangiocarcinoma cells. RBE / GEM cells cultured in 10 μmol / L GEM medium served as the control group. The test group was prepared by adding the feruloyl folin ester derivative to the control group at a concentration of 0.36 mg / L. The expression of GBP6 in RBE / GEM cells was detected, and the results are as follows: Figure 10 As shown, this indicates that the feruloyl folin ester derivative can inhibit the expression of GBP6 in RBE / GEM.

[0134] In this invention, the drug compositions from Examples 13-16 and Comparative Example 1 were added to the culture medium of gemcitabine-resistant human cholangiocarcinoma cells HUCCT1 / GEM to test the effect of the drug compositions on HUCCT1 / GEM, while maintaining the gemcitabine content in the drug compositions at 1C. 50 To determine the concentration, a control group was set up, in which only IC50 was used. 50 Concentrations of gemcitabine, results as follows Figure 11As shown, this invention verifies that ferulic foliol ester derivatives can inhibit GBP6 expression. When ferulic foliol ester derivatives are used in combination with gemcitabine, compared to the control group, the cell activity of HUCCT1 / GEM cells is reduced. The ferulic foliol ester derivative needs to be used within a certain dosage range, and the higher the dosage of the ferulic foliol ester derivative, the stronger the inhibitory effect on HUCCT1 / GEM cell activity. However, if the dosage of the ferulic foliol ester derivative is too low, it cannot effectively reduce the cell activity of HUCCT1 / GEM cells. In addition to using ferulic foliol ester derivatives and gemcitabine, nicotinic acid glycine can be further added. The combined use of ferulic foliol ester derivatives, nicotinic acid glycine, and gemcitabine can further reduce the cell activity of HUCCT1 / GEM cells.

[0135] In this invention, the drug compositions from Examples 13-16 and Comparative Example 1 were added to the culture medium of gemcitabine-resistant human cholangiocarcinoma cells RBE / GEM to test the effect of the drug compositions on RBE / GEM, while maintaining the gemcitabine content in the drug compositions at 1C. 50 To determine the concentration, a control group was set up, in which only IC50 was used. 50 Concentrations of gemcitabine, results as follows Figure 12 As shown, this invention verifies that ferulic foliol ester derivatives can inhibit GBP6 expression. When ferulic foliol ester derivatives are used in combination with gemcitabine, compared to the control group, the cell activity of RBE / GEM is reduced. The ferulic foliol ester derivative needs to be used within a certain dosage range, and the higher the dosage of the ferulic foliol ester derivative, the stronger the inhibitory effect on RBE / GEM cell activity. However, if the dosage of the ferulic foliol ester derivative is too low, it cannot effectively reduce the cell activity of RBE / GEM. In addition to using ferulic foliol ester derivatives and gemcitabine, nicotinic acid glycine can be further added. The combined use of ferulic foliol ester derivatives, nicotinic acid glycine, and gemcitabine can further reduce the cell activity of RBE / GEM.

[0136] The embodiments and / or implementation methods described above are merely preferred embodiments and / or implementation methods for implementing the technology of the present invention, and are not intended to limit the implementation methods of the technology of the present invention in any way. Any person skilled in the art can make some modifications or alterations to other equivalent embodiments without departing from the scope of the technical means disclosed in the content of the present invention, but they should still be regarded as the technology or embodiments that are substantially the same as the present invention.

[0137] This document uses specific examples to illustrate the principles and implementation methods of this application. The descriptions of the above embodiments are only for the purpose of helping to understand the methods and core ideas of this application. The above descriptions are only preferred embodiments of this application. It should be noted that due to the limitations of written expression, while there are objectively infinite specific structures, those skilled in the art can make several improvements, modifications, or changes without departing from the principles of this application, and can also combine the above technical features in an appropriate manner. These improvements, modifications, changes, or combinations, or the direct application of the inventive concept and technical solution to other situations without modification, should all be considered within the scope of protection of this application.

Claims

1. A method for preparing a pharmaceutical composition, comprising: A pharmaceutical composition was prepared by mixing a GBP6 inhibitor and gemcitabine. The GBP6 inhibitor is a feruloyl foliol ester derivative, which is prepared by reacting feruloyl chloride hydrochloride and foliol, and the feruloyl chloride hydrochloride is prepared by reacting ferulic acid and thionyl chloride. The pharmaceutical concentration of gemcitabine is 68.94-900 μM.

2. The method for preparing a pharmaceutical composition according to claim 1, characterized in that, The pharmaceutical composition also contains a pharmaceutical solvent.

3. The method for preparing a pharmaceutical composition according to claim 1, characterized in that, The mass ratio of the GBP6 inhibitor to gemcitabine is 1:5-50.

4. A pharmaceutical composition for treating cholangiocarcinoma, characterized in that, It contains gemcitabine and a GBP6 inhibitor, wherein the GBP6 inhibitor is a feruloyl foliol ester derivative, which is prepared by reacting feruloyl chloride hydrochloride with foliol, and the feruloyl chloride hydrochloride is prepared by reacting ferulic acid with thionyl chloride.

5. The use of GBP6 inhibitors in the preparation of drugs for reversing gemcitabine resistance in cholangiocarcinoma cells, characterized in that: The GBP6 inhibitor is a feruloyl foliol ester derivative, which is formed by reacting feruloyl chloride hydrochloride and foliol, and the feruloyl chloride hydrochloride is formed by reacting ferulic acid and thionyl chloride.

Images