Application of regorafenib in the preparation of drugs to reverse gemcitabine resistance in pancreatic cancer

Abstract

This invention discloses the application of regorafenib in the preparation of drugs to reverse gemcitabine resistance in pancreatic cancer. This invention is the first to discover that the protein FBLN3 plays a key regulatory role in gemcitabine-resistant pancreatic cancer cells; its downregulation significantly reduces the half-maximal inhibitory concentration (IC50) of gemcitabine. Furthermore, this invention clarifies that FBLN3 specifically interacts with EGFR, and identifies the key binding region between the two. This invention is also the first to discover that regorafenib can effectively block the interaction between FBLN3 and EGFR, and that the combination of regorafenib and sativa shows significantly better anti-tumor effects than monotherapy, effectively reversing gemcitabine resistance in pancreatic cancer.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical applications, and in particular to the use of regorafenib in the preparation of drugs that reverse gemcitabine resistance in pancreatic cancer. Background Technology

[0002] Pancreatic ductal adenocarcinoma (PDAC) is a highly malignant digestive system tumor with a poor prognosis and a five-year survival rate of less than 10%. Due to difficulties in early diagnosis, most patients are diagnosed at an advanced stage, missing the opportunity for radical resection. Therefore, adjuvant chemotherapy remains one of the main treatment methods. Gemcitabine is a first-line chemotherapy drug for pancreatic cancer. However, pancreatic cancer cells commonly exhibit primary or acquired resistance to gemcitabine, significantly limiting the clinical responsiveness of chemotherapy. Existing research indicates that chemotherapy resistance involves multiple molecular mechanisms, including enhanced drug efflux, enhanced DNA damage repair, and abnormal activation of survival-promoting signaling pathways. The EGFR signaling pathway plays a crucial role in the development, progression, and treatment resistance of pancreatic cancer. Although EGFR-targeted drugs have been applied to various tumors, their efficacy in pancreatic cancer is limited, suggesting that the regulatory mechanisms of EGFR-related resistance are not yet fully elucidated. Currently, there is a lack of effective technical solutions to reverse gemcitabine resistance in pancreatic cancer by regulating EGFR-interacting proteins. Summary of the Invention

[0003] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide applications for regorafenib.

[0004] A second object of the present invention is to provide a pharmaceutical composition containing gemcitabine and regorafenib.

[0005] A third object of the present invention is to provide the use of a pharmaceutical composition containing gemcitabine and regorafenib.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] Application of regorafenib in the preparation of drugs to reverse gemcitabine resistance in pancreatic cancer.

[0008] A pharmaceutical composition comprising gemcitabine and regorafenib.

[0009] The use of the above-mentioned pharmaceutical composition containing gemcitabine and regorafenib in the preparation of a drug for treating pancreatic cancer.

[0010] Furthermore, in the pharmaceutical composition containing gemcitabine and regorafenib, the drug concentrations of gemcitabine and regorafenib are respectively:

[0011] The drug concentrations of gemcitabine range from 0 to 625 nM, and those of regorafenib range from 0 to 195.3125 nM.

[0012] Alternatively, the drug concentrations of gemcitabine are 312.5 nM-1250 nM and regorafenib are 195.3125-390.625 nM.

[0013] Alternatively, the drug concentration of gemcitabine is 2500-5000 nM, and the drug concentration of regorafenib is 195.3125-781.25 nM;

[0014] Furthermore, the drug concentrations of gemcitabine and regorafenib were: gemcitabine 625 nM and regorafenib 390.62 nM, respectively.

[0015] Furthermore, regorafenib reverses gemcitabine resistance and synergistically inhibits tumor growth with gemcitabine. Even further, regorafenib reverses gemcitabine resistance by (1) downregulating the expression of protein FBLN3 and / or (2) blocking the interaction between protein FBLN3 and EGFR.

[0016] In one implementation, regorafenib is used in combination with gemcitabine to enhance the inhibitory effect of gemcitabine on pancreatic cancer cells.

[0017] In one embodiment, HEK293T cells were treated with 5.0 μM regorafenib for 72 h in an in vitro experiment to detect the interaction between FBLN3 protein and EGFR protein. The results showed that regorafenib could inhibit the protein interaction.

[0018] In one embodiment, in a gemcitabine-resistant pancreatic cancer cell model, regorafenib 390.62 nM and gemcitabine 625 nM were used for combined treatment.

[0019] In one implementation, validation was performed in a patient-derived xenograft (PDX) animal model of pancreatic cancer.

[0020] In one embodiment, gemcitabine is administered at a dose of 25 mg / kg via intraperitoneal injection twice weekly; regorafenib is administered at a dose of 12.5 mg / kg via gavage once daily in a volume of 100 μL.

[0021] The combination therapy of the present invention exhibits superior tumor growth inhibition compared to the use of regorafenib or gemcitabine alone, thereby achieving reversal of gemcitabine resistance in pancreatic cancer.

[0022] The present invention has the following advantages and effects compared with the prior art:

[0023] (1) The protein FBLN3 was first discovered to play a key regulatory role in gemcitabine-resistant pancreatic cancer cells, and its downregulation could significantly reduce the half-maximal inhibitory concentration (IC50) of gemcitabine.

[0024] (2) Through protein interaction network analysis and protein truncation experiments, it was determined that protein FBLN3 can specifically interact with EGFR, and the key binding regions of the two were identified.

[0025] (3) It was found that treatment with regorafenib at 5.0 μM for 72 h could effectively block the interaction between protein FBLN3 and EGFR in HEK293T cells, inhibiting pancreatic cancer drug resistance-related signals from a new mechanism of action.

[0026] (4) In the gemcitabine-resistant cell model (regorafenib 390.62 nM + gemcitabine 625 nM) and the resistant PDX model (gemcitabine 25 mg / kg, intraperitoneal injection, twice a week; regorafenib 12.5 mg / kg, 100 μL, gavage, once a day), the combination therapy showed significantly better antitumor effects than monotherapy, suggesting that regorafenib combined with gemcitabine can effectively reverse the resistance of pancreatic cancer to gemcitabine. Attached Figure Description

[0027] Figure 1 This is a schematic diagram showing the expression of protein FBLN3 in gemcitabine-resistant pancreatic cancer cells and its effect on gemcitabine IC50.

[0028] Figure 2 This is a schematic diagram illustrating the interaction between protein FBLN3 and EGFR and the identification of its binding region.

[0029] Figure 3 This is a schematic diagram illustrating the interaction between the regorafenib-blocking protein FBLN3 and EGFR.

[0030] Figure 4 This is a schematic diagram illustrating the antitumor effects of gemcitabine combined with regorafenib in gemcitabine-resistant cells and PDX models. Detailed Implementation

[0031] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0032] Example 1: Correlation between gemcitabine resistance and FBLN3 in pancreatic cancer

[0033] I. Preparation of gemcitabine-resistant cell models

[0034] 1. Culture, passage, cryopreservation and resuscitation of PDAC-resistant cells

[0035] (1) Culture: PDAC resistant cell line BxPC-3 (GR) was cultured in RPMI 1640 (BasalMedia, China) medium containing 10% fetal bovine serum and placed in an incubator containing 5% CO2 at 37°C.

[0036] (2) Passaging: When PDAC-resistant cells reach 80%-90% of the bottom area of ​​the culture dish, they can be passaged. Discard the original culture medium and wash the cells twice with PBS. Then add an appropriate amount of 0.25% trypsin (BasalMedia, China) and place them back in the incubator to stand for about 3-5 minutes. After the cells shrink into spherical shapes, add an equal amount of complete culture medium to stop the digestion reaction. Transfer the cells to a centrifuge tube, centrifuge at 1200 rpm for 3 minutes at room temperature, and retain the cell pellet at the bottom of the centrifuge tube. Resuspend the cells in an appropriate amount of complete culture medium and, depending on the cell state, transfer the cells to a new culture flask containing an appropriate amount of complete culture medium at an appropriate ratio (1:2-1:5). Place the culture flask in an incubator containing 5% CO2 at 37℃ and continue culturing.

[0037] (3) Cryopreservation: Discard the original culture medium in the T25 culture flask, wash the cells twice with PBS (Saiwell Biotech, China), discard the PBS, add an appropriate amount of 0.25% trypsin, and place back in the incubator to stand for about 3-5 minutes. After the cells shrink into spherical shape, add an equal amount of complete culture medium to trypsin to stop the digestion reaction, transfer the cells to centrifuge tubes, centrifuge at 1200 rpm for 3 minutes at room temperature and keep the cell pellet at the bottom of the centrifuge tube, add an appropriate amount of prepared cryopreservation solution (85% complete culture medium, 10% FBS, 5% DMSO by volume percentage) to resuspend the cells, add 1 mL / tube to the cryopreservation tube, label the cell name, cell number, cryopreservation date and cryopreservation personnel on the outer wall of the tube, place it in a programmed cooling box containing isopropanol and place it in an ultra-low temperature freezer at -80°C, and after 24 hours, transfer the cryopreservation tubes to a liquid nitrogen tank for storage.

[0038] (4) Resuscitation: Remove the cell cryopreservation tube from the liquid nitrogen tank and immediately place it in a 37°C water bath for rewarming. After the cryopreservation solution containing cells has thawed, transfer the cell suspension in the cryopreservation tube to a centrifuge tube and add 5 times the volume of complete culture medium. Centrifuge at 1200 rpm for 3 minutes at room temperature, discard the supernatant in the centrifuge tube, add 1 mL of complete culture medium to resuspend the cells, add an appropriate amount of complete culture medium to a new T25 culture flask, transfer the cell suspension to the culture flask, and place it in a 37°C incubator containing 5% CO2 for continued culture. Replace with new culture medium the next day.

[0039] II. Expression level of FBLN3 mRNA in PDAC-resistant cells

[0040] Using a ligecitabine-resistant pancreatic cancer cell model, the expression level of FBLN3 mRNA was detected by real-time quantitative PCR (RT-qPCR). Specific experimental procedures are as follows:

[0041] RT-qPCR reaction systems were prepared in 96-well qPCR plates, sealed with qPCR sealing film, and briefly centrifuged at 4°C. The plates were then placed in an RT-qPCR instrument. Reaction conditions: 50°C for 2 min, 95°C for 30 s, 95°C for 10 s denaturation, and 60°C for 30 s annealing; the denaturation and annealing reactions were repeated for 40 cycles. Melting curves were prepared at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s. Relative expression levels were detected using a QuantStudio6 Flex real-time PCR system, with GAPDH as an internal reference gene, and data analysis was performed according to 2-ΔΔCT. The RT-qPCR reaction system per well is shown in Table 1.

[0042] Table 1

[0043]

[0044] The primers used are shown below:

[0045] FBLN3-primer-F: 5'-GTCACAGGACACCGAAGAAAC-3';

[0046] FBLN3-primer-R: 5'-TTGCATTGCTGTCTCACAGGA-3'.

[0047] The expression level of FBLN3 in drug-resistant cells is as follows: Figure 1 As shown in A, the expression level of FBLN3 was found to be higher in drug-resistant cells than in wild-type cells, indicating that FBLN3 is associated with gemcitabine resistance in pancreatic cancer.

[0048] Example 2: Verification of the role of protein FBLN3 in gemcitabine resistance in pancreatic cancer.

[0049] I. Construction of cells with downregulated FBLN3 expression

[0050] 1. Lentiviral packaging

[0051] HEK293T cells were seeded into 60mm culture dishes, and after 12 hours, the cell density reached 60% of the bottom area of ​​the dish. 10 μg of each plasmid and pLP / VSVG:psPAX2:FBLN3 shRNA were added to a 1.5mL EP tube containing 1mL Opti-MEM medium (Gibco, USA). After vortexing and incubation for 15 minutes, PEI (Saiwell, China) was added to the tube at a plasmid to PEI mass ratio of 1:3. After vortexing and incubation for 10 minutes, the old medium in the HEK293T cell culture dish was aspirated and replaced with 9mL fresh DMEM high-glucose complete medium (BasalMedia, China). The solution from the aforementioned 1.5mL EP tube was then slowly added dropwise to the HEK293T cell culture dish, and the cells were incubated at 37°C with 5% CO2 for 48 hours. 48 hours later, the culture medium in the HEK293T cell culture dish was drawn with a 10mL syringe and filtered through a 0.45μm filter. The obtained virus solution was stored in an ultra-low temperature freezer at -80℃ for subsequent cell stable transfection experiments.

[0052] The FBLN3 shRNAs are FBLN3 shRNA #1, FBLN3 shRNA #2, and FBLN3shControl, and their sequences are shown below:

[0053] FBLN3 shRNA #1: CCAGTCAATAGTCTACAAATA;

[0054] FBLN3 shRNA #2: CCTGTGAGACAGCAATGCAAA;

[0055] FBLN3 shControl: CAACAAGATGAAGAGCACCAA.

[0056] 3. Stable cell transfection and selection

[0057] The virus solution was mixed with complete culture medium at a volume ratio of 1:1. Digested PDAC-resistant cells were prepared to cover 40% of the bottom area of ​​a six-well plate, and the cells were seeded into the six-well plates. Simultaneously, polybrene (Beyotime, China) was added at a volume ratio of 1:1000. When the cells grew to 80%-90% of the bottom area of ​​the six-well plate, they were transferred to 60mm culture dishes. Puromycin (White Shark, China) was added to select cells (final concentration 2 μg / mL). After two generations of culture and selection, FBLN3 shRNA #1, FBLN3 shRNA #2, and FBLN3 shControl cells were used to obtain stably transfected knockdown group 1, knockdown group 2, and control group cells, respectively.

[0058] FBLN3 expression levels in cells with downregulated FBLN3 protein expression were as follows: Figure 1 As shown in B. Finally, the changes in the half-maximal inhibitory concentration (IC50) of the drug in the cells were analyzed by cell viability assay. The specific steps are as follows:

[0059] Knockdown group 1, knockdown group 2, and control cells were seeded in 96-well plates at a density of 2000 cells / well, with 6 replicates per group. Gemcitabine (Taoshu, China) gradient prepared using the half-dilution method was added before cell adhesion. The plates were incubated at 37°C with 5% CO2 for 72 hours. Then, following the manufacturer's instructions, the luminescence intensity of each well was measured using the CellTiter-Lumi™ luminescence assay kit (Beyotime, China) as the cell viability value. The IC50 was calculated using GraphPad curve fitting.

[0060] The results are as follows Figure 1 As shown in C, downregulating the expression of protein FBLN3 can significantly reduce gemcitabine IC50, suggesting that inhibiting FBLN3 expression can reverse gemcitabine resistance in pancreatic cancer.

[0061] Example 3: Identification of the interaction between protein FBLN3 and EGFR and its binding region

[0062] First, protein interaction network analysis (https: / / string-db.org / ) was used to predict the potential interaction between the protein FBLN3 and EGFR, such as... Figure 2 As shown in Figure A, FBLN3 may play a role in promoting gemcitabine resistance in pancreatic cancer through EGFR. Secondly, we used an online protein docking tool (https: / / zdock.wenglab.org / ) to further predict the possible structures of interaction between FBLN3 and EGFR and visualized them using the open-source computer software PyMol, as shown in Figure A. Figure 2 As shown in B in the figure. Furthermore, we constructed FBLN3 mutants with different truncated forms (Miaoling, China), as shown in... Figure 2 As shown in C; and the key binding region for the interaction between protein FBLN3 and EGFR was determined by immunoprecipitation experiments, the specific steps of which are as follows:

[0063] The FBLN3 protein samples or truncated variants (FBLN3-Flag, Δ26-71aa-Flag, Δ72-172aa-Flag, Δ173-378aa-Flag, or Δ379-493aa-Flag) were divided into three groups: an input group and an IP group. For the input group, an appropriate amount of sample was directly added to 1×SDS loading buffer and boiled at 95°C for 5 minutes. Meanwhile, anti-HA magnetic beads (Kangti Life, China) were washed three times with PBST (PBS containing 0.1% Tween-20) and added to the IP group, then incubated overnight in a 3D gyroscope at 4°C. The next day, the magnetic beads were washed five times with PBST. The bound protein was eluted with 1×SDS loading buffer and heated at 95°C for 5 minutes. Finally, all samples were subjected to SDS-PAGE electrophoresis and Western blot analysis using specific antibodies.

[0064] The results are as follows Figure 2 As shown in D, the key binding region for the interaction is the amino acid domain at positions 26-71.

[0065] The above results suggest that the interaction site between FBLN3 and EGFR is located at amino acids 26-71 of FBLN3.

[0066] Example 4: Verification of the interaction between regorafenib-blocking protein FBLN3 and EGFR

[0067] Using the amino acid domains at positions 26-71 obtained from the above experiments, a binding cassette was constructed, and virtual screening technology was used to screen FDA-approved small molecule drugs that can bind to this binding cassette, such as... Figure 3 As shown in Figure A, the small molecule drug regorafenib can block the binding of FBLN3 to EGFR and reverse gemcitabine resistance in pancreatic cancer. Further immunoprecipitation experiments revealed that regorafenib effectively inhibits the interaction between FBLN3 (Flag) and EGFR (HA) in HEK293T cells. Immunoprecipitation with anti-HA antibody and detection of Flag protein showed that after 72 h of treatment with regorafenib (0, 2.5, and 5.0 μM) following cell adhesion, the level of co-precipitated Flag protein decreased in a dose-dependent manner. Figure 3 As shown in Figure B. Finally, further validation in BxPC-3 resistant cells revealed that regorafenib treatment effectively inhibited EGFR activation. Compared with the control group treated with the drug solvent PBS, p-EGFR levels significantly decreased after 72 h of treatment with 2.5 μM regorafenib following cell adhesion, while total EGFR expression did not change significantly. Figure 3 As shown in C.

[0068] Example 5: Application of combination therapy in gemcitabine resistance model

[0069] like Figure 4 As shown in Figure A, we first designed multiple drug concentration ratios of gemcitabine and regorafenib and then tested their Bliss synergistic index at different ratios. The experimental results suggest a synergistic effect within specific concentration ranges (e.g., gemcitabine: 0-625 nM, regorafenib: 0-195.3125 nM; gemcitabine: 312.5 nM-1250 nM, regorafenib: 195.3125-390.625 nM; gemcitabine: 2500-5000 nM, regorafenib: 195.3125-781.25 nM); among these, the optimal synergistic therapeutic effect was observed when the gemcitabine concentration was 625 nM and the regorafenib concentration was 390.62 nM.

[0070] Furthermore, cell proliferation and colony formation experiments were conducted on drug-resistant cells using this concentration combination. The specific steps are as follows:

[0071] Cell proliferation assay: PDAC-resistant cells were seeded into 96-well plates at a density of 2000 cells / well. After 8 hours of cell adhesion, different drug treatments were administered (blank control group: PBS; regorafenib group: 390.62 nM; gemcitabine group: 625 nM; combination drug group: regorafenib 390.62 nM + gemcitabine 625 nM). Following the manufacturer's instructions, the luminescence intensity was measured at 0, 24, 48, and 72 hours using the CellTiter-Lumi™ luminescence assay kit (Beyotime, China). The ratio of the luminescence intensity at 24, 48, and 72 hours to that at 0 hours represented cell proliferation viability.

[0072] Clonogenesis assay: PDAC-resistant cells were seeded into six-well plates at a density of 1000 cells / well and cultured for 10 days. Afterward, different drug treatments were administered (blank control group: PBS; regorafenib group: 390.62 nM; gemcitabine group: 625 nM; combination drug group: regorafenib 390.62 nM + gemcitabine 625 nM). After culturing for another 4 days, the cells were fixed with 4% paraformaldehyde for 10 minutes and stained with crystal violet for 30 minutes. After washing away excess crystal violet, the cells were photographed, counted, and analyzed for the number of cell clones.

[0073] The results are as follows Figure 4 As shown in B and C, the combination therapy group showed significantly slower cell proliferation and a significantly reduced colony formation capacity compared to the two single-drug groups, suggesting that the combination of this drug and gemcitabine has a synergistic anti-tumor effect.

[0074] Furthermore, we conducted experiments on this combination therapy in mice. First, a PDAC PDX animal model was constructed. Fresh PDAC tumor tissue was aseptically cut into pieces of approximately 1 mm³ and stored in serum-free culture medium containing 1× bispecific antibody. Two immunodeficient mice (NSG mice, 6–8 weeks old) were used for each PDX. After isoflurane inhalation anesthesia, the mice were placed in a supine position. After skin disinfection, a longitudinal incision of approximately 3–5 mm was made below the xiphoid process. Forceps were inserted subcutaneously to create subcutaneous tunnels extending to both axillae. The 1 mm³ pancreatic cancer tissue was transplanted into both axillae. 1× bispecific antibody was applied to the incision site, and the skin was disinfected and sutured. The surgery was completed. Tumor growth was monitored daily after transplantation, and the tumor formation rate and growth curve were recorded. This PDX tissue was defined as generation P1. When the tumor grew to 1 cm in diameter, the mice were sacrificed, and the tumor tissue was removed and passaged in 4–6 week old female nude mice using the aforementioned method, defined as generations P2–P4. Subsequently, a PDAC gemcitabine-resistant PDX model was constructed: the aforementioned PDX tissue was aseptically cut into pieces approximately 1 mm in size. 3 Small pieces were prepared and stored in serum-free culture medium containing 1X penicillin antibody. For each successfully constructed PDX, six 6–8 week old BALB / c nude mice were used. After isoflurane inhalation anesthesia, the mice were placed in a supine position. After skin disinfection, a longitudinal incision of approximately 3–5 mm was made below the xiphoid process. Forceps were inserted subcutaneously to create subcutaneous tunnels extending to both axillae. The pieces were cut into 1 mm pieces. 3 After transplanting PDX tissue into both axillae, 1X bispecific antibody was applied to the incision site, the area was disinfected, and the skin was sutured, completing the surgery. Tumor growth was monitored daily post-transplantation, and tumor formation rate and growth curves were recorded. This PDX tissue was defined as generation P1. When the tumor reached a diameter of 4 mm, mice were randomly divided into PBS and GEM groups, receiving intraperitoneal injections of 100 μL of PBS or GEM, respectively. The GEM dose was 25 mg / kg, administered twice weekly for 3 weeks. Tumor volume was measured and calculated twice weekly using calipers, and the weight and condition of the nude mice were recorded. When the tumor reached a diameter of 1 cm, the mice were sacrificed, and the tumor tissue was removed and passaged in 4-6 week old female nude mice using the aforementioned method, defined as generations P2-P4. The successfully constructed PDAC gemcitabine-resistant PDX model was used, and the tissue was cut into 3 mm sections. 3The tissue block was prepared for use. After isoflurane inhalation anesthesia, the nude mice were placed in a supine position. The skin around the xiphoid process was disinfected with alcohol, the skin was cut open, and a subcutaneous tunnel leading to the axillary region was constructed using straight forceps. The tissue block was inserted subcutaneously, the incision was sutured, and the area was disinfected again with alcohol to complete the surgery. During the operation, the heart rate and body temperature of the nude mice were monitored. Postoperatively, the heart rate, body temperature, and anesthesia recovery status of the nude mice were monitored. Enrofloxacin was administered prophylactically once postoperatively, with 2 μL of the drug prepared in 1 mL of drinking water for the experimental animals and administered by gavage. After tumor formation, nude mice were randomly divided into four groups of five mice each. The solvent group received 100 μL of PBS via intraperitoneal injection; the gemcitabine group received 100 μL of gemcitabine (25 mg / kg, intraperitoneal injection, twice a week); the regorafenib group received 100 μL of regorafenib (12.5 mg / kg, gavage, once daily); and the combination therapy group received gemcitabine (25 mg / kg, intraperitoneal injection, twice a week) + 100 μL of regorafenib (12.5 mg / kg, gavage, once daily). Treatment lasted for four weeks. Tumor volume was measured twice weekly using calipers, and mouse weight changes were recorded. After three weeks, 0.2 mL of blood was collected from the anterior medial canthal vein of the mice to study liver and kidney function changes. After blood collection, the mice were sacrificed, and tumor tissue was removed, measured, and weighed. Figure 4 As shown in the DF results, the combination therapy effectively inhibited the proliferation rate of human xenograft tumors. These in vitro and in vivo experiments confirm that this small molecule drug can effectively reverse gemcitabine resistance in pancreatic cancer.

[0075] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Application of regorafenib in the preparation of drugs to reverse gemcitabine resistance in pancreatic cancer.

2. The application according to claim 1, characterized in that: Regorafenib inhibits the interaction between the FBLN3 protein and the EGFR protein, thereby suppressing the signaling pathway associated with drug resistance in pancreatic cancer and thus reversing gemcitabine resistance in pancreatic cancer.

3. A pharmaceutical composition, characterized in that, It contains gemcitabine and regorafenib.

4. The pharmaceutical composition according to claim 3, characterized in that, Gemcitabine has a drug concentration of 0-625 nM and regorafenib has a drug concentration of 0-195.3125 nM.

5. The pharmaceutical composition according to claim 3, characterized in that, Gemcitabine concentrations ranged from 312.5 nM to 1250 nM, while regorafenib concentrations ranged from 195.3125 to 390.625 nM.

6. The pharmaceutical composition according to claim 5, characterized in that, The drug concentration of gemcitabine was 625 nM, and the drug concentration of regorafenib was 390.62 nM.

7. The pharmaceutical composition according to claim 3, characterized in that, Gemcitabine has a drug concentration of 2500-5000 nM, while regorafenib has a drug concentration of 195.3125-781.25 nM.

8. Use of the pharmaceutical composition according to any one of claims 3-7 in the preparation of a medicament for treating pancreatic cancer.

Images