Vibrio harveyi crp gene and method for inhibiting gene horizontal transfer by knocking out vibrio harveyi crp gene

Abstract

The invention discloses a vibrio harveyi crp gene and a method for inhibiting gene horizontal transfer by knocking out the vibrio harveyi crp gene, and relates to the fields of molecular biology and gene engineering. According to the invention, a CRP / FNR family transcriptional regulatory factor coding gene crp of vibrio harveyi is knocked out, and the CRP / FNR family transcriptional regulatory factor coding gene crp is shown as a 487bp-1119 bp of SEQ ID NO. 1. By knocking out the crp gene of the recipient bacterium vibrio harveyi, the efficiency of obtaining exogenous plasmids by the vibrio harveyi through conjugational transfer is reduced, and the method has the characteristic of remarkably reducing the conjugational transfer efficiency. Compared with a wild type host cell, the efficiency of obtaining the plasmid pMMB207 in donor bacteria escherichia coli through conjugational transfer by the host cell with the crp gene knocked out is reduced to 0. According to the method, the obtaining capacity of host cells on exogenous plasmids is greatly reduced, and the method has very important significance on resisting pathogenicity and drug resistance of microorganisms.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a Vibrio harveyi crp gene and a method for knocking out the Vibrio harveyi crp gene to inhibit horizontal gene transfer. BACKGROUND

[0002] Vibrio harveyi is an important opportunistic pathogen of marine aquaculture organisms, which has caused great harm to the marine aquaculture industry. The investigation of marine fish diseases in the South China coast found that about 70% of the Vibrio disease of marine fish was caused by Vibrio harveyi. Due to the limitations of other control methods such as vaccines and immune enhancers, antibiotics are considered to be the most effective and flexible weapon against bacterial infectious diseases, and are widely used to prevent or treat bacterial diseases in aquaculture. At present, the drug resistance of Vibrio harveyi is serious, and the drug resistance index is as high as 0.60. The urgency of effective disease control and the drug resistance caused by antibiotic treatment both indicate the urgent need to explore new disease control strategies, and attenuation and resistance reduction is the fundamental requirement for disease control and the key to the implementation of green and healthy aquaculture.

[0003] The key to attenuation and resistance reduction lies in the control of virulence genes and drug resistance genes. The virulence genes and drug resistance genes of pathogenic microorganisms can be horizontally transferred between different species through conjugation transfer of mobile genetic elements such as plasmids, thereby enhancing the pathogenicity and drug resistance of pathogenic bacteria and increasing the complexity and variability of disease control. Therefore, reducing the conjugation transfer efficiency of plasmids between bacteria can effectively prevent the spread and diffusion of virulence and drug resistance genes, and is considered to be one of the effective strategies for preventing the spread of virulence and drug resistance of pathogenic microorganisms. SUMMARY

[0004] In view of the problems in the prior art, the present application aims to provide a Vibrio harveyi crp gene and a method for knocking out the Vibrio harveyi crp gene to inhibit horizontal gene transfer. The method can effectively reduce the conjugation transfer efficiency of plasmids, and can effectively solve the problem of rapid spread of drug-resistant and pathogenic bacteria.

[0005] To solve the above problems, the present application is realized as follows:

[0006] The first object of the present application is to provide a Vibrio harveyi crp gene, the nucleotide sequence of which is shown in 487bp-1119bp of SEQ ID NO. 1 or a sequence having the same function according to the degeneracy of codons, which is a CRP / FNR family transcriptional regulator encoding gene.

[0007] The crp gene is located at 1524658-1525290 of the chromosome 1 of the Vibrio harveyi genome, and has an Id of CU052_07695 and is composed of 210 bases. The encoded protein CRP is a CRP / FNR family transcriptional regulator, and has an Id of AWA99220.1.

[0008] A second object of the present application is to provide an application of knocking out the crp gene of Vibrio harveyi in inhibiting horizontal transfer of an exogenous gene to a host Vibrio harveyi.

[0009] Preferably, the bacteria is Vibrio harveyi 345.

[0010] A third object of the present application is to provide a Vibrio harveyi with low conjugative transfer efficiency, which is obtained by knocking out the CRP / FNR family transcriptional regulator encoding gene crp of Vibrio harveyi, and the CRP / FNR family transcriptional regulator encoding gene crp is shown in 487bp-1119bp of SEQ ID NO. 1.

[0011] A fourth object of the present application is to provide a construction method of a Vibrio harveyi with low conjugative transfer efficiency, which is obtained by knocking out the CRP / FNR family transcriptional regulator encoding gene crp of Vibrio harveyi, and the CRP / FNR family transcriptional regulator encoding gene crp is shown in 487bp-1119bp of SEQ ID NO. 1.

[0012] Preferably, the method comprises the following steps:

[0013] Step one, designing gene knockout primers for the CRP / FNR family transcriptional regulator encoding gene crp on the Vibrio harveyi genome;

[0014] Step two, knocking out the CRP / FNR family transcriptional regulator encoding gene crp with Vibrio harveyi as the starting strain, and correspondingly obtaining the gene deletion strain V. harveyi 345-Δcrp, which is the Vibrio harveyi with low conjugative transfer efficiency.

[0015] Preferably, the gene knockout primers in step one are: upstream homologous arm amplification primers aagcttgatatcgaattcACCA ACCGTCGATACTTC and aattttttaaacgttaatcgagaAATATCTCACTTCCTCTGC, and downstream homologous arm amplification primers gcagaggaagtgagatattTCTCGATTAACGTTTAAAAAATT and ttggtaacgaatcagacCGAACCAC TTCACGG.

[0016] Preferably, in step two, the knocking out of the CRP / FNR family transcriptional regulator gene crp specifically comprises the following steps:

[0017] (1) PCR amplifying the upstream and downstream homologous arms of the crp gene and linearizing the suicide plasmid;

[0018] (2) Assembling the upstream and downstream homologous arms and the linearized suicide plasmid by isothermal assembly to obtain a recombination plasmid, transforming the recombination plasmid into the intermediate host E. coli GEB802 and the donor bacteria E. coli GEB883 in sequence, and obtaining positive clones by PCR identification;

[0019] (3) Culturing the donor bacteria E. coli GEB883 to the early logarithmic phase, and culturing the recipient bacteria V. harveyi 345 to the early logarithmic phase;

[0020] (4) Heat-shocking the recipient bacteria V. harveyi 345 to the early logarithmic phase at 40°C for 30 min, and performing conjugation transfer experiment with the donor bacteria E. coli GEB883 to the early logarithmic phase;

[0021] (5) Screening and identifying single exchange clones and double exchange clones, thereby obtaining the crp gene deletion strain, i.e., the V. harveyi with low conjugation transfer efficiency.

[0022] In step (1), the suicide plasmid is pSW7848; in step (5), the screening of the single exchange clones specifically refers to screening through a plate containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of the double exchange clones specifically refers to screening through a plate containing 0.2% L-arabinose; and in step (5), the identification specifically refers to PCR identification by using the primer pair: CCGTGATCATGTGCACAGT and GAATCTGAGAGGGCTTCATCTC.

[0023] Further, in some embodiments of the present application, before the conjugation transfer step, the above method comprises a crp gene knockout step; the above crp gene knockout step comprises the following steps: constructing a recombination suicide plasmid comprising the upstream and downstream homologous arm fragments of the targeting fragment (the crp gene fragment to be knocked out); introducing the recombination suicide plasmid into the conjugation transfer donor bacteria host E. coli GEB883; and conjugating the donor bacteria comprising the recombination suicide plasmid with the recipient bacteria.

[0024] It should be noted that the above-mentioned gene knockout method adopts the homologous recombination method to knockout the crp gene, but in some other embodiments, other gene knockout methods can also be used to knockout the crp gene, no matter what method is used to knockout the crp gene, such as complete knockout, partial knockout, or even inhibition of the expression of the crp gene by an RNAi interference vector to inactivate the crp gene, etc., as long as the crp gene of the recipient bacteria does not function in the conjugation transfer process of the plasmid, which belongs to the protection scope of the present application.

[0025] A fifth object of the present application is to provide the above-mentioned low-conjugation-transfer-efficiency V. harveyi as a genetically engineered bacteria for use in gene knockout, inhibition of horizontal gene transfer, or reduction of drug-resistant pathogenic bacteria.

[0026] A sixth object of the present application is to provide a method for inhibiting horizontal gene transfer based on crp knockout of V. harveyi, which comprises the following steps: introducing a target exogenous plasmid into a conjugation transfer donor bacteria, and then conjugating with the above-mentioned low-conjugation-transfer-efficiency V. harveyi.

[0027] Preferably, the exogenous plasmid is pMMB207, and the donor bacteria is E. coli GEB883.

[0028] Compared with the prior art, the present application has the following beneficial effects:

[0029] The present application first found that, compared with wild-type bacteria, knockout of the crp gene can inhibit the efficiency of obtaining an exogenous plasmid by conjugation transfer. Based on this achievement, in the process of conjugation transfer, the donor bacteria containing a target exogenous plasmid are mixed with the recipient bacteria with a knockout crp gene to perform conjugation transfer, which can reduce the conjugation transfer efficiency of the target exogenous plasmid from the donor bacteria to the recipient bacteria, inhibit horizontal gene transfer, and has great significance in resisting the rapid spread of drug-resistant and pathogenic microorganisms.

[0030] The present application greatly reduces the ability of host cells to obtain an exogenous plasmid by conjugation transfer, and the conjugation transfer efficiency of V. harveyi 345-Δcrp is significantly reduced compared with the starting bacteria, which greatly reduces the absorption capacity of V. harveyi for exogenous plasmids, and has great significance in resisting the pathogenicity and drug resistance of microorganisms.

[0031] The method for inhibiting horizontal gene transfer provided by the application comprises the following steps: mixing a donor bacterium containing a target exogenous plasmid with a receptor bacterium with a crp gene knockout, reducing conjugative transfer by knocking out the crp gene of the receptor bacterium, and inhibiting horizontal gene transfer. The method has the characteristics of significantly reducing the efficiency of conjugative transfer. For example, the efficiency of obtaining plasmid pMMB207 by conjugative transfer of V. harveyi 345-Δcrp with a crp gene knockout is 0, compared with wild-type V. harveyi 345. The method for inhibiting horizontal gene transfer provided by the application has great significance in resisting the emergence of drug-resistant pathogenic bacteria.

[0032] The starting strain V. harveyi 345 described in the application has been published in NCBI (CP025537, CP025538, CP025539, CP025540). The recombinant plasmid intermediate host E. coli GEB802, the donor bacterium E. coli GEB883, and the plasmid pSW7848 involved in the application have been published in the following document: Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA srvg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology [J]. Frontiers in microbiology, 2018: 2394. The present inventors also hold the above-mentioned microorganisms and vectors and guarantee to provide them to the public for 20 years from the date of application. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 Construction of crp knockout strain for CRP / FNR family transcriptional regulator encoding gene crp;

[0034] In the figure, lane M1: DNA Marker DL5000; lane 1: pSW7848 linearized fragment; lane M2: DNA Marker DL2000; lane 2 / 3: crp upstream / downstream fragment; lane M3: DNA Marker DL2000; lane 4: recombinant pSW7848-crp detection fragment; lane M4: DNA Marker DL2000; lane 5: amplification result of crp gene knockout identification primer with wild-type V. harveyi 345 genomic DNA as a template; lane 6: amplification result of crp gene knockout identification primer with crp candidate mutant strain genomic DNA as a template.

[0035] Figure 2Figure for comparison of transfer efficiency of V. harveyi 345 and V. harveyi 345-Δcrp in chloramphenicol plates.

[0036] Figure 3 Figure for comparison of relative transfer efficiency of V. harveyi 345 and V. harveyi 345-Δcrp. DETAILED DESCRIPTION

[0037] The technical solutions of the present application are further described below in conjunction with examples, but the scope of protection of the present application is not limited thereto.

[0038] The origin of the suicide plasmid pSW7848 is described in the literature: Val, M-E., Skovgaard, O., Ducos-Galand, M., Bla nd, M.J., Mazel, D., 2012. Genome engineering in Vibrio cholerae: a feasible approach to address biological issues. PLoS Genet. 8, e1002472.

[0039] The origin of E. coli GEB883 is described in the literature: Nguyen, A.N., Disconzi, E., Charrière, G.M., Destoumi eux-Garzón, D., Bouloc, P., Le Roux, F., Jacq, A., 2018. csrB gene duplication drives the evolution of redundant regulatory pathways controlling expression of the major toxic secreted metalloproteases in Vibrio tasmaniensis LGP32. mSphere. 3, e00582-00518.

[0040] E. coli GEB802 was disclosed in Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA sryg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology [J]. Frontiers in microbiology, 2018: 2394. E. coli GEB802 is π3813 in the article.

[0041] Example 1:

[0042] I. Knockout of crp (CU052_14940), a CRP / FNR family transcriptional regulator encoding gene in V. harveyi 345 genome

[0043] In the experiment, we designed the corresponding gene knockout primers for the crp gene (Table 1).

[0044] Table 1 Primers related to gene knockout and identification

[0045]

[0046] The crp gene ORF and its upstream and downstream sequences (as shown in SEQ ID NO. 1), the italic ATG and TAA are the start and stop codons of crp, i.e. from 487bp-1119bp.

[0047] The upstream homologous arm amplification primers crp-U_fwd: aagcttgatatcgaattcACCAACCGTCGATACTTC and crp-U_rev: aattttttaaacgttaatcgagaAATATCTCATTTCCTCTGC, and the downstream homologous arm amplification primers crp-D_fwd: gcagaggaagtgagatattTCTCGATTAACGTTTAAAAATT and crp-D_rev: ttggtaacgaatcagacCGAACCACTTCACGG were used to amplify the upstream and downstream flanking sequences of the crp gene from the genome of V. harveyi 345 by PCR. The linearized plasmid pSW7848 was obtained by PCR amplification using the primers pSW7848-F and pSW7848-R and the suicide plasmid pSW7848 as the template. The upstream and downstream flanking sequences were isothermally assembled with the linearized plasmid using the ClonExpress MultiS OneStep Cloning Kit (Nanjing Novozyme Biotech Co., Ltd.), and the obtained recombinant plasmid pSW7848-crp (the sequence of which is shown as SEQ ID NO. 2) was transformed into the intermediate host E. coli GEB802 and the donor bacterium E. coli GEB883 (the preparation and transformation method of the E. coli GEB802 and E. coli GEB883 competent cells refer to the invention patent CN 107904228 A) in sequence. The positive clones were screened by PCR based on the primers pSW7848-check-F and pSW 7848-check-R. The PCR amplification system and procedure refer to the invention patent CN 107904228 A.

[0048] The mutant strain V. harveyi 345-Δcrp was constructed according to the invention patent CN 107904228 A. The recipient bacterium V. harveyi 345 was cultured to the early logarithmic phase (OD 600nm = 0.3-0.7), and after heat shock treatment at 40°C for 30 min, it was mixed with the donor bacterium V. harveyi 345-Δcrp, which was also cultured to the early logarithmic phase (OD 600nmE. coli GEB883 containing recombinant plasmid pSW7848-crp was used as the donor strain. The recombinant plasmid pSW7848-crp in E. coli GEB883 strain was transferred into V. harveyi 345 by bacterial conjugation. Since the pSW7848 plasmid cannot self-replicate in V. harveyi 345, it can only replicate with the genome after the plasmid is integrated into the V. harveyi 345 genome by homologous recombination. The integration of the plasmid will confer chloramphenicol resistance to V. harveyi 345, and D-glucose will inhibit the expression of the toxic gene ccdB of the suicide plasmid pSW7848. These single crossover clones can be obtained by screening plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose. Subsequently, plates containing 0.2% L-arabinose (to induce the expression of the toxic gene ccdB) were used to screen double crossover clones, and further, the clones were plated on plates containing 0.2% L-arabinose and plates containing 34 μg / mL chloramphenicol and 0.2% L-arabinose to screen candidate mutant strains. Clones without chloramphenicol resistance were identified by PCR (del crp-check-F and del crp-check-R), and clones with successful gene knockout were obtained, i.e., the mutant strain V. harveyi 345-Δcrp. The crp gene was knocked out according to this procedure, and the identification results of the gene knockout were as expected. Figure 1

[0049] II. Implementation effect

[0050] ​The starting strain V. harveyi 345 and the obtained mutant V. harveyi 345-Δcrp are subjected to heat shock at 40°C for 10 min in the early logarithmic phase, and then subjected to conjugation with E. coli GEB883 carrying the RP4 type shuttle plasmid pMMB207 (with chloramphenicol resistance, which can self-replicate in V. harveyi 345, and the construction method is described in Liu, J. X., Zhao, Z., Deng, Y. Q., Shi, Y., Liu, Y. P., Wu, C., Luo, P., Hu, C. Q., 2017. Complete genome sequence of Vibrio campbellii LMB29 isolated from red drum with four native megaplasmids. Front. Microbiol. 8, 2035. https: / / doi.org / 10.3389 / fmcb.2017.02035). After overnight conjugation, the bacterial plaque is collected with 1 mL of fresh culture medium (LBS medium containing 1% proteose peptone, 0.5% yeast powder, and 3% sodium chloride by mass fraction), and is diluted by a factor of 2. 100 μL of each dilution is inoculated on an LBS plate (containing 1% proteose peptone, 0.5% yeast powder, 3% sodium chloride, and 1.5% technical agar powder by mass fraction) containing 34 μg / mL of chloramphenicol to screen the conjugants, and the conjugation transfer efficiency is counted. The results show that the conjugation transfer efficiency of V. harveyi 345-Δcrp is 0 compared with the starting strain V. harveyi 345 (Table 2). Figures 2-3

[0051] Table 2 Conjugation transfer efficiency of V. harveyi 345 and V. harveyi 345-Δcrp

[0052]

[0053] The efficiency of the host cell with the crp gene knocked out in acquiring the plasmid pMMB207 in the donor E. coli through conjugation transfer is reduced to 0 compared with the wild-type host cell. This method greatly reduces the ability of the host cell to acquire exogenous plasmids, and has great significance in resisting microbial pathogenicity and drug resistance.

[0054] In summary, the results show that the deletion of the crp gene can significantly reduce the efficiency of V. harveyi in acquiring exogenous plasmids through conjugation transfer, inhibit gene horizontal transfer, and thus prevent or reduce the ability of microorganisms to absorb drug-resistant DNA fragments or pathogenic DNA fragments from the external environment. The method provided by the present application provides a new way and idea for reducing or avoiding the occurrence of drug-resistant pathogenic bacteria. ​

[0055] The above only is the preferred embodiment of the present application, and is not used to limit the present application, for the person skilled in the art, the present application can have various changes and variations. Any modification, equivalent replacement, improvement, etc. within the spirit and principle of the present application, should be included in the protection scope of the present application.

[0056] SEQ ID NO. 1

[0057] ACCAACCGTCGATACTTC TAACCCACTTAACGCTAAAGGCATCCCTAGCTTGGATGAAA

[0058] GCTTCGTGGTGATCCGCCTGCGCGGTATCAAGAATGTCGACTTCCCGTATTTGTTGGCGA

[0059] TGATTGATGGCTCCTTCATGTCTCGCCATAACACCATTGTGGTTCCTGGCGGTAAGATGA

[0060] GCTTTGCAATGGAGCTCATAGTGAGACCGATTCTGCAGCAACTCATCGAAACCGGGAAA

[0061] ATTGGCTAAAAACCTCGTTAATTGAGTGTTTACTTTTCATACCGTGATCATGTGCACAGTT

[0062] TTGCTTACAAAATCTCAATCATGGCACGATTAAAATCAAGAAATCGTTTCCGAAAAAGGA

[0063] TACTATTTCTAACCGAAACACAAGAGAGCTTGCAGCATATAAAAAGTGCTCTTATTCTAG

[0064] TAAGCCAATTCAGGCTTAGCTAAAATATGGATAGCGCAAGCGTACCCT GCAGAGGAAGT

[0065] GAGATATT ATGGTTCTAGGTAAACCTCAAACCGACCCAACATTAGAGTGGTTTCTTTCAC

[0066] ACTGTCATATTCATAAGTACCCATCAAAGAGCACGCTAATTCACGCGGGCGAAAAAGCA

[0067] GAGACTTTGTACTACATCGTTAAAGGTTCTGTTGCGGTTCTTATCAAAGACGAAGAAGGT

[0068] AAGGAAATGATCCTTTCTTACCTAAACCAAGGCGACTTCATTGGTGAGCTTGGTCTATTC

[0069] GAAGAAGACCAAGAGCGTACAGCTTGGGTTCGCGCTAAATCTCCTTGTGAAGTGGCAG

[0070] AGATTTCTTTCAAGAAATTCCGTCAACTTATCCAAGTTAACCCAGACATCCTAATGCGTC

[0071] TTTCGGCGCAAATGGCTCGTCGTCTACAAGTTACTAGCCAAAAAGTGGGTGACCTAGCG

[0072] TTCCTAGACGTAACTGGTCGTATCGCTCAGACTCTTCTGAACCTTGCTAAACAACCAGAT

[0073] GCGATGACGCACCCAGACGGCATGCAAATCAAGATCACTCGTCAAGAAATCGGTCAAAT

[0074] CGTTGGCTGTTCTCGTGAGACAGTAGGTCGTATTTTGAAGATGCTAGAAGAGCAGAACC

[0075] TAATTTCTGCGCACGGTAAGACTATCGTTGTTTACGGGACTCGTTAA TCTCGATTAACGTT

[0076] TAAAAAATT TAAAAGCCACCAAATGCAAGTTTGGTGGCTTTTTCTTTTTTGGGAGTTAGA

[0077] CATTGAGAGTCGAGAGCGCTGCACTTCACAACGGACTTCATCCTTTGAGATGAAGCCCT

[0078] CTCAGATTCCAAGTAAAAACCCTCTCGAAGCGAAGCGGTTCTCGTCTTGTATCTATTAAC

[0079] CGTTGGTACTCTCGAAGATCTTATCTGCCGATGCAGCTACAAACCCTGGGTACAACTCAC

[0080] CGTTATCCATTGGGTAGCGCTTAGCAAACTCGTAGAAGCCTCCAGGAATCACCTCAACC

[0081] CCTTCAGTGAAGGTCACTGGCACTTTGTCTGCCATGGTCGATGATTGCTCTAGTAGCACC

[0082] TCTGGCGTGCCTTTTACTTCACCGCCATTCTCGTTGATGATAAAGCCTACGGTGCGTAGG

[0083] TGGTCGTTCACTTGCTTCACTTCTTCATGCTGATTGAGTTGATTCACACTCA CCGTGAAG

[0084] TGGTTCG

[0085] SEQ ID NO.2

[0086] TCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGG

[0087] CCGGCGTCGACGGTATCGATAAGCTTGATATCGAATTCACCAACCGTCGATACTTCTAAC

[0088] CCACTTAACGCTAAAGGCATCCCTAGCTTGGATGAAAGCTTCGTGGTGATCCGCCTGCG

[0089] CGGTATCAAGAATGTCGACTTCCCGTATTTGTTGGCGATGATTGATGGCTCCTTCATGTCT

[0090] CGCCATAACACCATTGTGGTTCCTGGCGGTAAGATGAGCTTTGCAATGGAGCTCATAGTG

[0091] AGACCGATTCTGCAGCAACTCATCGAAACCGGGAAAATTGGCTAAAAACCTCGTTAATT

[0092] GAGTGTTTACTTTTCATACCGTGATCATGTGCACAGTTTTGCTTACAAAATCTCAATCATG

[0093] GCACGATTAAAATCAAGAAATCGTTTCCGAAAAAGGATACTATTTCTAACCGAAACACA

[0094] AGAGAGCTTGCAGCATATAAAAAGTGCTCTTATTCTAGTAAGCCAATTCAGGCTTAGCTA

[0095] AAATATGGATAGCGCAAGCGTACCCTGCAGAGGAAGTGAGATATTTCTCGATTAACGTTT

[0096] AAAAAATTTAAAAGCCACCAAATGCAAGTTTGGTGGCTTTTTCTTTTTTGGGAGTTAGA

[0097] CATTGAGAGTCGAGAGCGCTGCACTTCACAACGGACTTCATCCTTTGAGATGAAGCCCT

[0098] CTCAGATTCCAAGTAAAAACCCTCTCGAAGCGAAGCGGTTCTCGTCTTGTATCTATTAAC

[0099] CGTTGGTACTCTCGAAGATCTTATCTGCCGATGCAGCTACAAACCCTGGGTACAACTCAC

[0100] CGTTATCCATTGGGTAGCGCTTAGCAAACTCGTAGAAGCCTCCAGGAATCACCTCAACC

[0101] CCTTCAGTGAAGGTCACTGGCACTTTGTCTGCCATGGTCGATGATTGCTCTAGTAGCACC

[0102] TCTGGCGTGCCTTTTACTTCACCGCCATTCTCGTTGATGATAAAGCCTACGGTGCGTAGG

[0103] TGGTCGTTCACTTGCTTCACTTCTTCATGCTGATTGAGTTGATTCACACTCACCGTGAAG

[0104] TGGTTCGGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCT

[0105] TCACAACCGGCACGAAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACTCGCGA

[0106] GAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGG

[0107] TAGTGCTCAAAAGCAG。

Claims

1. The *Vibrio harveyi* crp gene, characterized in that, Nucleotide sequences as shown in SEQ ID NO.1, 487bp-1119bp, or sequences that function similarly based on codon degeneracy.

2. The application of knocking out the crp gene of Vibrio harveyi as described in claim 1 in inhibiting horizontal gene transfer in Vibrio harveyi.

3. The application according to claim 2, characterized in that, The bacteria mentioned is Vibrio harveyi 345.

4. A type of Vibrio harveyi with low conjugation transfer efficiency, characterized in that, It involves knocking out the crp gene of Vibrio harveyi as described in claim 1.

5. A method for constructing Vibrio harveyi with low conjugation transfer efficiency, characterized in that, The method involves knocking out the crp gene of Vibrio harveyi as described in claim 1 to obtain Vibrio harveyi with low conjugation transfer efficiency.

6. The construction method according to claim 5, characterized in that, Includes the following steps: Step 1: Design gene knockout primers for the crp gene on the Vibrio harveyi genome; Step 2: Using Vibrio harveyi as the starting strain, knock out the crp gene to obtain the gene-deleted strain V.harveyi345-Δcrp, which is Vibrio harveyi with low conjugation transfer efficiency.

7. The construction method according to claim 6, characterized in that, The gene knockout primers mentioned in step one are: upstream homologous arm amplification primers: aagcttgatatcgaattcACCAACCGTCGATACTTC and aattttttaaacgttaatcgagaAATATCTCACTTCCTCTGC; downstream homologous arm amplification primers: gcagaggaagtgagatattTCTCGATTAACGTTTAAAAAATT and ttggtaacgaatcagacCGAACCACTTCACGG.

8. The construction method according to claim 6, characterized in that, Step two, specifically the knockout of the CRP / FNR family transcriptional regulatory factor encoding gene crp, includes the following steps: (1) PCR amplification of the upstream and downstream homologous arms of the crp gene and the linearized suicide plasmid; (2) Recombinant plasmids were obtained by isothermal assembly of upstream and downstream homologous arms and linearized suicide plasmids. The recombinant plasmids were then transformed into intermediate host E. coli GEB802 and donor E. coli GEB883, and positive clones were obtained by PCR identification. (3) The donor bacteria E. coli GEB883 was cultured to the early logarithmic phase, and the recipient bacteria Vibrio harveyi 345 was cultured to the early logarithmic phase; (4) The early logarithmic recipient bacteria Vibrio harveyi 345 was heat-shocked at 40℃ for 30 min and then conjugated with the early logarithmic donor bacteria E. coli GEB883. (5) Screening and identification of single and double crossover clones, i.e., obtaining strains with the crp gene deletion, i.e., Vibrio harveyi with low conjugation transfer efficiency. In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single-exchange clones specifically refers to screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double-exchange clones specifically refers to screening on plates containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing primer pairs: CCGTGATCATGTGCACAGT and GAATCTGAGAGGGCTTCATCTC for PCR identification.

9. The application of Vibrio harveyi with low conjugation transfer efficiency as a genetically engineered bacterium in inhibiting horizontal gene transfer or reducing drug-resistant pathogens, as described in claim 4.

10. A method for horizontal transfer of repressive genes based on Vibrio harveyi CRP knockout, characterized in that, The procedure includes the following steps: introducing the target exogenous plasmid into the conjugation transfer donor bacterium, and then conjugating it with Vibrio harveyi, which has low conjugation transfer efficiency, as described in claim 4; preferably, the exogenous plasmid is pMMB207, and the donor bacterium is Escherichia coli GEB883.

Images