A kasp molecular marker related to scab resistance on wheat chromosome 7b and application thereof

Abstract

The application discloses a KASP molecular marker related to scab resistance on a wheat 7B chromosome and an application thereof, and belongs to the field of molecular biology. The KASP molecular marker closely related to the wheat scab resistance is screened, a nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO. 1, and a primer group for amplifying the KASP molecular marker is further designed, including an upstream primer F1, F2 and a downstream primer R connected with different color fluorescent adapters. Experimental results show that the KASP molecular marker developed by the application can efficiently and accurately identify whether the wheat to be tested has the scab resistance, and then separate the single plant resistant to the scab in a population, is used for improvement breeding of the wheat, and can effectively save detection cost, shorten a period and improve breeding efficiency. The application provides a new theoretical basis and technical means for disease-resistant breeding of the wheat, and has outstanding industrial application value.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a KASP molecular marker on wheat chromosome 7B that is associated with resistance to Fusarium head blight and its applications. Background Technology

[0002] Fusarium head blight (FHB) is a devastating disease of wheat production caused by Fusarium graminearum, often referred to as the "cancer of wheat." It is prevalent in many wheat-growing areas and becomes particularly severe during rainy weather. In recent years, due to global warming and adjustments in farming practices such as returning rice and corn straw to the field, the scope of FHB outbreaks has shown a continuous expansion trend.

[0003] Wheat infected with Fusarium head blight can suffer from seedling rot, stem rot, stalk rot, and ear rot, with ear rot having the most severe impact on yield, reducing it by up to 50%. If wheat experiences rain during the heading and flowering stage, water-soaked light brown spots will appear on infected spikelets and glumes, gradually expanding to cover the entire spikelet. Under high field humidity, pinkish, gelatinous mold spores will form at the sutures of the spikelet glumes. Conidia on diseased ears can be further dispersed and infected by wind and rain, becoming a source of infection. The mycelium of diseased spikelets can also infect the rachis, causing necrosis of the rachis tissue and leading to the drying and death of the upper spikelets. After infecting the grains, the pathogen causes them to dry out and shrivel, and produces mycotoxins, such as deoxynivalenol (DON, also known as vomitoxin).

[0004] If humans or animals accidentally ingest deoxynivalenol and other trichothecene toxins and other types of fungal toxins, various poisoning symptoms such as nausea, vomiting, and diarrhea will usually appear within 1-2 hours. In severe cases, they can inhibit the proliferation of immune cells, damage the immune system, and cause birth defects.

[0005] Chemical control of Fusarium head blight has limitations such as high cost, ecotoxicity, and the risk of pathogen resistance. Therefore, genetic improvement through the discovery and utilization of Fusarium head blight resistance genes in wheat has become the most effective solution for controlling this disease. Currently, only Fhb1 and Fhb7 have been successfully cloned and functionally analyzed globally.

[0006] Traditional QTL mapping methods utilize segregating populations constructed from two parents, where only alleles differing between the two parents segregate, thus revealing only a small portion of the trait's genetic structure. Furthermore, due to varying recombination frequencies, QTL mapping typically has low resolution. Therefore, population-specific QTL mapping methods cannot effectively utilize the broader genetic diversity of germplasm resources. More comprehensive analysis of genetic structure requires considering multiple populations representing larger samples and multiple genetic variations. In addition to traditional QTL mapping, association analysis utilizes natural populations with a broader genetic base, does not require parental hybridization, and provides more efficient and accurate QTL mapping. Association analysis can maximize the extraction of genetic variation present in natural populations; more importantly, it utilizes recombination information accumulated by natural populations over long-term evolution, thereby achieving higher resolution and even directly locating genes themselves.

[0007] In recent years, the improvement of the wheat reference genome map, combined with the development of high-throughput sequencing technology, has provided technical support for the fine mapping of quantitative trait loci (QTLs). The efficient detection system based on KASP markers has become an important tool for molecular marker-assisted selection breeding due to its ease of operation and cost-effectiveness. Summary of the Invention

[0008] The purpose of this invention is to provide a KASP molecular marker on wheat chromosome 7B associated with resistance to Fusarium head blight and its application, thereby addressing the problems existing in the prior art. This invention has screened a KASP molecular marker closely associated with wheat Fusarium head blight, the nucleotide sequence of which is shown in SEQ ID NO.1. Using the KASP molecular marker developed in this invention, it is possible to efficiently and accurately identify whether a wheat sample possesses resistance to Fusarium head blight. This invention provides a new theoretical basis and technical means for disease-resistant breeding of wheat and has outstanding industrial application value.

[0009] To achieve the above objectives, the present invention provides the following solution:

[0010] This invention provides a KASP molecular marker associated with wheat scab resistance. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1. In the sequence shown in SEQ ID NO.1, position S at position 151 indicates polymorphism, which is either C or G.

[0011] The genotypes at position 151 of the sequence shown in SEQ ID NO.1 include CC, CG, and GG.

[0012] The present invention also provides a primer set for amplifying the above-mentioned KASP molecular marker, the primer set comprising nucleotide sequences as shown in SEQ ID NO.2 (F1), as shown in SEQ ID NO.3 (F2), and as shown in SEQ ID NO.4 (R);

[0013] F1 and F2 are connected by fluorescent signal connectors of different colors.

[0014] Furthermore, the fluorescent signal connector connected to F1 is FAM, and the fluorescent signal connector connected to F2 is HEX.

[0015] The present invention also provides the application of the above-mentioned KASP molecular marker or the above-mentioned primer set in the preparation of products for identifying wheat scab resistance.

[0016] Furthermore, the product is a reagent kit.

[0017] The present invention also provides a kit for identifying wheat scab resistance, comprising the primer set described above.

[0018] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer set, or the above-mentioned kit in identifying wheat scab resistance.

[0019] This invention also provides a method for identifying wheat scab resistance, comprising the following steps:

[0020] Genomic DNA was extracted from the wheat sample to be tested;

[0021] The genomic DNA was amplified by PCR using the primer set described above, and the fluorescence signal of the PCR amplification result was read.

[0022] The resistance of the tested wheat to Fusarium head blight can be identified based on the fluorescence signal.

[0023] If the fluorescence signal matches the color of the fluorescent connector of F1, then the wheat to be tested is identified as a wheat susceptible to Fusarium head blight.

[0024] If the fluorescence signal matches the color of the fluorescent connector of F2, then the wheat to be tested is identified as a Fusarium head blight resistant wheat.

[0025] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer set, or the above-mentioned kit in wheat scab resistance breeding.

[0026] This invention also provides a method for breeding wheat resistant to Fusarium head blight, comprising the following steps:

[0027] Genomic DNA was extracted from the wheat sample to be tested;

[0028] The genomic DNA was amplified by PCR using the primer set described above, and the fluorescence signal of the PCR amplification result was read.

[0029] If the fluorescence signal matches the color of the fluorescent connector of F2, the wheat sample to be tested is retained for breeding.

[0030] The present invention discloses the following technical effects:

[0031] This invention screened a KASP molecular marker closely associated with wheat scab resistance, the nucleotide sequence of which is shown in SEQ ID NO.1. A primer set for amplifying this KASP molecular marker was further designed, including upstream primers F1 and F2 connected to fluorescent linkers of different colors, and a downstream primer R. Experimental results show that the KASP molecular marker developed in this invention can efficiently and accurately identify whether a wheat sample possesses scab resistance, thereby isolating scab-resistant individual plants from the population for wheat improvement breeding. This effectively saves detection costs, shortens the cycle, and improves breeding efficiency. This invention provides a new theoretical basis and technical means for wheat disease resistance breeding and has outstanding industrial application value. Attached Figure Description

[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0033] Figure 1 Manhattan plot and QQ plot are used for association analysis of BLUP spikelet disease rate data; in the Manhattan plot, the yellow dashed line represents a significance screening threshold of -log 10 (p) = 5; In the QQ plot, the X-axis represents the chromosomal distribution of all SNP / InDel markers when using the CS v2.1 reference genome, and the Y-axis represents the -log of SNP / InDel markers. 10 (p) value;

[0034] Figure 2 The image shows the results of KASP marker 7B-59160314 at the QFhb.hzau-7B locus in wheat materials 1-96. The X and Y axes represent the fluorescence signals corresponding to allele 1 and allele 2 detected by FAM and HEX dyes, respectively. Blue dots represent susceptible genotypes, while orange dots represent resistant genotypes.

[0035] Figure 3The image shows the results of KASP marker 7B-59160314 at the QFhb.hzau-7B locus in wheat accessions 97-192. The X and Y axes represent the fluorescence signals corresponding to allele 1 and allele 2 detected by FAM and HEX dyes, respectively. Blue dots represent susceptible genotypes, while orange dots represent resistant genotypes.

[0036] Figure 4 The image shows the results of KASP marker 7B-59160314 at the QFhb.hzau-7B locus in wheat accessions 193-247. The X and Y axes represent the fluorescence signals corresponding to allele 1 and allele 2 detected by FAM and HEX dyes, respectively. Blue dots represent susceptible genotypes, while orange dots represent resistant genotypes.

[0037] Figure 5 The figure shows the results of single-marker analysis of KASP marker 7B-59160314 in 247 wheat materials in three environments; where color represents disease response type, yellow indicates susceptibility, blue indicates resistance, and * indicates P<0.05. Detailed Implementation

[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0039] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0040] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0041] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0042] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0043] This invention identified phenotypic resistance to Fusarium head blight in 247 natural populations from both domestic and international sources over a five-year period. Using resequencing genotype data and genome-wide association study (GWAS), a novel Fusarium head blight resistance locus was located in this population on chromosome 7BL (the long arm of chromosome 7B), explaining 9.12% of the phenotypic variation. A KASP marker, 7B-59160314, was developed for this locus, and the strong association between this marker and Fusarium head blight was validated using the 247 accessions.

[0044] All primers used in this invention were synthesized by Shanghai Sangon Biotech Co., Ltd., and primer information is shown in Table 1.

[0045] Table 1 Primer sequences for amplifying KASP marker 7B-59160314

[0046]

[0047] Note: Underlined sequences indicate fluorescent adapter sequences. The fluorescent adapter for F1 is FAM, and the fluorescent adapter for F2 is HEX.

[0048] Example 1

[0049] 1. Phenotypic analysis of wheat scab

[0050] The 247 wheat materials used in this invention include 143 cultivars, 44 local varieties, 10 synthetic wheat varieties, and 50 foreign varieties from CIMMYT. The materials were planted in Ezhou City, Hubei Province, during the 2021-2025 planting season. Each material was sown at 3g per row, with a row length of 1.5m and a row spacing of 25cm, with two replicates. Sumai 3, Yangmai 158, Yangmai 13, and Annong 8455 were used as control varieties for high resistance, moderate resistance, moderate susceptibility, and high susceptibility to wheat scab, respectively. All materials underwent standard field production management before harvest.

[0051] Twenty-one days after inoculation, the number of diseased spikelets and the total number of spikelets were counted. These were then converted into the proportion of small spikes infected (PSS), disease severity (SEV), and disease index (DI). The severity and DI of wheat disease in wheat ears were calculated according to the People's Republic of China National Standard: Technical Specification for Forecasting and Monitoring of Wheat Fusarium Head Blight (GB / T15796-2011). Statistical analysis of the obtained phenotypic data was performed using Excel and SAS-9.2. The results showed that the distribution of Fusarium head blight severity from 0 to 100% was continuous across the five years, and the phenotypic correlations among the five years ranged from 0.11 to 0.55.

[0052] 2. Genotype data analysis

[0053] The resequencing depth of natural populations was between 2× and 6×. FastQC (0.11.9) was used for quality control of this sequencing data to remove low-quality data. After indexing, using the Chinese Spring IWGSC v2.1 genome as a reference, BWA (0.7.17) was used to align the resequencing data of 247 materials back to the reference genome. After filtering, GATK (4.1.9.0) was used to detect inter-material variation. Plink (1.9) was used to filter the data according to the criteria of second allele frequency not less than 5%, locus genotype deletion ratio less than 20%, and sample genotype deletion ratio less than 50%.

[0054] After filtering, 8,425,679 SNPs and 340,241 Indels remained. On average, each chromosome contained 417,400 markers, with chromosomes 1A, 2B, 4A, 7A, and 7B having higher SNP densities than other chromosomes. Within the wheat A, B, and D subgenomes, A and B had higher genome coverage, while D had lower genome coverage.

[0055] Calculate the kinship matrix using GEMMA(0.98.1).

[0056] 3. Correlation Analysis

[0057] Genome-wide association analysis was performed using a mixed linear model in Fastlmm / v0.2.32 software. (The data is expressed in -Logarithmic...) 10 (P)>5 was the screening threshold; a total of 5408 SNP loci were significantly associated with Fusarium head blight. Figure 1As shown in Tables 2, 3, and 4, 1, 3, and 3 significant loci were detected on chromosome 7B under the indicators of disease spikelet percentage (PSS), disease severity (SEV), and disease index (DI), respectively. Among them, locus QFhb.hzau-7B was detected under all three indicators (Table 5). The phenotypic contribution rate of QFhb.hzau-7B was 9.12%.

[0058] Table 2. QTL loci stably detected under the diseased spikelet percentage (PSS) index.

[0059]

[0060] Table 3. QTL sites stably detected under the Disease Indicator (DI) index.

[0061]

[0062] Table 4. QTL sites that were stably detected under the Severity of Illness (SEV) index.

[0063]

[0064] Table 5. QTL sites that were stably detected under the three indicators.

[0065]

[0066] 4. KASP tag development

[0067] In the above experiment, a QTL, QFhb.hzau-7B, which was stable under all three phenotypic evaluation indicators, was obtained based on population genome association analysis. SNP site screening was performed on this QTL, and the steps are as follows:

[0068] (1) To obtain SNP sites, the base sequences of the two parents at the SNP site must be different, and there must be no other SNPs 20bp upstream and 40bp downstream of the SNP. SNP information can be obtained through whole genome sequencing and resequencing.

[0069] (2) Extract parental DNA and dilute it to 50-100 ng / μL for later use;

[0070] (3) Primer design

[0071] a. Starting from the base at the SNP site, count upstream for 20 bp to obtain the left primer f. The base at the SNP site is used as the 20th base of the upstream primer. The other parent is obtained in the same way, resulting in left primers f1 and f2.

[0072] b. Use primer design software or the primer design website PolyMarker (https: / / www.polymarker.info / ) to fix the upstream primer f, and obtain the downstream primer R by BLAST, limiting the product size to less than 60bp;

[0073] c. Add adapters FAM(A1) and HEX(A2) to the 5' ends of the left primers f1 and f2, respectively, so that the sequences are F1 and F2, i.e., F1 = A1-f1, F2 = A2-f2;

[0074] d. Synthesized sequences F1, F2, and R were purified using ULTRPAGE.

[0075] (4) Dissolve the primer powder. The concentration of F1 and F2 is 36 μM and the concentration of R is 90 μM. Mix the three primers in a volume ratio of 1:1:1 to form a Primer mix.

[0076] (5) Primer screening

[0077] Each primer was used to perform at least two PCR amplifications per parent and F1.

[0078] PCR amplification system: DNA 2.5 μL, KASP PCR mix 2.44 μL, Primer mix 0.056 μL;

[0079] The PCR amplification procedure is shown in Table 6.

[0080] Table 6 PCR Amplification Procedure

[0081]

[0082] (6) After amplification, use the real-time PCR reading program as follows:

[0083] Incubate at 25℃ for 5 seconds before reading the bands. After reading, select the fluorescence type (FAM, HEX, ROX) and use AllelicDiscrimination for analysis.

[0084] (7) Select primers with obvious clustering as candidate markers and use them in the population. If the clustering effect is obvious, they can be used as KASP markers.

[0085] This invention screened for the significant SNP site SNP-59160314 on QFhb.hzau-7B; and developed the significant SNP site SNP-59160314 into a KASP marker 7B-59160314, the nucleotide sequence of which is shown in SEQ ID NO.1. The S at position 151 of this sequence indicates polymorphism, which is either C or G. The genotype of this site is CC, CG, or GG. Wheat with the CC genotype is susceptible to Fusarium head blight, and wheat with the GG genotype is resistant to Fusarium head blight.

[0086] SEQ ID NO.1:

[0087] GGATTGACAATAATCGAAGTGCAGCCACTTCAATATAGGGGAAAACCCGTGTGGCACTTCAATGGAGAAGACGATGCCTCCCGCTGCGGTCGCAAAGGTCCGGACTCCACCACATCTTTGGCGAGGATAATGTCCGAATTGTACAAAGGAS AAGAACATGAGTTCCTCCGCATTAAACCGCGGGATGGATTTTCCATGTATAACCCCCAAAGCTGGGTAAGTTGTCATCTTTACTTGGCTCTATCTGTTCTTACCTTCTTTGTCACAATTATTTACATTGCTGTTTCAAAATAGGAACTA.

[0088] The sequences of the two upstream primers and one downstream primer obtained by the design are shown in SEQ ID NO.2-SEQ ID NO.4, respectively, as shown in Table 1.

[0089] The KASP molecular marker 7B-59160314 was validated in 247 wheat materials.

[0090] The validation results after removing other base variations at this site and cases where the phenotypic value of the sample from that year was missing are as follows: Figures 2-5 As shown, the t-test revealed a significant correlation between marker 7B-59160314 and Fusarium head blight phenotypic data in 2021, 2022, and 2024 (P<0.05).

[0091] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a primer set in the preparation of products for identifying wheat scab resistance, characterized in that, The primer set includes nucleotide sequences such as F1 as shown in SEQ ID NO.2, F2 as shown in SEQ ID NO.3, and R as shown in SEQ ID NO.4; F1 and F2 are connected by fluorescent signal connectors of different colors.

2. The application as described in claim 1, characterized in that, The product in question is a reagent kit.

3. The application of a primer set or kit in identifying wheat scab resistance, characterized in that, The primer set includes nucleotide sequences such as F1 as shown in SEQ ID NO.2, F2 as shown in SEQ ID NO.3, and R as shown in SEQ ID NO.4; F1 and F2 are connected by fluorescent signal connectors of different colors; The kit includes the primer set.

4. A method for identifying wheat scab resistance, characterized in that, Includes the following steps: Genomic DNA was extracted from the wheat sample to be tested; The genomic DNA was amplified by PCR using the primer set described in claim 1, and the fluorescence signal of the PCR amplification result was read. The resistance of the tested wheat to Fusarium head blight can be identified based on the fluorescence signal. If the fluorescence signal matches the color of the fluorescent connector of F1, then the wheat to be tested is identified as a wheat susceptible to Fusarium head blight. If the fluorescence signal matches the color of the fluorescent connector of F2, then the wheat to be tested is identified as a Fusarium head blight resistant wheat.

5. The application of a primer set or kit in wheat scab resistance breeding, characterized in that, The primer set includes nucleotide sequences such as F1 as shown in SEQ ID NO.2, F2 as shown in SEQ ID NO.3, and R as shown in SEQ ID NO.4; F1 and F2 are connected by fluorescent signal connectors of different colors; The kit includes the primer set.

6. A method for breeding wheat resistant to Fusarium head blight, characterized in that, Includes the following steps: Genomic DNA was extracted from the wheat sample to be tested; The genomic DNA was amplified by PCR using the primer set described in claim 1, and the fluorescence signal of the PCR amplification result was read. If the fluorescence signal matches the color of the fluorescent connector of F2, the wheat sample to be tested is retained for breeding.

Images