Leukemia fusion gene detection quality control product and preparation method thereof
Patent Information
- Application Number
- CN202610658658.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-13
- Publication Date
- 2026-06-12
Smart Images

Figure CN122189192A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection reagents, and in particular to a quality control product for detecting leukemia fusion genes and its preparation method. Background Technology
[0002] Leukemia is a type of malignant tumor of the hematopoietic system, and gene testing has become a core component in its precise diagnosis, prognostic stratification, treatment selection, and efficacy monitoring. The presence or absence of fusion genes has become one of the key indicators in leukemia diagnosis. For example, the BCR-ABL1 fusion gene is used for the diagnosis of chronic myeloid leukemia or some acute lymphoblastic leukemia and as a companion diagnostic for tyrosine kinase inhibitors (TKIs); the PML-RARA fusion gene is used for the diagnosis and prognostic assessment of acute promyelocytic leukemia; and fusion genes such as CBFB-MYH11, AML1-ETO, and MLL-AF4 are also of great significance in the diagnosis and risk stratification of acute myeloid leukemia (AML) and other subtypes.
[0003] Currently, the main methods for detecting leukemia fusion genes include fluorescence in situ hybridization, real-time quantitative PCR, and next-generation sequencing. Among these, real-time quantitative PCR specifically amplifies and quantifies fusion gene transcripts after reverse transcription, achieving precise and highly sensitive (up to 10^6) detection of the target molecule. -5 ~10 -6 Next-generation sequencing (NGS) sequences DNA or RNA, screening a large number of known and unknown fusion genes at once. Different detection methods vary in sensitivity and specificity, easily leading to inconsistent results. Simultaneously, factors such as operator skill level, instrument performance, and batch-to-batch reagent variations can exacerbate inter-laboratory result fluctuations, affecting comparability. Therefore, establishing a rigorous quality control system is crucial for ensuring testing quality, especially the routine implementation of internal quality control (IQC) and regular participation in external quality assessment (EQA). Both IQC and EQA rely on stable and reliable quality control materials as core support to achieve quality monitoring throughout the entire testing process, ensuring accurate and reliable leukemia fusion gene detection results.
[0004] Currently, there are a small number of quality control products on the market in the form of nucleic acids or pseudoviruses, such as the AML1-ETO fusion mutant genomic RNA standard material. However, these products differ significantly from clinical samples and cannot monitor the entire reaction process. An ideal quality control product for leukemia fusion gene detection should have a human genomic background and be able to monitor the entire detection process, thereby more accurately assessing and controlling the entire process. Stable expression of leukemia-related fusion genes in human cells is an ideal approach for preparing quality control products. However, gene expression in cells is regulated by complex networks involving promoters, enhancers / silencers, and various cis- and trans-acting elements. Gene expression is a dynamic process, with the final expression level determined by both RNA synthesis and degradation rates. The intracellular RNA half-life is precisely regulated by multiple factors, including post-transcriptional modifications, binding proteins, non-coding RNA regulatory networks, and external stress signals.
[0005] Therefore, there is an urgent need to develop a quality control product for leukemia fusion gene detection that can simulate clinical samples, has good homogeneity and stability, and is widely applicable. Summary of the Invention
[0006] To address the shortcomings of existing quality control products, such as poor stability and inability to simulate clinical samples, this invention proposes a quality control product for leukemia fusion gene detection and its preparation method. This quality control product combines the ability to simulate human genome background, the ability to monitor quality throughout the detection process, and high mRNA stability. Combined with precise digital PCR value determination, it provides a standardized and traceable quality control solution for leukemia fusion gene mRNA detection, contributing to further improvements in the accuracy and reliability of clinical testing.
[0007] This invention provides a quality control product for detecting leukemia fusion genes, wherein the quality control product for detecting leukemia fusion genes uses hemoglobin solution as a matrix and includes recombinant cells; The recombinant cells lacked the ZFP36 (Zinc finger protein 36, CCCH-type zinc finger protein) gene and expressed a leukemia fusion gene expression cassette. The leukemia fusion gene is any one of the BCR-ABL1 fusion gene, AML1-ETO fusion gene, and PML-RARA fusion gene; the nucleotide sequence of the BCR-ABL1 fusion gene is shown in SEQ ID No. 5, the nucleotide sequence of the AML1-ETO fusion gene is shown in SEQ ID No. 6, and the nucleotide sequence of the PML-RARA fusion gene is shown in SEQ ID No. 7.
[0008] The leukemia fusion gene expression cassette includes a 3' untranslated region, which contains at least three ARE (AU Rich Element) sequences.
[0009] This invention, by introducing at least three ARE sequences into the 3' uncoding region, can further enhance the stability of the fusion gene mRNA, and together with the ZFP36 gene knockout, form a dual stable regulatory system, which significantly delays RNA degradation and improves expression level and storage stability.
[0010] In some embodiments, the ARE sequence comprises the sequence shown in SEQ ID No. 8.
[0011] In some embodiments, the recombinant cells are mammalian cells.
[0012] In some embodiments, the mammalian cells are immortalized B cells; preferably, the immortalized B cells are GM12878 cells, GM24385 cells, GM24149 cells, GM24143 cells, GM24631 cells, GM24694 cells, GM24695 cells, Raji cells, HMy2.CIR cells, Daudi cells, Ramos cells, or DB cells. The use of immortalized B cells in this invention can more realistically simulate the molecular detection scenario of leukemia occurrence and clinical samples, more closely resemble the state of real clinical samples, and improve the accuracy and representativeness of quality control results.
[0013] It should be noted that those skilled in the art can use the above examples or other immortalized B cells according to actual needs to realize the present invention without creative effort, and all of them fall within the protection scope of the present invention.
[0014] In some embodiments, the copy number concentration of the recombinant cells is 5 × 10⁻⁶. 4 ~1×10 7 copies / mL.
[0015] In some embodiments, the leukemia fusion gene expression cassette further includes a promoter, a leukemia fusion gene, and a terminator.
[0016] In some embodiments, the promoter is a CMV promoter, SV40 promoter, RSV promoter, EF1α promoter, CAG promoter, Ubiquitin promoter, β-actin promoter, PGK promoter, TK promoter, or GAPDH promoter.
[0017] In some embodiments, the terminator is a BGH polyA signal sequence, an SV40 polyA signal sequence, an HSV polyA signal sequence, a β-globin polyA signal sequence, a growth hormone polyA signal sequence, or a GAPDH terminator.
[0018] In some embodiments, the 3' non-coding region is derived from housekeeping genes, inflammatory cytokine genes, cytokine genes, or transcriptional regulatory genes.
[0019] The present invention also provides the application of the aforementioned leukemia fusion gene detection quality control material in the preparation of leukemia fusion gene detection reagents or detection kits.
[0020] In summary, compared with the prior art, the present invention achieves the following technical effects: (1) This invention constructs a dual-regulatory gene expression system by ZFP36 knockout combined with target gene 3'UTR sequence modification, which significantly improves the expression efficiency and RNA stability of the target fusion gene. It fundamentally solves the technical problems of traditional mRNA quality control products being easily degraded, having a short shelf life, and having large concentration fluctuations. This allows the quality control products to maintain a stable target content during long-term storage, meeting the requirements of clinical testing for stability and reproducibility.
[0021] (2) This invention uses clinical simulation quality control material construction technology, with gene-edited cells that highly express fusion genes as the core raw material. It completely preserves the human genome background and cell structure, and can realistically simulate the entire process of nucleic acid release and detection of clinical samples. It can simultaneously achieve quality control of the entire process of cell lysis, RNA extraction, and fluorescent PCR amplification, effectively overcoming the inherent defects of quality control materials such as in vitro transcribed RNA and pseudoviruses that cannot simulate real cell samples and are difficult to evaluate extraction efficiency. It greatly improves the authenticity, reliability and applicability of quality control results, and is more in line with the quality control requirements of clinical molecular detection of leukemia fusion genes.
[0022] (3) The leukemia fusion gene detection quality control product of the present invention has excellent batch-to-batch consistency, with small differences in target copy number between different batches and different packaging units and high precision, which can ensure the comparability and reliability of clinical test results. At the same time, the quality control product has excellent stability, which greatly extends the product shelf life, reduces the risks of use and transportation, and can meet the needs of clinical molecular testing laboratories for long-term, stable and reliable use of quality control products.
[0023] (4) The leukemia fusion gene detection quality control product of the present invention is applicable to mainstream detection platforms such as fluorescence quantitative PCR and digital PCR. It has strong compatibility and high versatility, and can be directly adapted to commonly used clinical leukemia fusion gene detection kits and detection systems without additional adjustment to the detection process. Attached Figure Description
[0024] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0025] Figure 1 This is for the identification of ZFP36 protein expression in Example 1 of the present invention.
[0026] Figure 2 This is a schematic diagram of the gene editing plasmid in Example 2 of the present invention.
[0027] Figure 3 The data represents the expression level of the fusion gene in cells of Example 3 of this invention; the data are the means of three independent experiments, and the error bar represents the standard deviation (SD); differences between groups were analyzed using analysis of variance. "" indicates a significant difference (P<0.05).
[0028] Figure 4 Example 4 of this invention illustrates the change in BCR-ABL1 fusion gene RNA content over time; the RNA content on day 0 was taken as 100% baseline; the RNA content at each subsequent time point was compared with the baseline value on day 0 within each group, and the relative percentage change was calculated; the data are the means of three independent experiments, and the error bar represents the standard deviation (SD); differences between groups were analyzed using two-way ANOVA. "" indicates a significant difference (P<0.05).
[0029] Figure 5 This invention presents Example 4 of the variation of AML1-ETO fusion gene RNA content over time; the RNA content on day 0 was taken as 100% baseline; the RNA content at each subsequent time point was compared with the baseline value on day 0 within each group, and the relative percentage change was calculated; the data are the means of three independent experiments, and the error bar represents the standard deviation (SD); the differences between groups were analyzed using two-way ANOVA. "" indicates a significant difference (P<0.05).
[0030] Figure 6 This invention presents the variation of PML-RARA fusion gene RNA content over time in Example 4 of this invention; the RNA content on day 0 is taken as 100% baseline; the RNA content at each subsequent time point is compared with the baseline value on day 0 within each group, and the relative percentage change is calculated; the data are the means of three independent experiments, and the error bar represents the standard deviation (SD); the differences between groups are analyzed using two-way ANOVA. "" indicates a significant difference (P<0.05). Detailed Implementation
[0031] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all materials and reagents used are commercially available.
[0033] The technical solution of this invention is as follows: A specific single guide RNA (sgRNA) sequence is designed and synthesized targeting the ZFP36 gene, and assembled with Cas9 protein to form a ribonucleoprotein (RNP) complex for the knockout of this gene. Further, in the ZFP36 knockout... - / - In cells, BCR-ABL1, AML1-ETO, or PML-RARA fusion gene expression cassettes were knocked in, respectively. Each fusion gene expression cassette included a promoter, a fusion gene CDS sequence, a 3' UTR sequence, and a terminator, with multiple copies of the ARE sequence introduced into the 3' UTR sequence, resulting in positive cells stably expressing the BCR-ABL1, AML1-ETO, or PML-RARA fusion genes. Negative cells not expressing the fusion genes were mixed with BCR-ABL1-positive, AML1-ETO-positive, or PML-RARA-positive cells at different ratios and stored in cell preservation medium to prepare quality control samples for leukemia fusion gene detection at different concentrations. Finally, digital PCR was used to determine the mRNA levels of the different leukemia fusion gene quality control samples, and their homogeneity and stability were examined. The suitability of the samples was also verified using a commercially available, certified kit.
[0034] Example 1: Preparation of ZFP36 knockout cell lines (1) The sgRNA sequence targeting ZFP36: TGCCAGTTTGCCCATGGCCT (SEQ ID No.1). This sgRNA was obtained by chemical synthesis.
[0035] (2) Cell transfection: After the above sgRNA and Cas9 protein are assembled into RNP, the plasmid is transfected into GM12878 cells by liposomes. The specific operation is performed according to the instructions of the jetPRIME® transfection reagent (Polyplus).
[0036] (3) Single-clone culture: 24 h after transfection, a) collect cells by centrifugation. b) Count the cells accurately according to the serial dilution method, dilute the live cells to 5 cells / mL with culture medium (containing 5% BriClone additive), and mix the cells thoroughly. c) Take 10 mL of cell suspension and evenly distribute it into a 96-well plate, 0.1 mL per well.
[0037] (4) Single clone identification: The cells were placed in a cell culture incubator and cultured. When cell clones were formed, the wells marked with clones were used as templates for PCR and Sanger sequencing. The remaining cells were cultured for later use.
[0038] (5) Cell line construction: Cells with frameshift mutations in the ZFP36 gene were selected from the Sanger results, cultured extensively, and a cell library was constructed for subsequent experiments. The CDS sequence of the ZFP36 knockout cells used in this invention is shown in SEQ ID No. 2, where the sequence between " / / " represents the deleted bases.
[0039] (6) Identification of ZFP36 protein expression: For the cells with the frameshift mutation, Western blot experiments were further performed to verify the activity of the ZFP36 protein. For example... Figure 1 As shown, in ZFP36 - / - In the cells, the expression of ZFP36 protein was almost undetectable, verifying the success of the gene knockout.
[0040] Example 2 Construction of fusion gene expression cell lines In wild type (ZFP36) + / + ) and knockout (ZFP36) - / - In GM12878 cells, using the CRISPR / Cas9 system, fusion gene expression cassettes carrying the 3'UTR sequence were knocked into adeno-associated virus integration site 1 (AAVS1). The gene editing procedure was consistent with the ZFP36 gene knockout. The specific steps were as follows: (1) A specific sgRNA was designed and synthesized targeting the AAVS1 site, with the sequence: GGGGCCACTAGGGACAGGAT (SEQ ID No. 3). (2) Chemically synthesized plasmids containing fusion gene expression cassettes, comprising: The CMV promoter, with its nucleotide sequence shown in SEQ ID No. 4. The CDS sequence of the BCR-ABL1 fusion gene, shown in SEQ ID No. 5. The CDS sequence of the AML1-ETO fusion gene, shown in SEQ ID No. 6. The CDS sequence of the PML-RARA fusion gene, shown in SEQ ID No. 7.
[0041] 3'UTR sequence: (1) The 3'UTR sequence of the modified RPP30 gene was used, in which the ARE sequence (SEQ ID No.8) was removed and it was denoted as ARE0 (SEQ ID No.9).
[0042] (2) The 3'UTR sequence of the modified RPP30 gene, containing 3 copies of the ARE sequence, is designated as ARE3 (SEQ ID No. 10).
[0043] The bGH poly(A) signal sequence is shown in SEQ ID No. 11, the homologous left arm sequence is shown in SEQ ID No. 12, and the homologous right arm sequence is shown in SEQ ID No. 13.
[0044] (3) Construction of gene editing plasmids The synthesized sequences were ligated into the pUC57 backbone vector via 5-NheI and 3-NotI restriction sites (see schematic diagram of the vector). Figure 2 (As shown).
[0045] (4) Cell editing In wild type (ZFP36) + / + ) and knockout (ZFP36) - / - In GM12878 cells, the fusion gene expression cassette was further integrated into the AAVS1 site using the CRISPR / Cas9 system. The editing process was similar to that of ZFP36 gene knockout, specifically as follows: ① Cell transfection: The above-mentioned sgRNA targeting AAVS1 was assembled with Cas9 protein to form RNPs, and BCR-ABL1, AML1-ETO, and PML-RARA fusion gene expression plasmids were transfected into wild-type (ZFP36) cells via liposomes. + / + ) and knockout (ZFP36) - / - In GM12878 cells, the specific procedures were performed according to the instructions of the jetPRIME® transfection reagent (Polyplus).
[0046] ② Antibiotic selection: 24 h after transfection, cells were cultured for 1 to 5 days using 0.1–5.0 μg / mL puromycin. Then, the cells were cultured for another day using puromycin-free medium.
[0047] ③ Monoclonal Culture: After resistance selection, a) collect cells by centrifugation. b) Count cells accurately using serial dilution, dilute viable cells to 5 cells / mL with culture medium (containing 5% BriClone additive), and mix the cells thoroughly. c) Take 10mL of cell suspension and evenly distribute 0.1mL into each well of a 96-well plate.
[0048] ④ Single-clone identification: Cells are cultured in a cell culture incubator. Once cell clones have formed, the wells marked with clones are used as templates for PCR and Sanger sequencing. The remaining cells are cultured for later use.
[0049] ⑤ Cell line construction: Positive cells were selected based on PCR and Sanger sequencing results, expanded in culture, and a cell bank was constructed for subsequent experiments. Cell information involved in this invention is shown in Table 1.
[0050] Table 1. Cell line information used in this invention
[0051] Example 3: Detection of Fusion Gene Expression After cell library construction, RNA was extracted from a portion of the cells, and the RNA content of the fusion gene was detected using the primers and probes in Table 2 and digital PCR.
[0052] Table 2. Digital PCR primers and probes used for RNA quantification in this invention.
[0053] like Figure 3 As shown, the expression level of the fusion gene was low in ZFP36 wild-type cells (cells A, B, and C). In ZFP36 knockout cells (cells D, E, and F), the expression level of the fusion gene was significantly enhanced. Furthermore, the expression intensity of the fusion gene was further enhanced in cells with an additional 3 copies of the ARE sequence in the 3'UTR sequence (cells G, H, and I).
[0054] Example 4: Study on the stability of fusion gene mRNA To investigate the effect of ZFP36 gene knockout and fusion gene 3'UTR region augmentation with ARE sequences on RNA stability, cells were stored at 2–8°C, and RNA content changes were measured after 2, 4, and 7 days of storage. Figures 4-6It was found that the degradation of fusion gene RNA was relatively rapid in wild-type cells (cells A, B, and C); after knocking out the ZFP36 gene (cells D, E, and F), the degradation of fusion gene RNA was significantly improved; furthermore, the degradation rate of fusion gene RNA was further significantly slowed down by using a 3'UTR with 3 copies of the ARE sequence (cells G, H, and I).
[0055] The above data indicate that, under conditions of ZFP36 gene knockout, using the ARE sequence in the modified 3'UTR as a regulatory element can significantly delay RNA degradation, thereby improving RNA stability.
[0056] Example 5: Preparation of quality control material for leukemia fusion gene detection To achieve quality control throughout the entire process of leukemia fusion gene detection, this embodiment employs a strategy of gradient mixing of negative cells with BCR-ABL1 positive (cell G), AML1-ETO positive (cell H), or PML-RARA positive (cell I) cells to construct quality control materials. Wild-type GM12878 cells were used as the negative cells. By adjusting the mixing ratio of positive and negative cells, four quality control materials with different fusion gene RNA copy number concentration levels were established, covering the linear range of clinical testing. The low concentration level was close to the kit's limit of detection (20,000 copies / mL), while the high concentration level represented typical values for strongly positive clinical samples. The concentration of the quality control materials was measured using digital PCR to confirm that the fusion gene RNA copy number was within the theoretical copy number concentration range. The specific theoretical copy number range is shown in Table 3 below.
[0057] Table 3. Theoretical copy number range of fusion gene RNA
[0058] The viable cell concentration of the mixed cell suspension was counted using a cell counter to ensure that the total cell concentration of each quality control sample was (1.0 ± 0.5) × 10⁻⁶. 5 The cells / mL quality control sample uses a 120 g / L hemoglobin solution as a matrix to simulate real clinical samples.
[0059] The copy number of quality control samples at various concentration levels was detected using digital PCR. The measured copy number of representative batches is shown in the table below. The measured copy number is within the theoretical copy number range.
[0060] Table 4 Measured copy number of quality control samples
[0061] Example 6: Homogeneity Verification of Quality Control Samples for Leukemia Fusion Gene Detection (1) Uniformity verification In accordance with the requirements of GB / T 15000.3-2023 "Standard Sample Working Guidelines Part 3: Standard Sample Value Assignment and Homogeneity and Stability Assessment", the homogeneity of the quality control samples prepared in this study was evaluated to confirm the consistency of values among different packaging units within each batch.
[0062] Ten smallest packaging units were randomly selected from each batch of quality control samples at low, medium, and high concentration levels using random sampling. Digital PCR was performed three independent tests on each sample under repeatability conditions. One-way ANOVA was used to statistically analyze the detection data for each concentration level and target, calculating the ratio of inter-vial mean square to intra-vial mean square (F-value), and the inter-vial coefficient of variation (CV) was also calculated as an auxiliary indicator of precision. Judgment criterion: At a 95% confidence level, if the calculated F-value is less than the critical value F... 0.05 (9,20) = 2.39 (P > 0.05), indicating that the difference between bottles is not statistically significant; at the same time, the coefficient of variation (CV) between bottles is not greater than 5%, so the homogeneity is considered acceptable. The homogeneity data are shown in Table 5 below: Table 5. Results of homogeneity verification of leukemia fusion gene detection quality control materials
[0063] One-way ANOVA confirmed that the calculated F-values for all detection targets were less than the critical value Fc. 0.05 The p-values (9,20) = 2.39 and the p-values were all greater than 0.05, indicating that there was no statistically significant difference between vials at the 95% confidence level. Furthermore, the coefficient of variation (CV) between vials for each target was ≤5%, meeting the industry-acceptable standard (≤5%), confirming good inter-vial precision. Therefore, all detection targets in the three batches at different concentration levels showed good intra-batch homogeneity, meeting the preset requirements.
[0064] Example 7: Stability Verification of Quality Control Products for Leukemia Fusion Gene Detection In accordance with the requirements of GB / T 15000.3-2023 "Standard Sample Working Guidelines Part 3: Standard Sample Value Assignment and Homogeneity and Stability Assessment", the stability of the quality control samples prepared in this study was evaluated.
[0065] Three batches of quality control samples were collected at 0 (T0, baseline), 3 (T1), 6 (T2), 12 (T3), and 13 (T4), with three replicates at each time point. Each sample underwent two digital PCR tests to determine the copy number concentration. Using T0 as the baseline, the bias of the measured copy number at each time point relative to T0 was examined. The pre-set acceptance criteria were: absolute bias of each target ≤10%, no amplification in negative controls, and 100% specificity. Simultaneously, linear regression analysis was used to analyze the relationship between time and concentration to assess the trend of concentration changes over time.
[0066] For the three batches of leukemia fusion gene detection quality control products, the bias of all samples at each time point relative to T0 was statistically analyzed. The bias details are shown in Table 6 below: Table 6. Absolute values (%) of the stability bias of the leukemia fusion gene detection quality control products at various time points.
[0067] Data show that, under the cryopreservation condition of -20±5℃, the absolute values of all biases of each batch of quality control samples were less than the 10% limit during the monitoring period of 0 to 13 months; in addition, the coefficient of variation (CV) at each time point was less than 5%, indicating good repeatability of the test; at the same time, no non-specific amplification signals were detected in the negative control samples, and the negative concordance rate was 100%.
[0068] Furthermore, a linear regression model was used to statistically analyze the detected concentrations (copy number / mL) at different time points to assess the trend of concentration changes. For each combination (a total of 27 data sets), linear regression was performed with time (months) as the independent variable and the measured concentration as the dependent variable. The regression slope and its significance were calculated, and the specific results are shown in Table 7 below: Table 7 Results of linear regression analysis on stability
[0069] The results in Table 7 show that the regression slopes of all combinations were not significant (P>0.05), and their 95% confidence intervals all included 0, indicating that no significant increase or decrease in the detection concentration was observed over time during the 13-month storage period under the storage conditions of -20±5℃.
[0070] In summary, the three batches of leukemia fusion gene quality control products prepared in this study maintained good stability for at least 13 months under cryopreservation conditions of -20±5℃. The deviation of the detected concentration from the initial value met the preset standard of ≤±10%, and no significant concentration change trend was observed. Therefore, the long-term stability of this product can be determined to be 12 months (T3 time point). Further monitoring at longer time points can be conducted as needed to support the extension of the shelf life.
[0071] Example 8: Applicability Study of Quality Control Products for Leukemia Fusion Gene Detection The applicability of a commercially available kit based on multiplex fluorescent PCR (Xiamen Zhishan Biotechnology Co., Ltd., Leukemia Fusion Gene Detection Kit (Fluorescent PCR Method), National Medical Device Registration Certificate No. 20183400429) was verified. This kit can simultaneously detect multiple fusion genes. The detection procedure followed the instructions: 1 mL of quality control sample was taken, and RNA was extracted using TRIzol reagent, with an elution volume of 50 μL; the reverse transcription reaction system was 20 μL (containing 13.5 μL of RT-PCR mixture, 1.5 μL of enzyme mixture, and 5 μL of RNA template), and amplification was performed on an ABI 7500 instrument; the reaction conditions were 37℃ reverse transcription for 15 min, and 85℃ pre-denaturation for 2 min. The PCR reaction program was: UNG treatment for 2 min, 50℃; 95℃ pre-denaturation for 10 min; 10 cycles (95℃ for 20 s, 60℃ for 60 s) (decreasing by 1℃ per cycle), and 40 cycles (95℃ for 20 s, 56℃ for 32 s, 72℃ for 60 s). The FAM channel of reaction solution A detects the PML-RARA gene, and the ROX channel detects the AML1-ETO gene; the FAM channel of reaction solution B detects the BCR-ABL1 gene. The Cy5 channel of both reaction solutions A and B detects the internal control gene GUSB. A commercially available kit was used to test the quality control material for leukemia fusion gene detection. The Ct values measured by the kit are shown in Table 8. Table 8. Applicability verification Ct value results
[0072] Table 8 shows that all quality control samples at various concentration levels were detected normally, and the negative control showed no amplification signal. Low-concentration quality control samples all showed clear and specific amplification; the Ct value of the internal reference gene remained stable between 19.49 and 20.47. Medium-concentration quality control samples showed significantly enhanced amplification signals of the target gene, with a significantly decreased Ct value; the Ct value of the internal reference gene was between 19.25 and 20.86. High-concentration quality control samples showed strong positive amplification; the Ct value of the internal reference gene remained between 19.69 and 20.75. The internal reference gene GUSB in all samples amplified stably, with Ct values concentrated in the range of 19 to 21, without significant fluctuations, indicating complete RNA extraction and an effective reaction system. As the concentration gradient of the quality control samples increased, the Ct values of each fusion gene target decreased in a gradient manner, consistent with the negative correlation between concentration and Ct value in quantitative real-time PCR. The quality control sample for leukemia fusion gene detection prepared in this invention exhibits normal amplification, accurate genotyping, and good concentration gradient response in commercial fluorescent PCR detection systems. The negative control sample shows no nonspecific amplification, and the positive control sample can be accurately detected. The internal reference gene amplifies stably, and the reaction system is effective. These results demonstrate that the quality control sample is highly compatible with mainstream clinical leukemia fusion gene detection kits, realistically simulating the entire clinical sample testing process, and is suitable for quality control throughout the entire leukemia fusion gene detection workflow.
[0073] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0074] sequence list SEQ ID No.1 TGCCAGTTTGCCCATGGCCT SEQ ID No.2 ATGGATCTGACTGCCATCTACGAGAGCCTCCTGTCGCTGAGCCCTGACGTGCCCGTGCCATCCGACCATGGAGGGACTGAGTCCAGCCCAGGCTGGGGCTCCTCGGGACCCTGGAGCCTGAGCCCCTCCGACTCCAGCCCGTCTGGGGTCACCTCCCGCCTGCCTGGCCGCTCCACCAGCCTAGTGGAGGGCCGCAGCTGTGGCTGGGTGCCCCCACCCCCTGGCTTCGCACCGCTGGCTCCCCGCCTGGGCCCTGAGCTGTCACCCTCACCCACTTCGCCCACTGCAACCTCCACCACCCCCTCGCGCTACAAGACTGAGCTATGTCGGACCTTCTCAGAGAGTGGGCGCTGCCGCTACGGGGCCAAGTGCCAGTTTGCCCAT / / GG / / CCTGGGCGAGCTGCGCCAGGCCAATCGCCACCCCAAATACAAGACGGAACTCTGTCACAAGTTCTACCTCCAGGGCCGCTGCCCCTACGGCTCTCGCTGCCACTTCATCCACAACCCTAGCGAAGACCTGGCGGCCCCGGGCCACCCTCCTGTGCTTCGCCAGAGCATCAGCTTCTCCGGCCTGCCCTCTGGCCGCCGGACCTCACCACCACCACCAGGCCTGGCCGGCCCTTCCCTGTCCTCCAGCTCCTTCTCGCCCTCCAGCTCCCCACCACCACCTGGGGACCTTCCACTGTCACCCTCTGCCTTCTCTGCTGCCCCTGGCACCCCCCTGGCTCGAAGAGACCCCACCCCAGTCTGTTGCCCCTCCTGCCGAAGGGCCACTCCTATCAGCGTCTGGGGGCCCTTGGGTGGCCTGGTTCGGACCCCCTCTGTACAGTCCCTGGGATCCGACCCTGATGAATATGCCAGCAGCGGCAGCAGCCTGGGGGGCTCTGACTCTCCCGTCTTCGAGGCGGGAGTTTTTGCACCACCCCAGCCCGTGGCAGCCCCCCGGCGACTCCCCATCTTCAATCGCATCTCTGTTTCTGAGTGA SEQ ID No.3 GGGGCCACTAGGGACAGGAT SEQ ID No.4 CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT SEQ ID No.5 SEQ ID No.6 SEQ ID No.7 SEQ ID No.8 AATAATTTATTTT SEQ ID NO.9 SEQ ID No.10 SEQ ID No.11 CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTA SEQ ID No.12 GAGCACTTCCTTCTCGGCGCTGCACCACGTGATGTCCTCTGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCGGGCATCTCTCCTCCCTCACCCAACCCCATGCCGTCTTCACTCGCTGGGTTCCCTTTTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCGACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCGTTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATCCTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCACTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCTCTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTCTTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCA SEQ ID No.13 GCCAGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGGGGGGATGCGTGACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTCTCCCAGAACCTGAGCTGCTCTGACGCGGCCGTCTGGTGCGTTTCACTGATCCTGGTGCTGCAGCTTCCTTACACTTCCCAAGAGGAGAAGCAGTTTGGAAAAACAAAATCAGAATAAGTTGGTCCTGAGTTCTAACTTTGGCTCTTCACCTTTCTAGTCCCCAATTTATATTGTTCCTCCGTGCGTCAGTTTTACCTGTGAGATAAGGCCAGTAGCCAGCCCCGTCCTGGCAGGGCTGTGGTGAGGAGGGGGGTGTCCGTGTGGAAAACTCCCTTTGTGAGAATGGTGCGTCCTAGGTGTTCACCAGGTCGTGGCCGCCTCTACTCCCTTTCTCTTTCTCCATCCTTCTTTCCTTAAAGAGTCCCCAGTGCTATCTGGGACATATTCCTCCGCCCAGAGCAGGGTCCCGCTTCCCTAAGGCCCTGCTCTG SEQ ID No.14 GGGAGGTTGTTCAGATGACC SEQ ID No.15 GTGCAATCAGAGAAGAAAATCCT SEQ ID No.16 CGCTGTGGAGTGGGTTTTAT SEQ ID No.17 CTTGGGAGACTGTGGGACTT SEQ ID No.18 GTTTTCAGAAACACAACCTTCTT SEQ ID No.19 CTCAAGCTTTTCACTCA SEQ ID No.20 TCTTCCTGCCCAACAGCAA SEQ ID No.21 GCTGGGCACTATCTCTTCAGAAC SEQ ID No.22 TCTCAATGGCTGCCTC。
Claims
1. A quality control product for detecting leukemia fusion genes, characterized in that, The quality control material for detecting leukemia fusion genes uses hemoglobin solution as a matrix and includes recombinant cells; The recombinant cells lacked the ZFP36 gene and expressed a leukemia fusion gene expression cassette. The leukemia fusion gene is any one of the following: BCR-ABL1 fusion gene, AML1-ETO fusion gene, and PML-RARA fusion gene. The leukemia fusion gene expression cassette includes a 3' untranslated region, which contains at least three ARE sequences.
2. The quality control product for leukemia fusion gene detection according to claim 1, characterized in that, The ARE sequence includes the sequence shown in SEQ ID No.
8.
3. The quality control product for leukemia fusion gene detection according to claim 1, characterized in that, The recombinant cells are mammalian cells.
4. The quality control product for leukemia fusion gene detection according to claim 3, characterized in that, The mammalian cells mentioned are immortalized B cells.
5. The quality control product for leukemia fusion gene detection according to claim 1, characterized in that, The copy number concentration of the fusion gene RNA is 5 × 10⁻⁶. 4 ~1×10 7 copies / mL.
6. The quality control product for leukemia fusion gene detection according to claim 1, characterized in that, The leukemia fusion gene expression cassette also includes a promoter, a leukemia fusion gene, and a terminator.
7. The quality control product for leukemia fusion gene detection according to claim 6, characterized in that, The promoter is a CMV promoter, SV40 promoter, RSV promoter, EF1α promoter, CAG promoter, Ubiquitin promoter, β-actin promoter, PGK promoter, TK promoter, or GAPDH promoter.
8. The quality control product for leukemia fusion gene detection according to claim 6, characterized in that, The terminator is a BGHpolyA signal sequence, an SV40 polyA signal sequence, an HSV polyA signal sequence, a β-globin polyA signal sequence, a growth hormone polyA signal sequence, or a GAPDH terminator.
9. The quality control product for leukemia fusion gene detection according to claim 1, characterized in that, The 3' non-coding region is derived from housekeeping genes, inflammatory cytokine genes, cytokine genes, or transcriptional regulatory genes.
10. The use of the leukemia fusion gene detection quality control material according to any one of claims 1 to 9 in the preparation of leukemia fusion gene detection reagents or detection kits.