DNA polymerases and uses thereof

Abstract

This invention provides a DNA polymerase comprising: a) the amino acid sequence shown in SEQ ID NO: 2; b) an amino acid sequence having one or more substitutions, deletions, and / or additions of amino acids compared to the amino acid sequence shown in SEQ ID NO: 2, and possessing polymerase function; or c) an amino acid sequence having at least 86% sequence identity compared to the amino acid sequence shown in SEQ ID NO: 2, and possessing polymerase function. The DNA polymerase exhibits good thermostability, 5'→3' polymerase activity, 3'→5' exonuclease activity, and good PCR amplification performance. It has significant application potential and room for modification, and can be further optimized according to different application scenarios, possessing considerable room for improvement and application potential.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and more specifically, this invention relates to DNA polymerase and its applications. Background Technology

[0002] Polymerase chain reaction (PCR) is one of the most important in vitro nucleic acid amplification techniques in molecular biology research. DNA polymerase is one of the commonly used enzymes in PCR reactions. It uses single-stranded DNA as a template and four types of deoxyribonucleotides as substrates to catalyze the polymerization to form daughter DNA.

[0003] DNA polymerases are classified into six families: A, B, C, D, X, and Y. Most of the thermostable DNA polymerases discovered so far belong to family A or family B. DNA polymerases belonging to family A are all derived from eubacteria, such as those from the genera *Thermus aquaticus*, *Thermus thermophilus*, *Thermus caldophilus*, *Thermus flavus*, and *Thermus filiformis*, and those from the genus *Bacillus stearothemophilis*, and others. Thermostable DNA polymerases belonging to the B family all originate from archaea, such as Tli (Thermococcus litoralis) from the genus Thermococcus, Pfu (Pyrococcus furiosus) and KOD1 (Thermococcus kodacaraensis) from the genus Thermococcus, as well as Pwo (Pyrococcus woesei), Tgo (Thermococcus gorgonarius), and Pab (Pyrococcus abyssi) from the genus Pfu.

[0004] DNA polymerases extend the new strand along the 5'→3' direction during PCR amplification, and some DNA polymerases also possess exonuclease activity along the 3'→5' direction. If mismatched bases occur during PCR amplification, these DNA polymerases with exonuclease activity can remove the mismatched bases and correct the error in the newly generated DNA. Afterward, these polymerases can continue to introduce the correct bases, thus ensuring the accuracy of amplification. Generally, family A DNA polymerases mainly have 5'→3' polymerase activity and 5'→3' exonuclease activity; while family B DNA polymerases mainly have 5'→3' polymerase activity and 3'→5' exonuclease activity. This unique 3'→5' exonuclease activity endows family B DNA polymerases with a correction function. Therefore, compared with ordinary DNA polymerases (such as Taq DNA polymerase), family B polymerases have a lower error rate and are suitable for applications requiring high PCR fidelity.

[0005] The primary application of DNA polymerase is in PCR reactions. This application necessitates that DNA polymerase possess the following three key properties: 1. High thermal stability; 2. High fidelity; 3. Sustained synthesis capability. With increasing application demands, in addition to the above basic requirements, the expansion of application scenarios places higher demands on DNA polymerase performance: such as faster extension speed, high amplification specificity, amplifurability with low template amounts, and amplifurability in special environments (such as high salt), to meet the needs of DNA amplification, synthesis, detection, sequencing, and other important recombinant DNA technologies.

[0006] Currently, widely used B-family DNA polymerases are mainly represented by KOD and Pfu DNA polymerases. Although these DNA polymerases have a certain degree of fidelity, they have certain disadvantages in terms of high-continuous synthesis capacity and high-fidelity performance. To address these shortcomings, various variant DNA polymerases and their commercial products have been developed, but their deficiencies have not been fully resolved. Furthermore, most B-family DNA polymerases are currently developed based on Pfu or KOD DNA polymerases. Although research and modification of KOD and Pfu DNA polymerases are relatively mature, the enzyme backbones available for modification for high-fidelity DNA polymerases are very limited. Therefore, the search for novel B-family DNA polymerases is of great significance and value. Summary of the Invention

[0007] To address the problems existing in the prior art, this invention aims to provide a novel B-family DNA polymerase with good thermal stability, and simultaneously possesses the 5'→3' polymerase activity and 3'→5' exonuclease activity unique to B-family polymerases. It exhibits good PCR amplification performance and has great potential for modification, providing a high-quality initial protein backbone for the development of high-fidelity DNA polymerases with strong and continuous synthesis capabilities.

[0008] Therefore, in a first aspect, the present invention provides a DNA polymerase comprising:

[0009] a) The amino acid sequence as shown in SEQ ID NO: 2;

[0010] b) An amino acid sequence having one or more substitutions, deletions, and / or additions of amino acids and possessing polymerase function, compared to the amino acid sequence shown in SEQ ID NO: 2; or

[0011] c) An amino acid sequence having at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and having polymerase function.

[0012] In a second aspect, the present invention provides an isolated nucleic acid comprising a nucleotide sequence encoding a DNA polymerase of the first aspect of the present invention.

[0013] In a third aspect, the present invention provides an expression vector comprising the nucleic acid of the second aspect of the present invention.

[0014] In a fourth aspect, the present invention provides a recombinant cell comprising the nucleic acid of the second aspect of the present invention or the expression vector of the third aspect of the present invention.

[0015] In a fifth aspect, the present invention provides a method for amplifying a target nucleic acid, the method comprising the step of amplifying a target nucleic acid present in a sample using a DNA polymerase of the first aspect of the present invention.

[0016] In a sixth aspect, the present invention provides a method for constructing a nucleic acid library, the method comprising the step of amplifying a target nucleic acid present in a sample using the DNA polymerase of the first aspect of the present invention.

[0017] In a seventh aspect, the present invention provides a kit comprising the DNA polymerase of the first aspect of the present invention.

[0018] The beneficial effects of the present invention include at least one or more of the following:

[0019] This invention provides a novel B-family DNA polymerase, which is named 36°N DNA polymerase in this paper. It has good thermostability, 5'→3' polymerase activity and 3'→5' exonuclease activity, as well as good PCR amplification performance (extension rate greater than 2kb / min and good long fragment amplification ability).

[0020] The 36°N DNA polymerase provided by this invention has good original enzymatic properties, huge application potential and room for modification, and can be further optimized according to different application scenarios. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other implementation schemes can be obtained based on these drawings without creative effort.

[0022] Figure 1 The protein purification results obtained in Example 2 are shown.

[0023] Figure 2 This is a schematic diagram illustrating the principle of polymerization activity detection.

[0024] Figure 3 The results are from the exoclease activity assay.

[0025] Figure 4 The results are from the elongation rate test.

[0026] Figure 5 The results are obtained by amplifying target gene fragments of different lengths using the 36°N DNA polymerase of the present invention. Detailed Implementation

[0027] The present invention will be described in detail below. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0029] In the context of this invention, many embodiments use the expressions "comprising," "including," or "basically / mainly composed of...". The expressions "comprising," "including," or "basically / mainly composed of..." are generally understood as open-ended expressions, indicating that they include not only the elements, components, parts, or method steps specifically listed after the expression, but also other elements, components, parts, or method steps. Additionally, in this document, the expressions "comprising," "including," or "basically / mainly composed of..." can also be understood as closed-ended expressions in certain circumstances, indicating that they include only the elements, components, parts, or method steps specifically listed after the expression, and exclude any other elements, components, parts, or method steps. Furthermore, in the context of this invention, many embodiments use the expression "composed of...", which should be understood as a closed-ended expression, indicating that it includes only the elements, components, parts, or method steps specifically listed after the expression, and excludes any other elements, components, parts, or method steps.

[0030] In this document, references to nucleic acid sequences include the sequence itself, its inverse complementary sequence, and the complementary double-stranded sequence formed by them. Those skilled in the art will understand how to derive the inverse complementary sequence from a nucleic acid sequence. The function of a sequence as referred to herein includes either the sequence itself possessing that function, or its inverse complementary sequence possessing that function.

[0031] In this article, as long as it does not contradict common sense in the field, mentioning nucleic acid sequences is equivalent to mentioning any one or more of the corresponding DNA, RNA, DNA double strand, RNA double strand, and DNA-RNA double strand.

[0032] As used herein, unless otherwise specified, “G”, “C”, “A”, “T” and “U” in a nucleotide sequence typically represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively.

[0033] As used herein, unless otherwise specified, amino acids are generally represented by single-letter or three-letter abbreviations known in the art. For example, alanine can be represented by Ala or A, glycine by Gly or G, valine by Val or V, leucine by Leu or L, isoleucine by Ile or I, proline by Pro or P, phenylalanine by Phe or F, tyrosine by Tyr or Y, tryptophan by Trp or W, serine by Ser or S, threonine by Thr or T, cysteine ​​by Cys or C, methionine by Met or M, asparagine by Asn or N, glutamine by Gln or Q, aspartic acid by Asp or D, glutamic acid by Glu or E, lysine by Lys or K, arginine by Arg or R, and histidine by His or H.

[0034] In this paper, the term "identity" is used to refer to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are considered identical at that position when a position is occupied by the same base or amino acid monomeric subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT have 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be performed using, for example, a computer program such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48: 443-453. The algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) which has been integrated into the ALIGN program (version 2.0) can also be used to determine the percentage identity between two amino acid sequences using the PAM120 weight residue table, a 12-bit nick length penalty, and a 4-bit nick penalty.

[0035] In this article, the term "polymerase function" includes 5'→3' polymerase activity, and in some cases further includes 3'→5' exonuclease activity. 5'→3' polymerase activity refers to the ability of DNA polymerase to synthesize new DNA molecules from the 5' end to the 3' end using parental DNA as a template in the presence of primers, while 3'→5' exonuclease activity refers to the ability of DNA polymerase to excise abnormalities or errors in the newly synthesized DNA strand.

[0036] As used herein, the term “degenerate sequence” refers to the phenomenon that the same amino acid is encoded by two or more codons, which includes all possible sequences of different base sequences encoding a single amino acid.

[0037] As described in the background section of this application, the available enzyme backbones for high-fidelity DNA polymerases are very limited. Therefore, there is an urgent need in the art for a novel DNA polymerase that provides a high-quality initial protein backbone for the development of high-fidelity DNA polymerases with strong and sustained synthetic capabilities.

[0038] Therefore, addressing the problems existing in the prior art, the inventors sampled, extracted nucleic acids, performed metagenomic sequencing, and sequence alignment on sediments from hydrothermal fields near Palaeochori Bay. The results revealed a protein (SEQ ID NO: 2) from *Thermococcus sp.*, which was verified to be a novel DNA polymerase with good thermostability, 5'→3' polymerase activity, 3'→5' exonuclease activity, and good PCR amplification performance. Thus, this invention was completed.

[0039] Therefore, in a first aspect, the present invention provides a DNA polymerase comprising:

[0040] a) The amino acid sequence as shown in SEQ ID NO: 2;

[0041] b) An amino acid sequence having one or more substitutions, deletions, and / or additions of amino acids and possessing polymerase function, compared to the amino acid sequence shown in SEQ ID NO: 2; or

[0042] c) An amino acid sequence having at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and having polymerase function.

[0043] Experiments have shown that this DNA polymerase, specifically the 36°N DNA polymerase described below, exhibits good thermostability and high amplification performance under various reaction conditions. Furthermore, the natural backbone structure of this 36°N DNA polymerase endows it with unique 5'→3' polymerase activity and 3'→5' exonuclease activity, effectively reducing mismatch rates and significantly improving the accuracy of amplified products during DNA synthesis. Moreover, this 36°N DNA polymerase can serve as a core backbone, and combined with directed evolution technology, polymerase variants suitable for different temperatures, pH values, and ion concentrations can be developed to meet the requirements of various experimental systems, thus gaining wide application in gene synthesis, molecular diagnostics, sequencing, and other fields.

[0044] In some embodiments, the DNA polymerase further includes a purification tag, an epitope tag, and / or a solubilization tag.

[0045] In some implementations, the purification tag, epitope tag, and / or solubilization tag are linked to the N-terminus or C-terminus of the DNA polymerase.

[0046] In some embodiments, the purification tag is selected from at least one of Poly-Arg, Poly-His, Strep-TagⅡ, S-tag, FLAG, and GFP.

[0047] In some embodiments, the epitope tag is selected from at least one of C-myc, HA, V5, and VSV-G.

[0048] In some embodiments, the solubilizing tag is selected from at least one of Trx, SUMO, GST, MBP, and NusA.

[0049] Those skilled in the art will understand that adding additional tag sequences to the N-terminus or C-terminus of the DNA polymerase amino acid sequence aims to improve the expression level, solubility, and stability of the exogenous expressed protein, or to facilitate the purification process after protein expression. These additional tag sequences do not affect the functional activity of the DNA polymerase itself.

[0050] In a second aspect, the present invention provides an isolated nucleic acid comprising a nucleotide sequence encoding a DNA polymerase of the first aspect of the present invention.

[0051] In some embodiments, the nucleic acid comprises a nucleotide sequence as shown in SEQ ID NO: 1 or a degenerate sequence thereof.

[0052] In a third aspect, the present invention provides an expression vector comprising the nucleic acid of the second aspect of the present invention.

[0053] In some embodiments, the expression vector is a plasmid such as pET28a, pBR322, pUC19, pUCm-T, ColE1, or pET.

[0054] In a fourth aspect, the present invention provides a recombinant cell comprising the nucleic acid of the second aspect of the present invention or the expression vector of the third aspect of the present invention.

[0055] In some implementations, the recombinant cells are eukaryotic cells such as plant cells or animal cells, or prokaryotic cells such as Escherichia coli.

[0056] In some preferred embodiments, the recombinant cells are Escherichia coli BL21(DE3) strain.

[0057] Through genetic engineering, nucleic acids containing the DNA polymerase encoding the first aspect of the present invention or expression vectors containing nucleic acids encoding the DNA polymerase of the first aspect of the present invention can be transferred into suitable cells. These cells can express the DNA polymerase in large quantities under suitable conditions and can be used as bioreactors.

[0058] In a fifth aspect, the present invention provides a method for amplifying a target nucleic acid, the method comprising the step of amplifying a target nucleic acid present in a sample using a DNA polymerase of the first aspect of the present invention.

[0059] In a sixth aspect, the present invention provides a method for constructing a nucleic acid library, the method comprising the step of amplifying a target nucleic acid present in a sample using the DNA polymerase of the first aspect of the present invention.

[0060] The following description applies to the fifth and sixth aspects of the present invention.

[0061] In some implementations, the method for constructing a nucleic acid library further includes the step of adding sequencing adapters to the amplified products. By adding sequencing adapters, a sequencing library can be constructed, which can then be sequenced and analyzed on a suitable sequencing platform.

[0062] In some implementations, the target nucleic acid amplified by the DNA polymerase is at most 8kb in length, such as 1kb, 2kb, 3kb, 4kb, 5kb, 6kb, 7kb, or 8kb, or any length in between.

[0063] In some embodiments, the concentration of the DNA polymerase used is 0.05-1 mg / mL, for example 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, or 1 mg / mL, or any concentration between these values.

[0064] In some preferred embodiments, the concentration of the DNA polymerase used is 0.2 mg / mL.

[0065] In some implementations, the amplification step is carried out at a reaction temperature of 65-75°C (e.g., 67°C, 70°C, 72°C).

[0066] In some preferred embodiments, the amplification step is carried out at a reaction temperature of 72°C.

[0067] In some implementations, the amplification step is performed in a PCR reaction buffer containing a buffer system such as Tris-HCl, K + Mg 2+ Serum albumin, ammonium sulfate, and nonionic detergents such as a mixture of Tween-20 and NP-40.

[0068] In some preferred embodiments, the PCR reaction buffer contains Tris-HCl (pH 8.0-9.0), KCl, MgCl2, bovine serum albumin, ammonium sulfate, and a mixture of nonionic detergents such as Tween-20 and NP-40.

[0069] In some preferred embodiments, the PCR reaction buffer comprises a 100-300 mM Tris-HCl (pH 8.0-9.0) buffer system and a 100-500 mM K+ buffer. + 1-100mM Mg 2+ 1-5 mg / mL serum albumin, 10-500 mM ammonium sulfate and 1%-10% nonionic detergent such as a mixture of Tween-20 and NP-40.

[0070] In some more preferred embodiments, the PCR reaction buffer comprises a mixture of 200 mM Tris-HCl (pH 8.4), 250 mM KCl, 15 mM MgCl2, 3.6 mg / mL bovine serum albumin, 100 mM ammonium sulfate, 2% Tween-20 and 2% NP-40.

[0071] In a seventh aspect, the present invention provides a kit comprising the DNA polymerase of the first aspect of the present invention.

[0072] In some implementations, the kit also includes PCR reaction buffer, dNTPs, and betaine.

[0073] It is understood that the descriptions of the first to sixth aspects of the present invention given above also apply to the seventh aspect of the present invention. Therefore, for the sake of brevity, they will not be repeated here.

[0074] Example

[0075] The embodiments of the present invention will be described in detail below with reference to examples. Those skilled in the art will understand that the following examples are merely illustrative and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0076] Example 1 - Sequence Alignment

[0077] The amino acid sequence shown in SEQ ID NO:2 (named 36°N protein) was aligned with KOD DNA polymerase and Pfu DNA polymerase using the Clustal Omega online sequence alignment website (http: / / www.clustal.org). The specific alignment results are shown below:

[0078]

[0079]

[0080]

[0081] The sequence alignment results above show that the 36°N protein of the present invention has 85.14% and 76.61% sequence identity with KOD DNA polymerase and Pfu DNA polymerase, respectively. Based on this, it is preliminarily inferred that the protein has the function of B family DNA polymerase.

[0082] Example 2 - Construction, expression and purification of recombinant plasmids

[0083] The gene sequence of the 36°N protein was synthesized by Changzhou Xinyisheng Life Technology Co., Ltd., and the gene was cloned into the pET28a expression vector at the Nde I and Xho I cloning sites. The recombinant plasmid was transformed into E. coli BL21(DE3) competent cells and incubated overnight at 37°C for subsequent expression and purification.

[0084] The affinity chromatography column and cation exchange column used for the purification of the 36°N protein were a HisTrap FF 5mL and a HiTrap SP HP 5mL, respectively. The specific purification steps included:

[0085] 1) Pick 3-6 healthy single colonies from the plate and inoculate them into a 250mL LB liquid conical flask. Incubate at 37℃ for 5-7 hours until OD (dose retardation). 600The bacterial culture was then inoculated into 5 L of LB medium at a rate of 1% (v / v) and incubated at 37°C for 2-4 h until the OD value reached 0.6-4.0. 600 The concentration was increased to 0.8-1.0. The original shaker was pre-cooled to 16°C. Isopropyl-β-D-thiogalactoside (IPTG) was added to the culture medium to a final concentration of 0.5 mM. The culture was then placed in a shaker at 16°C and 220 rpm to induce expression for 12-16 h.

[0086] 2) Collect bacterial cells by centrifugation at 8000g for 30 min, then resuspend the bacterial cells in affinity A buffer at a ratio of 1:10, and sonicate them in an ice bath to obtain a sonicated whole bacterial solution. Centrifuge the obtained whole bacterial solution at 12000rpm at 4℃ for 30 min to obtain the supernatant and broken bacterial cells.

[0087] 3) Heating treatment: Preheat the water bath to 75-80℃, then put the supernatant obtained after crushing and centrifuging into the water bath, shake and mix well, and use a clean thermometer to detect the internal temperature of the bacterial solution. When the internal temperature reaches 75℃, start the timer for 30 minutes, shaking and mixing 3 times every 10 minutes during the process to ensure uniform heating.

[0088] 4) Centrifuge the heat-treated ultrasonically disrupted fluid at 12000 rpm at 4℃ for 60 min to obtain the supernatant. Filter the supernatant through a 0.22 μM filter membrane to obtain the filtered supernatant.

[0089] 5) Load the supernatant filtered in step 4) into the pretreated chromatography column (HisTrapFF) at a rate of 3 mL / min and collect the flow-through. After loading, equilibrate with Ni column affinity A buffer for 20 column volumes and collect the elution buffer. Then, perform linear elution with 0-70% Ni column affinity B buffer at 10.5 column volumes (CV) and collect the eluent. Collect the eluted protein when the UV absorption peak reaches 50 mAu and stop collecting when the UV absorption peak drops to 200 mAu.

[0090] 6) Dilute the eluent collected in step 5) (eluent with UV absorption peak between 50 mAu and 200 mAu) 10-fold with diluent and load it onto the pretreated SP column (HiTrap SP HP 5 mL). After loading, rinse with SP column A buffer for 30 CV until the baseline is stable at a flow rate of 5 mL / min.

[0091] 7) Elute the target protein using a gradient of SP column B buffer (0-70% SP column B buffer, 20 CV) at a flow rate of 5 mL / min. Collect 1-3 liters of SP column eluent, which is the target protein. Perform SDS-PAGE analysis on the collected samples to determine protein purity.

[0092] 8) After dialysis and concentration determination, the purified protein sample is stored in a storage solution for subsequent functional activity analysis.

[0093] The specific components of the buffer solution used in the above purification process are shown below:

[0094] Ni column affinity A buffer: 20 mM Tris-HCl (2.42 g / L), 500 mM NaCl (29.22 g / L), 20 mM imidazole (1.36 g / L), 5% glycerol (62.5 g / L), pH 7.5.

[0095] Ni column affinity B buffer: 20 mM Tris-HCl (2.42 g / L), 500 mM NaCl (29.22 g / L), 500 mM imidazole (34.04 g / L), 5% glycerol (62.5 g / L), pH 7.5.

[0096] SP column-A buffer: 20mM Tris-HCl (2.42g / L), 50mM NaCl (2.92g / L), 5% glycerol (62.5g / L), pH 7.5.

[0097] SP column-B buffer: 20mM Tris-HCl (2.42g / L), 1M NaCl (58.44g / L), 5% glycerol (62.5g / L), pH 7.5.

[0098] Diluent: 20 mM Tris-HCl (2.42 g / L), 5% glycerol (62.5 g / L), pH 7.5.

[0099] 2X dialysis buffer: 40mM Tris-HCl, 200mM KCl, 2mM dithiothreitol (DTT) (0.154g / L), 0.2mM ethylenediaminetetraacetic acid (EDTA) (0.0884g / L), 5% glycerol, pH 8.0, 25℃.

[0100] Stock solution: 10 mM Tris-HCl (1.2114 g / L), 100 mM KCl (7.455 g / L), 1 mM DTT (0.15425 g / L), 0.1 mM EDTA (0.037224 g / L), 50% glycerol (625 g / L), pH 7.5, 25℃.

[0101] Polyacrylamide gel electrophoresis was used to detect the following samples: whole bacterial culture after ultrasonic disruption, supernatant after centrifugation of the whole bacterial culture, supernatant after heat treatment and centrifugation, flow-through buffer after Ni column loading, equilibration buffer for Ni column equilibration, elution buffer for Ni column purification, and elution buffer for SP column purification (1-3). Results are as follows: Figure 1 As shown in the figure, the purified protein has a molecular weight of approximately 91 kDa and a theoretical isoelectric point of approximately 8.7.

[0102] Example 3 - Thermal Stability Determination

[0103] Using Protein Thermal Shift TM Protein stability was determined using a ThermoFisher dye kit. KOD DNA polymerase and Pfu DNA polymerase were used as controls. The reaction mixture consisted of: 5 μL Protein Thermal Shift Buffer, 2 μL of the test protein (purity >90%, concentration 1.2 mg / mL), 2.5 μL 8× Protein thermal shift dye, and 10.5 μL nuclease-free (NF) water. After mixing, the mixture was placed in a qPCR instrument and subjected to temperature increases from 25-99°C. ROX fluorescence signal changes were monitored simultaneously. The results are shown in Table 1. It can be seen that the 36°N protein disclosed in this invention exhibits good thermal stability; its Tm value is comparable to that of KOD DNA polymerase and higher than that of Pfu DNA polymerase.

[0104] Table 1: Results of Thermal Stability Measurement

[0105] name Tm (°C) 36°N protein 95.34 KOD DNA polymerase 95.80 Pfu DNA polymerase 92.60

[0106] Example 4 - Polymerization Activity Assay

[0107] Polymerization activity was measured using primed M13 single-stranded DNA (ssDNA) substrate. The specific principle is as follows: Figure 2 As shown, in the presence of polymerization activity, the primers on the primed M13 ssDNA extend along the ssDNA in the 5'→3' direction, generating double-stranded DNA (dsDNA), which can be quantitatively detected using the Qubit dsDNA HS Assay Kits. The specific reaction system and components used for the polymerization activity assay are shown in Table 2 below.

[0108] Table 2: Reaction system and components for polymer activity determination

[0109]

[0110]

[0111] After incubating the above reaction solution at 72°C for 5 minutes, 2 μL of 0.5M EDTA was added to terminate the reaction, and the dsDNA concentration was determined using a Qubit kit. The negative control (NC) was a reaction system without 36°N protein. The results are shown in Table 3 below (Qubit values ​​are the values ​​after subtracting the negative control (NC)).

[0112] Table 3: Results of dsDNA Concentration Measurement

[0113] DNA polymerase Reaction conditions △Qubit value (ng / μL) 36°N protein 72℃ / 5min 32.2

[0114] The results above show that the 36°N protein has DNA polymerization activity at 72°C, so it can be considered that the protein is a DNA polymerase, and will be referred to as 36°N DNA polymerase in the following text.

[0115] Example 5 - Exonuclease Activity Assay (3'→5' Exonuclease Activity)

[0116] The exonuclease activity of 36°N DNA polymerase was qualitatively confirmed using a terminal mismatch fluorescent probe method (reaction at 37°C for 1 h). The probe sequences used were ATCAGCAGGCCACACGTTAAACTGT-BHQ2 (SEQ ID NO: 3) and FAM-5'-TGTCTTTAACGTGTGGCCTGCTGAT (SEQ ID NO: 4). The reaction system used for the exonuclease activity assay was as follows: 2.5 μL 10× The reaction mixture consisted of 0.25 μL of 10 μM fluorescent probe substrate, 2 μL of enzyme solution (enzyme concentration of 0.2 mg / mL), and 20.25 μL of NF-water. The negative control (NC) group used the same reaction system, replacing the enzyme solution component with the appropriate enzyme stock solution. The positive control (PC) group also used the same reaction system, but with the known B-family DNA polymerase KOD. The reaction mixture was prepared on ice, with a total volume of 25 μL. The reaction was carried out in 384-well plates, and then the plates were placed in a microplate reader for fluorescence detection. The excitation and emission wavelengths were set to 494 nm and 522 nm, respectively. Fluorescence signals were collected every 30 seconds, and the entire reaction time was 1 hour. Results are as follows: Figure 3 As shown (where the fluorescence values ​​have been subtracted from the corresponding blank control values). Figure 3 The results showed that, similar to KOD DNA polymerase, 36°N DNA polymerase has 3'→5' exonuclease activity, which can ensure the correction function of DNA polymerase in the PCR process.

[0117] Example 6 - PCR Performance Test (PCR Amplification Extension Rate Test)

[0118] To test the amplification rate of 36°N DNA polymerase in PCR applications, PCR amplification experiments were performed using the reaction system shown in Table 4 and the reaction procedure shown in Table 5. Specifically, different extension times were used to amplify the 2kb target gene fragment, and the amplification effect was detected by agarose gel electrophoresis. The template substrate used was λDNA, and the amplification primers used were:

[0119] Forward primer λF: CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 5)

[0120] Reverse primer λ-2R (2kb): CCATGATTCAGTGTGCCCGTCTGG (SEQ ID NO: 6)

[0121] Table 4: PCR reaction system

[0122] Components Volume (μL) 10× reaction buffer 2.5 5M betaine 2.5 10mM dNTPs 1.25 25 ng / μL λDNA 1 10 μM forward primer λF 1 10 μM reverse primer λ-2R (2 kb) 1 0.2 mg / mL DNA polymerase 0.5 NF Water 15.25

[0123] The 10× reaction buffer used for 36°N DNA polymerase amplification was: 200mM Tris-HCl (pH 8.4), 250mM KCl, 15mM MgCl2, 3.6mg / mL bovine serum albumin (BSA), 100mM ammonium sulfate, and a mixture of 2% Tween-20 and 2% NP-40.

[0124] Table 5: PCR reaction procedure

[0125]

[0126] PCR amplification results as follows Figure 4 As shown, the 36°N DNA polymerase can amplify a relatively clear main target band with an extension time of 60 s. This result indicates that the 36°N DNA polymerase has a high PCR amplification rate, approximately greater than 2 kb / min.

[0127] Example 7 - PCR Performance Test (Amplification of Target Gene Fragments of Different Lengths)

[0128] To test the amplification capacity of 36°N DNA polymerase, PCR amplification experiments were performed using the reaction system shown in Table 6 and the reaction procedure shown in Table 7 to amplify target gene fragments of different lengths. The template substrate used was λDNA, and the amplification primers used were:

[0129] Forward primer λF: CCTGCTCTGCCGCTTCACGC (SEQ ID NO: 7)

[0130] Reverse primer:

[0131] λ-2R (2kb): CCATGATTCAGTGTGCCCGTCTGG (SEQ ID NO: 8)

[0132] λ-4R (4kb): CCAGGACTATCCGTATGACTACG (SEQ ID NO: 9)

[0133] λ-6R (6kb): GAGATGGCATATTGCTACGCAAGA (SEQ ID NO: 10)

[0134] λ-8R (8kb): GCCCTCGTTGCGTTTTGTTTGCACG (SEQ ID NO: 11)

[0135] λ-10R (10kb): GCACAGAAGCTATTATGCGTCCCCAGG (SEQ ID NO: 12)

[0136] λ-12R (12kb):TCTTCCTCGTGCATCGAGCTATTCGG (SEQ ID NO: 13)

[0137] λ-15R (15kb): CTTGTTCCTTTGCCGCGAGAATGG (SEQ ID NO: 14)

[0138] Using λDNA as a template, the target gene fragments of 2kb, 4kb, 6kb, 8kb, 10kb, 12kb, and 15kb were amplified using the aforementioned forward and reverse primers, respectively.

[0139] Table 6: PCR reaction system

[0140] Components Volume (μL) 10× reaction buffer 2.5 5M betaine 2.5 10mM dNTPs 1.25 25 ng / μL λDNA 1 10 μM forward primer λF 1 10μM reverse primer 1 0.3 mg / mL DNA polymerase 0.5 NF Water 15.25

[0141] The 10× reaction buffer used for 36°N DNA polymerase amplification was: 200mM Tris-HCl (pH 8.4), 250mM KCl, 15mM MgCl2, 3.6mg / mL BSA, 100mM ammonium sulfate, and a mixture of 2% Tween-20 and 2% NP-40.

[0142] Table 7: PCR reaction procedure

[0143]

[0144] PCR amplification results Figure 5As shown in the figure, the results indicate that the 36°N DNA polymerase can amplify the corresponding 8kb target band.

Claims

1. A DNA polymerase comprising: a) The amino acid sequence as shown in SEQ ID NO: 2; b) An amino acid sequence having one or more substitutions, deletions, and / or additions of amino acids and possessing polymerase function, compared to the amino acid sequence shown in SEQ ID NO: 2; or c) An amino acid sequence having at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and having polymerase function.

2. The DNA polymerase according to claim 1, further comprising a purification tag, an epitope tag, and / or a solubilization tag; Preferably, the purification tag, epitope tag, and / or solubilization tag are linked to the N-terminus or C-terminus of the DNA polymerase; Preferably, the purification tag is selected from at least one of Poly-Arg, Poly-His, Strep-Tag II, S-tag, FLAG, and GFP; Preferably, the epitope tag is selected from at least one of C-myc, HA, V5, and VSV-G; Preferably, the solubilizing tag is selected from at least one of Trx, SUMO, GST, MBP and NusA.

3. An isolated nucleic acid comprising encoding the DNA of claim 1 or 2. The nucleotide sequence of the polymerase.

4. The nucleic acid according to claim 3, wherein the nucleic acid comprises a nucleotide sequence as shown in SEQ ID NO: 1 or a degenerate sequence thereof.

5. An expression vector comprising the nucleic acid of claim 3 or 4.

6. The expression vector according to claim 5, wherein the expression vector is a plasmid, such as pET28a, pBR322, pUC19, pUCm-T, ColE1, or pET.

7. A recombinant cell comprising the nucleic acid of claim 3 or 4 or the expression vector of claim 5 or 6.

8. The recombinant cell according to claim 7, wherein the recombinant cell is a eukaryotic cell such as a plant cell or an animal cell, or a prokaryotic cell such as Escherichia coli; preferably, the recombinant cell is Escherichia coli BL21(DE3) strain.

9. A method for amplifying a target nucleic acid, the method comprising the step of amplifying the target nucleic acid present in a sample using the DNA polymerase of claim 1 or 2.

10. A method for constructing a nucleic acid library, the method comprising the step of amplifying a target nucleic acid present in a sample using the DNA polymerase of claim 1 or 2.

11. The method of claim 10, further comprising the step of adding sequencing adapters to the amplified product.

12. The method according to any one of claims 9-11, wherein the target nucleic acid amplified by the DNA polymerase is at most 8 kb in length.

13. The method according to any one of claims 9-11, wherein the concentration of the DNA polymerase used is 0.05-1 mg / mL, preferably 0.2 mg / mL; Preferably, the amplification step is carried out at a reaction temperature of 65-75°C, more preferably 72°C.

14. The method according to any one of claims 9-11, wherein the amplification step is performed in a PCR reaction buffer, the PCR reaction buffer comprising a buffer system such as Tris-HCl, K + Mg 2+ Serum albumin, ammonium sulfate, and nonionic detergents such as a mixture of Tween-20 and NP-40; Preferably, the PCR reaction buffer contains Tris-HCl (pH 8.0-9.0), KCl, MgCl2, bovine serum albumin, ammonium sulfate, and a mixture of nonionic detergents such as Tween-20 and NP-40; More preferably, the PCR reaction buffer comprises a 100-300 mM Tris-HCl (pH 8.0-9.0) buffer system and a 100-500 mM K+ buffer. + 1-100mM Mg 2+ 1-5 mg / mL serum albumin, 10-500 mM ammonium sulfate and 1%-10% nonionic detergent such as a mixture of Tween-20 and NP-40; More preferably, the PCR reaction buffer comprises a mixture of 200 mM Tris-HCl (pH 8.4), 250 mM KCl, 15 mM MgCl2, 3.6 mg / mL bovine serum albumin, 100 mM ammonium sulfate, 2% Tween-20 and 2% NP-40.

15. A kit comprising the DNA polymerase of claim 1 or 2.

16. The kit according to claim 15, further comprising PCR reaction buffer, dNTPs, and betaine.

17. The kit of claim 16, wherein the reaction buffer comprises a buffer system such as Tris-HCl, K + Mg 2+ Serum albumin, ammonium sulfate, and nonionic detergents such as a mixture of Tween-20 and NP-40; Preferably, the PCR reaction buffer contains Tris-HCl (pH 8.0-9.0), KCl, MgCl2, bovine serum albumin, ammonium sulfate, and a mixture of nonionic detergents such as Tween-20 and NP-40; More preferably, the PCR reaction buffer comprises a 100-300 mM Tris-HCl (pH 8.0-9.0) buffer system and a 100-500 mM K+ buffer. + 1-100mM Mg 2+ 1-5 mg / mL serum albumin, 10-500 mM ammonium sulfate and 1%-10% nonionic detergent such as a mixture of Tween-20 and NP-40; More preferably, the PCR reaction buffer comprises a mixture of 200 mM Tris-HCl (pH 8.4), 250 mM KCl, 15 mM MgCl2, 3.6 mg / mL bovine serum albumin, 100 mM ammonium sulfate, 2% Tween-20 and 2% NP-40.

Images